ID: 948171768

View in Genome Browser
Species Human (GRCh38)
Location 2:235909556-235909578
Sequence TCTGATGAGCAGACATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948171768_948171777 30 Left 948171768 2:235909556-235909578 CCTTCCCATGTCTGCTCATCAGA 0: 1
1: 0
2: 1
3: 16
4: 249
Right 948171777 2:235909609-235909631 ATAAACACACACACAGAGTCAGG 0: 1
1: 1
2: 31
3: 207
4: 1345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948171768 Original CRISPR TCTGATGAGCAGACATGGGA AGG (reversed) Intronic
900481534 1:2901878-2901900 TCTGATGAGGACACTTGTGATGG - Intergenic
900626033 1:3609079-3609101 TCTGATGAGCAGGCAGGGCTTGG - Intronic
901369308 1:8782939-8782961 TGTCAGGAGCTGACATGGGAAGG - Intronic
901539535 1:9906773-9906795 TCTGATGAAAAGACAGGGGCAGG + Intronic
901581499 1:10247868-10247890 TCTGATGATCTGAGATGGAACGG - Intronic
901946808 1:12710949-12710971 TCTGAGGAGGAGACATTAGATGG + Intergenic
902521752 1:17021980-17022002 TCTGATGTGCAGGCATGAGAAGG + Intronic
903102754 1:21047280-21047302 TTTGATGAGCTTCCATGGGAGGG - Intronic
903356472 1:22751186-22751208 TCTGAAGAACAGAGAGGGGATGG + Intronic
908785164 1:67728473-67728495 TCTGAAGAGCAAGCAAGGGAGGG - Intronic
911980170 1:104557395-104557417 TCTGAAGAATAGGCATGGGAAGG + Intergenic
912082337 1:105952128-105952150 TCTGGTGTGCAGACAGGGGCAGG - Intergenic
915356436 1:155257710-155257732 TAGGATGAGCATAGATGGGAAGG - Intronic
916280600 1:163047274-163047296 TCTTATGAGCAGTTATTGGATGG + Intergenic
917668954 1:177253922-177253944 TATGATGAGCAGATTTGGGATGG + Intronic
918034264 1:180851722-180851744 TCTGATGATCTGATCTGGGAAGG + Intronic
918092509 1:181309726-181309748 TCTGAAGAGCATATTTGGGAAGG - Intergenic
919137105 1:193523708-193523730 TCTGATATGTAGACCTGGGATGG + Intergenic
919656021 1:200197939-200197961 TCTGATGAGCAGGTCTGGAATGG + Intergenic
919986903 1:202681777-202681799 TCAGCTGAGCAGTCAGGGGATGG + Intronic
920845841 1:209592432-209592454 TCTCATGAGCTGACATGAGCCGG + Intronic
922987174 1:229874790-229874812 GCTGATGAGCACCCAGGGGAAGG + Intergenic
923018184 1:230142962-230142984 TCTGAAGAGCAGCCACAGGAAGG - Intronic
924559390 1:245144911-245144933 ACTGATGTGCAGAGATGGCAAGG - Intergenic
1063102615 10:2963571-2963593 TCTGAGGTGGGGACATGGGAGGG - Intergenic
1064016076 10:11773291-11773313 CCTGAACAGCAGACATTGGATGG - Intergenic
1065087573 10:22194780-22194802 TCTGATCAGTAGCCAAGGGAGGG - Intergenic
1066293411 10:34034137-34034159 TCAGCTGAGCAGCCATGGGTGGG + Intergenic
1068293687 10:55038647-55038669 TCTGATGGGCAGTTGTGGGACGG + Intronic
1068628093 10:59271121-59271143 TCTGTTGAGCAAACTTGAGAAGG - Intronic
1069223037 10:65907278-65907300 TCCGAGGAGCAGCCATGGGGTGG - Intergenic
1069513778 10:69061392-69061414 TCTGAAGATTAAACATGGGATGG + Intergenic
