ID: 948176911

View in Genome Browser
Species Human (GRCh38)
Location 2:235950571-235950593
Sequence CAGGGGATGAAGGCTGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 780}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948176911 Original CRISPR CAGGGGATGAAGGCTGCTGT AGG Intronic
900106082 1:981693-981715 CAGGAGGTGCAGGCTGCGGTGGG + Intronic
900152448 1:1184554-1184576 CAGCGGATGAAGGTTTTTGTGGG + Intronic
900370626 1:2330475-2330497 AAGGGGATGAAGGCCTGTGTGGG + Intronic
900963901 1:5944319-5944341 CAGCTGAAGAAGGCTGCTCTGGG + Intronic
901049065 1:6417227-6417249 CAGGATATGAAGGAAGCTGTAGG - Exonic
901136241 1:6998365-6998387 GAGGGGAAGAAGCCTGCTGGAGG - Intronic
901217981 1:7565353-7565375 CAGGGGCAGAAGGCTGGTGAGGG + Intronic
901271752 1:7957545-7957567 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
901423125 1:9164079-9164101 CAGAGGAGGAAGGCTGCTTGCGG + Intergenic
901808355 1:11751593-11751615 TCAGGGAGGAAGGCTGCTGTGGG + Intronic
902152139 1:14452011-14452033 CAGGAGACGGAGGCTGCAGTGGG - Intergenic
902384938 1:16071192-16071214 CTGGAGCTGCAGGCTGCTGTGGG - Intronic
902403311 1:16169825-16169847 CAGGAGATGAAGGTTGCAGTGGG - Intergenic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
903265209 1:22153966-22153988 CAGGGGCTGAAGGGGGCTCTTGG + Intergenic
903271615 1:22192032-22192054 CATGGTCTGGAGGCTGCTGTTGG + Intergenic
903643214 1:24874578-24874600 CAGGAGATTGAGGCTGCAGTAGG + Intergenic
903844047 1:26266311-26266333 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG + Intergenic
904495063 1:30881914-30881936 CAGGGGGTGAGGGCAGCTGCGGG - Intronic
904646402 1:31970546-31970568 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
905342548 1:37289277-37289299 CAGCAGATGTAGGCTGCGGTTGG - Intergenic
905402679 1:37715101-37715123 CAGGAGATGGAGGTTGCAGTGGG - Intronic
905811033 1:40913389-40913411 CAGGGGGTTGAGGCTGCAGTGGG - Intergenic
905885852 1:41491490-41491512 CTTGGGATGCAGGGTGCTGTGGG + Intergenic
905936771 1:41830574-41830596 CAGTGGATAAAGACTGCTTTTGG - Intronic
906039859 1:42780174-42780196 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
906068192 1:42997692-42997714 CAGGAGATCAAGGCTGCAGTGGG - Intergenic
906472141 1:46140060-46140082 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
906767339 1:48445741-48445763 AAGGGGATGTAGTATGCTGTTGG - Intronic
907033740 1:51197735-51197757 CAAGAGATCAAGGCTGCAGTGGG + Intergenic
907215829 1:52862855-52862877 CAGGAGGTCAAGGCTGCAGTTGG - Intronic
907486258 1:54780412-54780434 CAGGAGATGGAGGTTGCAGTGGG + Exonic
907486843 1:54783926-54783948 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
908722060 1:67136104-67136126 CAGGCGATTGAGGCTGCAGTGGG - Intronic
908994642 1:70136801-70136823 CAGGTGGTCAAGGCTGCAGTGGG - Intronic
910136014 1:83970934-83970956 CAGCAGTTGAAGGCTGCTGTGGG + Intronic
911002123 1:93177501-93177523 CGGGAGATGAAGGTTGCTGTGGG + Intronic
911097376 1:94065608-94065630 CAGGGCATGGAGGCTGAGGTGGG - Intronic
911721218 1:101193307-101193329 CAGGAGATGGAGGCTGCAATGGG + Intergenic
911956576 1:104243219-104243241 CAGGAGTTAAAGGCTGCAGTGGG + Intergenic
911957665 1:104258940-104258962 CAGGAGGTGGAGGCTGCAGTGGG - Intergenic
