ID: 948172128

View in Genome Browser
Species Human (GRCh38)
Location 2:235912366-235912388
Sequence CGGGACTTCCAGCTAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948172124_948172128 26 Left 948172124 2:235912317-235912339 CCAACACAGCAAATTCAATCTGA 0: 1
1: 0
2: 1
3: 9
4: 194
Right 948172128 2:235912366-235912388 CGGGACTTCCAGCTAAAAATAGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948172128 Original CRISPR CGGGACTTCCAGCTAAAAAT AGG Intronic
901596084 1:10386338-10386360 CTGGACTTGCAGTTTAAAATGGG + Intergenic
913173496 1:116253462-116253484 AAGGACATCCAGCTAAAAATTGG + Intergenic
913225686 1:116696246-116696268 CAGGACTTACAGCTTATAATGGG + Intronic
917935944 1:179867206-179867228 TGGGACTTCCATCAAAATATGGG - Intronic
918479594 1:184964260-184964282 CAGGACTTCTAGCAAAAGATAGG + Intronic
922812329 1:228424297-228424319 CTGGACTTCTAACTTAAAATAGG + Intergenic
924439228 1:244072755-244072777 CTGTATTTCCAGCTGAAAATGGG + Intergenic
1075097464 10:119481928-119481950 CGGGACTGCCAACAAAAACTGGG + Intergenic
1080570417 11:33551238-33551260 GGCTACTTCCAGCTAAAAACAGG + Exonic
1080759306 11:35232688-35232710 CTGGACTTCCAGTTAAAGAGAGG + Intergenic
1094755358 12:33462763-33462785 CTGGATTTCCAGCACAAAATTGG + Intergenic
1117225253 14:53651787-53651809 AGAGACTTCCAGGTAAAAAATGG - Intergenic
1123063532 14:105605186-105605208 CAGTGCTTTCAGCTAAAAATGGG + Intergenic
1131504939 15:93009238-93009260 CGGAACTGCCTGCTGAAAATCGG + Exonic
1134056794 16:11175134-11175156 GGTGACTTCCAGCAAAAACTTGG - Intronic
1134834072 16:17346753-17346775 AGGAACTTCCAGCTATAAAACGG - Intronic
1139219530 16:65166163-65166185 ATGGATTTCCAGCTAAAAATGGG - Intergenic
1146519255 17:33513820-33513842 TGTGACTTCCAGCTACAGATGGG - Intronic
1149036183 17:52136641-52136663 GGAGACATCCAGCTAGAAATAGG + Intronic
1151180352 17:72322864-72322886 TGGGTCTTCCAGAGAAAAATGGG - Intergenic
1153486202 18:5601194-5601216 CAGGACCTGCAGTTAAAAATAGG + Intronic
1160416204 18:78713080-78713102 AGGGACTTCTATCTAAAAAATGG + Intergenic
1161448956 19:4333962-4333984 CGGGACTTCCAGGTAAGGATGGG - Exonic
1166100614 19:40569554-40569576 TGGCACTTCCAGCTAAGAAGTGG + Intronic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
1167505131 19:49867256-49867278 CGGGACTTCCTGCAGCAAATTGG - Intronic
925346827 2:3177449-3177471 CGTGACGTCCAGCTCAAAAATGG - Intergenic
930691130 2:54366088-54366110 CCAAATTTCCAGCTAAAAATGGG - Intronic
933510117 2:83230087-83230109 AGGGACTCCCACCTAAAATTTGG - Intergenic
934710477 2:96511006-96511028 CGGGAAGAGCAGCTAAAAATTGG + Intergenic
948172128 2:235912366-235912388 CGGGACTTCCAGCTAAAAATAGG + Intronic
1178890728 21:36519135-36519157 AGCTACATCCAGCTAAAAATGGG - Intronic
1182761798 22:32728433-32728455 AGGGCTTTCCAGCTAAAAAGAGG - Intronic
959643242 3:108665002-108665024 GGAGACTGCCTGCTAAAAATAGG + Intronic
961100045 3:124190956-124190978 CTGGCCAACCAGCTAAAAATTGG + Intronic
964854054 3:161126749-161126771 CCAAATTTCCAGCTAAAAATAGG + Intronic
974260242 4:59517720-59517742 TGGGACTCCCAGCTACAAAGAGG - Intergenic
981568513 4:146126733-146126755 CCTGGCTTCCAGCTAAAAGTTGG + Intergenic
981831549 4:149007475-149007497 CAGGTCTTCCAGCTAAAGCTTGG + Intergenic
983975556 4:173929343-173929365 CTGGACTGCCAGCTCACAATGGG + Intergenic
985857659 5:2442811-2442833 CGGGACCTCCAGCTCAGAACCGG + Intergenic
987221347 5:15793138-15793160 CAGGACTTCCAGCTACAACATGG - Intronic
990744631 5:58947160-58947182 AGGGACTTCCACTTAAACATGGG + Intergenic
997308688 5:132861236-132861258 ATGGACTTGCAGCTATAAATAGG - Exonic
1006263032 6:32893324-32893346 TGGGACTGCCAGATAAAACTGGG - Intergenic
1014693504 6:124590833-124590855 CTGGAGTTCCAGCTGATAATTGG + Intronic
1015634932 6:135265691-135265713 CGGGACTTCCAGCTAATCTTTGG - Intergenic
1016073475 6:139768984-139769006 AGGGATTTCCAGTTAAAAATGGG - Intergenic
1034237947 7:149587214-149587236 CCGGTCTCCCAGCTGAAAATAGG - Intergenic
1037180144 8:15995253-15995275 CTGGCCAACCAGCTAAAAATCGG - Intergenic
1052530175 9:29673114-29673136 CTGGACTTACAGAGAAAAATAGG - Intergenic
1057571732 9:96209226-96209248 AGGGACTTCCAGCTAATGAGTGG + Intergenic
1192051716 X:67730475-67730497 CTGGTCTGCCAGCTAAAACTTGG + Exonic