1071472738 10:85995598-85995620 TCTGATGAGTAAACATGAGCAGG + Intronic
1073248341 10:102107073-102107095 TCAGTTGGGCAGGCATGGGATGG - Intergenic
1074184067 10:111086148-111086170 TCTGAGCCACAGACATGGGATGG - Intergenic
1074193253 10:111156423-111156445 TCTGATGGGCAAGCCTGGGAAGG - Intergenic
1075198742 10:120383492-120383514 TCTTTTGGGTAGACATGGGATGG + Intergenic
1075903151 10:126059379-126059401 TCTGAAGAAGAGAGATGGGAAGG - Intronic
1077662283 11:4080344-4080366 TCTGATGGGAAGACAAGAGATGG - Intronic
1079141634 11:17814552-17814574 CCTGATGAATACACATGGGATGG + Intronic
1079613476 11:22462090-22462112 GATGATGAGGAGAAATGGGAAGG - Intergenic
1080853397 11:36090898-36090920 CCTGTTGAGCAGACTTAGGAAGG + Intronic
1084541129 11:69787865-69787887 TCTGATGGGCACATAGGGGAAGG - Intergenic
1085998130 11:81947291-81947313 TCTGATGATCTGACATCCGAGGG - Intergenic
1086812463 11:91327810-91327832 TCTGATGAGCAGCAGTGGGAGGG + Intergenic
1087026338 11:93653522-93653544 TCTTAGGAGCAAAGATGGGAGGG + Intergenic
1087734506 11:101816897-101816919 TCTGGGCAGCAGACATGTGAAGG - Intronic
1088436119 11:109814985-109815007 TCTGATGGGAAGCCATTGGAAGG + Intergenic
1089387602 11:118078488-118078510 GCTGATGATCAGAAAGGGGAAGG + Intronic
1089588981 11:119528535-119528557 TCAGATCAGAGGACATGGGAGGG - Intergenic
1090368098 11:126224889-126224911 TCTGCAGAGCATTCATGGGATGG - Intronic
1090959327 11:131542174-131542196 TCTAATGAGCCCACAGGGGATGG + Intronic
1091296749 11:134479280-134479302 TTTGATGAGCACACATTCGATGG - Intergenic
1092972143 12:13706625-13706647 TTTGATGGTCAGACATGGGGAGG - Intronic
1094602067 12:31917759-31917781 TCTGCTGGGCACACAAGGGAAGG + Intergenic
1097730201 12:63120630-63120652 TCTGATGAGCAGAACTGGGTTGG + Intergenic
1098053815 12:66482309-66482331 CCTGATGAGCTGACATGGCTGGG + Intronic
1101741103 12:107500662-107500684 TCTCATGTGCAGCCATGAGATGG - Intronic
1103021975 12:117541311-117541333 GCTGATGTGGAGGCATGGGAGGG + Intronic
1103959998 12:124603456-124603478 ACTGATGAGCAGCCAGGGCAGGG + Intergenic
1104497612 12:129255691-129255713 TCTGTAGAACAGAGATGGGATGG - Intronic
1104720775 12:131043940-131043962 TCTGAGGAGCAGAGTTGGGAGGG + Intronic
1106310347 13:28548777-28548799 TTTGATGAGCACACAGGTGATGG + Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1111850832 13:93572473-93572495 TCTGTTTAGCAGATCTGGGATGG - Intronic
1112596885 13:100815638-100815660 TCAGATGAGAAGACAGGGCATGG + Intergenic
1112865528 13:103891917-103891939 ACTGCTGATCTGACATGGGATGG - Intergenic
1113571916 13:111363816-111363838 GCTGATGGGCAGCTATGGGAAGG + Intergenic
1114191927 14:20446052-20446074 TCTGAAGAGCATAAATGTGAAGG + Intergenic
1114466378 14:22925758-22925780 TCTGGTGAGCTGAGATGGTATGG + Intronic
1114531714 14:23400610-23400632 GCTGTGGACCAGACATGGGAAGG - Intronic