912092594 1:106099076-106099098 CAGCGGGTGGAGGCTGCAGTGGG + Intergenic
912328795 1:108797271-108797293 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
912346177 1:108965417-108965439 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
912364721 1:109123874-109123896 CAGGAGATGGAGGTTGCAGTGGG - Intronic
913002021 1:114590314-114590336 TAGGGGATAAAGGCTGCAGTGGG + Intronic
914893528 1:151649777-151649799 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
915243003 1:154537196-154537218 CAGGGGATGAAGGGTGCCAGGGG - Intronic
915617623 1:157051691-157051713 CAGGAGATCAAGGCAGCAGTGGG + Intergenic
916072952 1:161182160-161182182 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
916429604 1:164714458-164714480 CAGGGGCTGAAGGGAGATGTAGG + Intronic
916587819 1:166164231-166164253 CAGGGGCCCCAGGCTGCTGTGGG + Intronic
916642759 1:166748518-166748540 AAAGGAAAGAAGGCTGCTGTTGG + Intergenic
917380112 1:174397066-174397088 CAGGAGATCGAGGCTGCAGTGGG + Intronic
917823474 1:178791192-178791214 CAGGAGATCAAGGATGCAGTGGG - Intronic
917854008 1:179087302-179087324 CAGGGGAGCAAGCCTGCTGAAGG - Intronic
918122738 1:181554082-181554104 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
919534942 1:198775875-198775897 CATGGGATGAAGACTGCTCGTGG + Intergenic
919802278 1:201361151-201361173 CAGGAGCTGAAGGGGGCTGTTGG + Intronic
920026946 1:203006045-203006067 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
920634658 1:207688200-207688222 CAGGGGTTCAAGGCTTCAGTGGG + Intronic
921381014 1:214524576-214524598 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
922188306 1:223295553-223295575 GAAGGGAGGAAGGGTGCTGTGGG + Intronic
922416071 1:225424716-225424738 TGGGGGTTGATGGCTGCTGTAGG - Intronic
922693853 1:227716217-227716239 CAGGAGATGGAGGCTGCAGTGGG + Intergenic
923630306 1:235645255-235645277 CAGGGCAGGGAGGCTGCTGAGGG - Intronic
923778605 1:237001623-237001645 CATGGCATGCAGGCTGCTGCTGG - Intergenic
923783823 1:237049063-237049085 CAGGTGATGATTGCTGCTTTGGG + Intronic
923992192 1:239451148-239451170 CGGGGGTTGGAGGCTGCAGTGGG + Intronic
924519140 1:244791088-244791110 CAGGAGGTTAAGGCTGCAGTGGG + Intergenic
924640016 1:245824780-245824802 CAGGAGATGGAGGTTGCAGTGGG + Intronic
1062957860 10:1552119-1552141 CAGGGGTTAAAGGCTGCTCCTGG + Intronic
1062971652 10:1653398-1653420 CTGGGGTTTGAGGCTGCTGTAGG + Intronic
1063120651 10:3103553-3103575 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1063464026 10:6231777-6231799 CAGGGGATGACGGCTGCCTGCGG - Intronic
1063469668 10:6274124-6274146 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1063596899 10:7443672-7443694 CAGGAGTTTAAGGCTGCAGTGGG - Intergenic
1064034732 10:11906092-11906114 CAGGAGATCAAGGCTGCAGTGGG + Intergenic
1064100838 10:12462763-12462785 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1064588998 10:16869237-16869259 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1065745774 10:28840401-28840423 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1065941570 10:30569001-30569023 CAGGACATCAAGGCTGCAGTAGG + Intergenic
1066479908 10:35785801-35785823 CAGGGGAAGGAGGCTGCAGCTGG - Intergenic
1067737756 10:48871547-48871569 CAGGAGTTCAAGGCTTCTGTGGG - Intronic