1114536930 14:23428856-23428878 GCTGTGGACCAGACATGGGAAGG - Intronic
1121412954 14:93760467-93760489 TCTGAAGAGCAGAATAGGGAGGG - Intronic
1121518442 14:94569596-94569618 ACAGATGAGCAGCCCTGGGAGGG - Exonic
1121735036 14:96212539-96212561 TTTGAAGAGCAGACAGGAGAAGG + Intronic
1124932339 15:34133375-34133397 TTTGGTGGGCTGACATGGGAGGG + Intergenic
1127811847 15:62572003-62572025 TCTGATGTGCTGATATGGGAGGG + Intronic
1128240824 15:66099976-66099998 TCTGAGGACCAGACACGGAAAGG - Intronic
1128776813 15:70326689-70326711 TGTGAGGAGCAGACATCCGATGG + Intergenic
1128983138 15:72200642-72200664 CCTGGTGAGCAGACCTGAGATGG + Exonic
1134746896 16:16595478-16595500 GCTGATGAGCAGCCACAGGATGG + Intergenic
1134998578 16:18758185-18758207 GCTGATGAGCAGCCACAGGATGG - Intergenic
1137253748 16:46758684-46758706 TCTGACGCCCAGAGATGGGAAGG + Intronic
1137751028 16:50861232-50861254 TCTGGGGAGCAGGCATGGGTGGG - Intergenic
1138931118 16:61657148-61657170 ACTGATGATCAGAAATTGGATGG - Intronic
1140192740 16:72832115-72832137 GCTGCTCAGCAGACATGGGAAGG + Intronic
1140208467 16:72952337-72952359 CCTACTGAGAAGACATGGGAGGG - Intronic
1142271258 16:89090732-89090754 TCTGGTGAGCAGGAAGGGGAGGG - Intronic
1144237390 17:13274810-13274832 TCTGATGAGAAAAAAAGGGAAGG + Intergenic
1144394110 17:14826908-14826930 TCTGATGAGCAGATCTGAGTTGG - Intergenic
1145414293 17:22702696-22702718 GGTGATGAGCAGCCATGGGGTGG + Intergenic
1145960875 17:28885947-28885969 TCTGAGGAGCAGCCAGGGGGTGG + Intronic
1147457714 17:40548741-40548763 TCTGATGAGCATGGGTGGGAGGG + Intergenic
1149509953 17:57232218-57232240 TCTGCTGAAGAGACATAGGAAGG + Intergenic
1150515951 17:65809320-65809342 ACTGATGAGAAGCCATTGGAGGG + Intronic
1151514339 17:74582503-74582525 TCTGAGGAGCAGACTAAGGAGGG + Intronic
1151816318 17:76473151-76473173 TCTGAGGCTCCGACATGGGAGGG + Intronic
1156816172 18:41314012-41314034 TCTTATCACCAGACATGAGATGG + Intergenic
1157184534 18:45527199-45527221 TCTGATGAGAAGCGTTGGGATGG + Intronic
1157717869 18:49901452-49901474 TTTGATTGGCTGACATGGGAAGG + Intronic
1158526002 18:58214306-58214328 TCACATGAACAGATATGGGATGG - Intronic
1158983499 18:62789119-62789141 TCAGATGAGCACACAGGGGGTGG + Intronic
1159921828 18:74233456-74233478 TGTGATGAGCAGTCATGCGGTGG - Intergenic
1160451731 18:78971060-78971082 TCTGCTTAGAAGACATGGGCCGG + Intergenic
1161002550 19:1918085-1918107 ACGGATGAGCAGGCACGGGAGGG - Intronic
1164386512 19:27775581-27775603 TCTGGTCCTCAGACATGGGAAGG - Intergenic
1166593064 19:44018412-44018434 TATGATGATCAGACATGGTGAGG + Intergenic
1166750108 19:45160486-45160508 AGTGCTGAGCAGACATGGGCTGG + Intronic
1168415467 19:56165065-56165087 TCTGTTGAGCAGTCTAGGGATGG - Intergenic
925189490 2:1871371-1871393 ACTGAGGAGCAGAGATAGGAGGG - Intronic
925487180 2:4348416-4348438 TCAGGTGTGCAGAAATGGGAAGG + Intergenic
925857017 2:8138825-8138847 TCTGATGAGCTGAGCTGGGGAGG - Intergenic
926621066 2:15047809-15047831 AGTGATTAGCAGAGATGGGACGG - Intergenic
929458381 2:42083150-42083172 TTTAATGGGCAGACATGGGCAGG - Intergenic
929626435 2:43413384-43413406 TCTGATTAGCAAAGATGGGTTGG + Intronic
929896321 2:45963711-45963733 TCTGATTAGATGACCTGGGAAGG - Intronic
929917883 2:46151355-46151377 GGTGATGAGCAGAGGTGGGAGGG - Intronic
929918256 2:46154148-46154170 TCGGAGGACCAGACAGGGGAGGG + Intronic
930081147 2:47449826-47449848 TCTGCTGGGCAGAAATGTGATGG - Intronic
933241109 2:79921208-79921230 TCTTATGAGCAGGCATGTTAGGG + Intronic
934575296 2:95396788-95396810 TCTGCTGGGAAGCCATGGGAAGG + Intergenic
935742304 2:106160341-106160363 GCTTATGAGCAGTCGTGGGAAGG - Intronic
936995070 2:118404781-118404803 TCTGAGGAGCAGAGAAAGGATGG + Intergenic
937706558 2:124927461-124927483 TCTGATTAGCACATATGAGAGGG + Intergenic
938098543 2:128479524-128479546 TCTGATAAGCAGCCAAGGAAGGG + Intergenic
939711738 2:145529727-145529749 TCTGAGTAGCAGACATTGAAAGG + Intergenic
939986682 2:148835753-148835775 TGTGATGGGAAGCCATGGGAAGG - Intergenic
941491366 2:166145959-166145981 GATGAGGAGCAGAGATGGGATGG + Intergenic
942484390 2:176423943-176423965 TCTGAAGAGCAGACAGGGAAAGG + Intergenic
945261163 2:207844637-207844659 TTTGATGAGAAAACAAGGGAAGG - Intronic
947817133 2:233045140-233045162 TCTGATGAGGAGATGAGGGAAGG - Intergenic
948003643 2:234589793-234589815 GCTAAAGAGGAGACATGGGACGG + Intergenic
948171768 2:235909556-235909578 TCTGATGAGCAGACATGGGAAGG - Intronic
948230904 2:236348735-236348757 GCTGAAGAGCAGACATGGTCAGG + Intronic
949060854 2:241956560-241956582 GATGATGGGCAGACATGGCAGGG + Intergenic
1169799443 20:9499905-9499927 GCTGAGGAGCAGACAGGGGCAGG + Intergenic
1170070261 20:12358559-12358581 GCTCAGGAGCAGACATGGAAAGG + Intergenic
1170552318 20:17488642-17488664 TCTCCTGAGGAGAAATGGGATGG + Intergenic
1172055279 20:32150470-32150492 GCTGTTGAGAAGACAAGGGAGGG + Intronic
1172601220 20:36184588-36184610 TCACATGTGCTGACATGGGAGGG + Intronic
1173125473 20:40332341-40332363 GCTGATGAGCCGACTTGGCAGGG + Intergenic
1175388185 20:58610584-58610606 GCTGATGAGCAGGGATGGGCGGG - Intergenic
1178250538 21:30999568-30999590 TCTTCTGAGCAGACATGAGGAGG + Intergenic
1178876820 21:36420274-36420296 ACTGTTGAGCAGACAGGGGTGGG + Intergenic
1179647132 21:42782947-42782969 CATGAGGAGCAGGCATGGGAGGG - Intergenic
1180934651 22:19617276-19617298 TCTGATGAGCAGAAGTGTTAAGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183395543 22:37568940-37568962 TCTGCAGGACAGACATGGGAGGG + Exonic
1183864010 22:40690015-40690037 CCAGATGGTCAGACATGGGATGG + Intergenic