1067897037 10:50193627-50193649 GAGGGGATGAGGGGTGCTGGGGG + Intronic
1067951936 10:50748413-50748435 GAGGGGATGAGGGGTGCTGGGGG - Intronic
1069400156 10:68035815-68035837 CAGGGAAGGAAGGCTCCTGCTGG - Intronic
1069899170 10:71697054-71697076 CAGGTGAGGAAGGTTGCTCTGGG + Intronic
1069987602 10:72295150-72295172 CAGGGGGTGGAGGTTGCAGTGGG + Intergenic
1070109156 10:73465486-73465508 CAGGAGTTCAAGGCTGCTGTGGG + Intronic
1070109646 10:73472418-73472440 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1070307587 10:75248777-75248799 CCGGGGAATAAGGCTACTGTGGG + Intergenic
1070545606 10:77450021-77450043 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1070874667 10:79792044-79792066 CAGGGGGTTGAGGCTGCAGTGGG - Intergenic
1071641591 10:87314208-87314230 CAGGGGGTCGAGGCTGCAGTGGG - Intergenic
1072584177 10:96766572-96766594 CAGGAGGTGGAGGCTGCAGTGGG + Intergenic
1072639174 10:97198001-97198023 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1072677890 10:97482100-97482122 CAGGAGATCGAGGCTGCAGTGGG + Intronic
1072686633 10:97541402-97541424 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1072752766 10:97995068-97995090 CATGGGAAGATGGCTGCTGAGGG + Intronic
1072910549 10:99497152-99497174 CAGGGGAGCAAGGATGCTTTAGG + Intergenic
1072957860 10:99903006-99903028 CAGGTGTTGGAGGCTGCAGTTGG - Intronic
1073198639 10:101716421-101716443 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1073343292 10:102762456-102762478 CATGGGATTAAGGGTACTGTTGG - Intronic
1073343346 10:102762871-102762893 CAGGTGAGCAAGGCTGCTGAGGG + Intronic
1073372406 10:103002551-103002573 CAGGAGGTGGAGGCTGCAGTGGG - Intronic
1073814591 10:107192561-107192583 CAGGAGATGCAGGCTTCTGCAGG + Intergenic
1074467768 10:113698577-113698599 CAGGAGATCGAGGCTGCAGTGGG + Intronic
1074762181 10:116675313-116675335 CAGGCGGTGCAGGCTGCTTTTGG - Exonic
1074845297 10:117392342-117392364 CAGGAGGTGGAGGCTGCAGTGGG - Intergenic
1074908438 10:117885293-117885315 CAGGAGAGGGAGGCTGCTGTGGG - Intergenic
1074993387 10:118732547-118732569 CATTGGTTGAAGGCTGCTTTGGG - Intronic
1075062522 10:119266846-119266868 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1075085825 10:119413844-119413866 CCAGGGCTGGAGGCTGCTGTGGG - Intronic
1075877279 10:125818417-125818439 CAGGAGTTCAAGGTTGCTGTGGG + Intronic
1076707428 10:132309266-132309288 CAAGGGATGGGGGCTCCTGTTGG - Intronic
1076869694 10:133187276-133187298 CGAGGGATGGAGGATGCTGTTGG + Intronic
1076914824 10:133418075-133418097 CAGGAGGTGGAGGCTGCAGTGGG - Intronic
1077148413 11:1056285-1056307 CATGGGATGAGTCCTGCTGTGGG - Intergenic
1077233078 11:1467254-1467276 CAGGAGATGAAGGCAGATTTTGG - Intergenic
1077959846 11:7063942-7063964 CTGGGGAGGAGGGCTGCTTTTGG - Intronic
1078158537 11:8819321-8819343 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1078748084 11:14134472-14134494 CATGGGATGGTGGCTGCAGTGGG - Intronic
1078818567 11:14852128-14852150 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1079214566 11:18496720-18496742 CAGGAGATGGAGGTTGCAGTGGG + Intronic
1080431415 11:32203281-32203303 CAGGGGGTCAAGGCTGCAGTGGG + Intergenic
1080431930 11:32207409-32207431 GAGGGGCTGAAGGGTGCTGTTGG - Intergenic