1184721187 22:46314478-46314500 TCTGAAGAGCAGAAAGGCGAAGG - Intronic
949347840 3:3093613-3093635 TCTGGTGAGAAAACATGAGAAGG - Intronic
950437427 3:12988667-12988689 TCTGAGGAGCAGGCTGGGGAGGG + Intronic
950718759 3:14867857-14867879 TCAGAAGAGCAGACCAGGGAAGG + Intronic
953508990 3:43516312-43516334 TCTGAAGAGCAGAAATTGGATGG + Intronic
953927978 3:46992020-46992042 GCTGCTGAGCAAACATGGGCTGG + Intronic
955615520 3:60803072-60803094 TCTGATCACCAGAAATGGCAAGG - Intronic
956917753 3:73891037-73891059 TCTGCTGTGCAGACAGGAGATGG - Intergenic
958513272 3:95077397-95077419 TTTGAAGAGCATACATGGAAGGG + Intergenic
960446373 3:117753874-117753896 TGTGATGAGCAGAAAAGGGTGGG + Intergenic
962102163 3:132354133-132354155 TCTGATGGGCAGACTTGTGCCGG - Intronic
963355963 3:144209139-144209161 TCTGGAGAACAGACATGGGATGG - Intergenic
964179139 3:153863185-153863207 TCTGACGAGGAGGAATGGGATGG + Intergenic
964287780 3:155138996-155139018 TCTGATGAGCTTAGATGGCAGGG - Intronic
967688511 3:192445580-192445602 TCTGATGAGCTAAAATAGGAAGG - Intronic
968525970 4:1057316-1057338 TCTGGGGGGCTGACATGGGAGGG + Intronic
971453468 4:26821767-26821789 TGTGATGAGCAGACAGGGACAGG - Intergenic
972716945 4:41655936-41655958 TCTGATGAACAGGCATGGAAAGG - Intronic
974432967 4:61822072-61822094 TCTGATTAGCAGACATTACAGGG + Intronic
974785132 4:66609708-66609730 TCTGATGTGCAGACTTGGCAGGG - Intergenic
977866849 4:102039013-102039035 TCAGATAAGCAGAGATGGAAAGG - Intronic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
980821066 4:138018718-138018740 TCTCCTAGGCAGACATGGGAGGG + Intergenic
983987574 4:174078820-174078842 TCTGATGGGCAGGCATTGGGTGG - Intergenic
985839572 5:2296075-2296097 TATGATGGGCAGAGAGGGGAAGG + Intergenic
987220875 5:15789463-15789485 TATGCTCAGCAGACATGGGGTGG - Intronic
988054682 5:26078811-26078833 TCTGATGAGAAGACACTGGGAGG - Intergenic
988292734 5:29310531-29310553 TGAAATGAGAAGACATGGGAAGG - Intergenic
989333113 5:40282819-40282841 TCTGAGGAGCTGCCATGTGAAGG - Intergenic
990312683 5:54554794-54554816 TCTGAGGAGCAGCCATGGCCTGG + Intergenic
990718966 5:58671616-58671638 GCTGATATGGAGACATGGGAAGG - Intronic
990868745 5:60408083-60408105 CCTGATCACCAGACATGTGAGGG + Intronic
991515560 5:67431299-67431321 TCTGAGGAGAAGACATAGGGAGG + Intergenic
992497869 5:77310713-77310735 TCAGATGAGCAGTCATTAGAGGG + Intronic
993316369 5:86411356-86411378 TCTGATGTGGAGAAATAGGAAGG - Intergenic
994181063 5:96766776-96766798 TTTGATGAACAGGCATGGAAAGG - Intronic
997405900 5:133646443-133646465 TGTGATGAGAAGACTTCGGATGG + Intergenic
997822683 5:137079901-137079923 CCAGAAGAGCAGGCATGGGACGG - Intronic
998078271 5:139253968-139253990 TCTCATGAGCAGACTGGGGTAGG - Intronic
998861368 5:146447426-146447448 TCTCGTGAGCAGAGATGTGAAGG - Intronic
1000130805 5:158296301-158296323 TCTGATGATCAGATATGATATGG + Intergenic
1000910731 5:167019013-167019035 TCTGAAGACCAGACCTGAGAAGG - Intergenic
1001327243 5:170738034-170738056 TCTGATGTGCAGCCAGGGCAGGG - Intergenic
1003311563 6:4973802-4973824 TCTGAGGTGAGGACATGGGAAGG - Intergenic
1004130187 6:12912315-12912337 TCTCAAGAGCAGACAAGGGTAGG + Intronic
1004759696 6:18652877-18652899 TCTAATGAGCAGCCAGGGTATGG + Intergenic
1011096668 6:83673760-83673782 TCTGATGGGCAGAGAAGGGATGG - Intronic
1014412290 6:121140583-121140605 TCAGATAAGCAGAAATGTGATGG + Intronic
1014635063 6:123835257-123835279 TCTGATTAACAAACATGGGTGGG - Intronic
1015686561 6:135869903-135869925 GGAGATGAGCAGGCATGGGAAGG + Intronic
1016012670 6:139154600-139154622 CCTGTTGGGCAGACAAGGGAAGG + Intronic
1017656176 6:156631741-156631763 TGTGATGAGCGGACTTGGGTGGG - Intergenic
1017671801 6:156777041-156777063 TCTGACGAGCAGACAAAAGAGGG - Intergenic
1018637681 6:165878693-165878715 TATGATGAGCAGTCCTGAGACGG + Intronic
1019368409 7:647238-647260 GCTGAGGACCTGACATGGGAGGG - Intronic
1020344443 7:7147985-7148007 TGAGATGAGGAGACATTGGAGGG - Intergenic
1021086119 7:16422039-16422061 TCTGATGAGCAGGCATGTTTTGG + Intergenic
1023990144 7:45123975-45123997 TCTGTCGAGCAGACTTGGGTGGG + Intergenic
1025001523 7:55319435-55319457 TGTGAAAAGCAGACATGGGCAGG + Intergenic
1025908441 7:65808241-65808263 ACTGATGGGCAGTCATTGGATGG - Intergenic
1025980644 7:66402497-66402519 ACTGATGGGCAGTCATTGGATGG + Intronic
1026090998 7:67300913-67300935 TTGGATGAGCAGACATTGGTTGG - Intergenic
1026371906 7:69708399-69708421 TATGATGTTCAGACATGGGAGGG + Intronic
1026749068 7:73035538-73035560 TTGGATGAGCAGACATTGGTTGG + Intergenic
1026752716 7:73063683-73063705 TTGGATGAGCAGACATTGGTTGG + Intergenic
1026756367 7:73091815-73091837 TTGGATGAGCAGACATTGGTTGG + Intergenic
1027031527 7:74892281-74892303 TTGGATGAGCAGACATTGGTTGG + Intergenic
1027091038 7:75301610-75301632 TTGGATGAGCAGACATTGGTTGG - Intergenic
1027094683 7:75329582-75329604 TTGGATGAGCAGACATTGGTTGG - Intergenic
1027098324 7:75357488-75357510 TTGGATGAGCAGACATTGGTTGG - Intergenic
1027324658 7:77038101-77038123 TTGGATGAGCAGACATTGGTTGG + Intergenic
1029399435 7:100334382-100334404 TTGGATGAGCAGACATTGGTTGG - Intergenic
1029717129 7:102335629-102335651 TTGGATGAGCAGACATTGGTTGG + Intergenic
1030375063 7:108745114-108745136 TCTGGTGACCAGGCATGGGCAGG + Intergenic
1030842262 7:114370229-114370251 TCTAATGAGAAGACATCTGAAGG - Intronic
1031571197 7:123362198-123362220 ACTGATTAGAAGACAAGGGAAGG + Intergenic
1032422531 7:131794113-131794135 TGTGCAGAGCAGACAGGGGAAGG - Intergenic
1032863798 7:135905832-135905854 TTTGAAGAGCAGAGATGGGCAGG + Intergenic
1033004379 7:137545800-137545822 TCTGACGAACAGACCTGTGAAGG + Intronic
1033130069 7:138738330-138738352 TCTGAGGAGCAGAAATGGACAGG + Intronic
1034566358 7:151918818-151918840 TCTGATGTGCCGGCATGGCAAGG + Intergenic
1035309371 7:157955422-157955444 TCTCATCAGCAGCCAGGGGAGGG + Intronic
1035947126 8:3977651-3977673 TCTTATGAGCAGAAAGGAGAAGG - Intronic
1036192444 8:6682573-6682595 TCTGCTGTGGAGAGATGGGACGG - Intergenic
1036694415 8:10965223-10965245 TCAGATGAGCCGAACTGGGAAGG - Intronic
1037861045 8:22405812-22405834 TCTGATTAGCAGAGATGATATGG - Intronic
1038642841 8:29341356-29341378 TCCAATGTGCAGACATGTGACGG + Intronic
1038954613 8:32453860-32453882 TCTGATGTGCAGGGATGGAAAGG - Intronic
1042177059 8:66047320-66047342 GAGGATGAGCAGACATGGGCAGG - Intronic
1042888596 8:73581075-73581097 TGTCCTGTGCAGACATGGGAAGG - Intronic
1045285301 8:100785420-100785442 TCTGATAAGCAGACTAGGGCAGG + Intergenic
1047723029 8:127659808-127659830 TGTGATGAGCAAACAAGGGGAGG - Intergenic
1049118588 8:140713076-140713098 TCTGATGTGAAGACATGGGAAGG - Intronic
1049967920 9:796063-796085 TCTGATGAGCAGACAAGGCTGGG - Intergenic
1051165288 9:14255532-14255554 ACTGATGACCAGATATGGGCTGG + Intronic
1051681339 9:19611105-19611127 TCTGATCAGGTGACATGTGAAGG + Intronic
1056137919 9:83647475-83647497 TCTGGTGAGCAGCCAGGGGTGGG + Intergenic
1056380424 9:86052735-86052757 TTTCAGCAGCAGACATGGGAGGG - Intronic
1056494141 9:87139300-87139322 TCTGTTGAGCACACATGGTGTGG + Intergenic
1057268563 9:93634416-93634438 TCTTAAGAGCTGAGATGGGAAGG - Intronic
1058453461 9:105117696-105117718 ACTGGTGAGCAGACAGGTGAGGG + Intergenic
1061058721 9:128239716-128239738 TCTGCTGAGCACTAATGGGAGGG - Exonic
1061770821 9:132919927-132919949 TCTGCTGATCAGACAGAGGAGGG - Intronic
1186516830 X:10172599-10172621 TCCAATGAGCAGACACAGGAAGG - Intronic
1190969834 X:55337779-55337801 TGGGATGAGCAGTCAAGGGAAGG + Intergenic
1192066814 X:67893505-67893527 TCTCTTGAGAAGACCTGGGATGG - Intergenic
1194413090 X:93579085-93579107 TCCCATGGGCAGCCATGGGAGGG - Intergenic
1194833131 X:98650042-98650064 TCTGATGTGGAGATCTGGGATGG + Intergenic
1194938991 X:99986744-99986766 TATGAAGAGCAGAAAAGGGATGG + Intergenic
1195287586 X:103400392-103400414 TCTGAAGTGCAGACCTGAGAGGG + Intergenic
1195311642 X:103637848-103637870 TTTGCTGAGCAGAGAAGGGAAGG - Intergenic
1196868147 X:120087739-120087761 TCTGATGAGGAGTCCTGGGCAGG - Intergenic
1197794831 X:130287508-130287530 TCTGCTGAGCAGAAAAGGTAGGG - Intergenic
1198791525 X:140352127-140352149 TCTGATGAGGAGAAATTGGGAGG + Intergenic
1198955958 X:142130790-142130812 TCTAATAAGAAGAAATGGGATGG - Intergenic
1199511812 X:148630780-148630802 TTTGATGAACAGTCATGAGAGGG - Intronic
1199774398 X:150998103-150998125 ACTGATTAGAAGACATGGGGAGG + Intergenic
1201589388 Y:15597674-15597696 TCTGAGGATCAGACAAGGAAGGG - Intergenic