1080888230 11:36386210-36386232 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1081504384 11:43700091-43700113 CACTGGATGAAGGCTGTTGATGG + Intronic
1081548935 11:44094762-44094784 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1081594744 11:44451290-44451312 CAGGAGATGGAGGATGCAGTGGG + Intergenic
1082055225 11:47809178-47809200 CAGGAAATCAAGGCTGCAGTGGG + Intronic
1083025017 11:59543270-59543292 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1083606794 11:63983650-63983672 CAGGGGCTGGAGGTTGCAGTGGG - Intronic
1083884852 11:65567897-65567919 CAGGAGATCCAGGCTGCAGTGGG - Intergenic
1083982093 11:66180730-66180752 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1085158350 11:74317634-74317656 CAGGAGATCAAGGCTGCAGTGGG - Intergenic
1085302706 11:75467709-75467731 GAGGGGATGGAGGCTGAGGTGGG + Intronic
1086892188 11:92271064-92271086 CAGGGCTTGGAGGCTGCTGCAGG - Intergenic
1087031601 11:93711574-93711596 CAGGAGATGGAGGCTGCAGTGGG - Intronic
1087659321 11:100967785-100967807 CAGGAGATGGAGGTTGCAGTAGG - Intronic
1088153798 11:106780085-106780107 CAGGAGATCAAGGCTGCAGTGGG + Intronic
1088313622 11:108485729-108485751 CAGGAGGTGGAGGCTGCAGTGGG - Intronic
1088638228 11:111845228-111845250 CAGGAGGTTAAGGCTGCAGTGGG + Intronic
1088685969 11:112284838-112284860 CAGGGGCTTTAGGCTGCTCTAGG + Intergenic
1089263197 11:117237151-117237173 CAGGAGGTGGAGGCTGCAGTAGG - Intronic
1089496653 11:118911437-118911459 CTGGGGAGGAAGGCTCCTGGGGG + Intronic
1089508673 11:118981599-118981621 CAGGAGGTCAAGGCTGCAGTCGG + Intergenic
1089508710 11:118981991-118982013 CAGGAGGTGAAGGTTGCGGTAGG - Intergenic
1089553013 11:119295651-119295673 CGGGAGATCAAGGCTGCAGTGGG + Intronic
1089636259 11:119814464-119814486 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1090040071 11:123283005-123283027 CAAGGGAAGAATGGTGCTGTGGG + Intergenic
1090408832 11:126493737-126493759 TAGAAGATGCAGGCTGCTGTGGG - Intronic
1090694272 11:129221736-129221758 CAGGAGGTCCAGGCTGCTGTGGG + Intronic
1090868275 11:130721197-130721219 CAGAAAATGATGGCTGCTGTAGG - Intergenic
1091573004 12:1706914-1706936 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1091719105 12:2799666-2799688 AAGGGTATGAAGGATGCTGAGGG + Intronic
1091733413 12:2898751-2898773 CAGGAGTTCAAGGCTGTTGTGGG - Intronic
1091749530 12:3013798-3013820 CAGGAGTTGGAGGCTGCGGTGGG + Intronic
1092188436 12:6499283-6499305 CAGGAGGTGAAGGTTGCAGTGGG - Intronic
1092248035 12:6874174-6874196 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1092689086 12:11087173-11087195 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1093190477 12:16068972-16068994 ATGGGGATGAAGGGTGCAGTGGG - Intergenic
1093730705 12:22562665-22562687 TAAAGGATGAAGGCAGCTGTGGG - Intergenic
1093915318 12:24795692-24795714 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1094676128 12:32621959-32621981 CAGGGTATGGAGGTTGCAGTGGG - Intronic
1095777506 12:46025746-46025768 CAGGAGGTCAAGGCTGCAGTAGG - Intergenic
1095950163 12:47777380-47777402 CAGGGGCTGAGGGAAGCTGTAGG + Intronic
1096125651 12:49117511-49117533 CAGGGGGTGGAGGCTGCAGTGGG + Intergenic
1096281920 12:50262743-50262765 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1096706146 12:53423766-53423788 GTGGGGGAGAAGGCTGCTGTGGG - Intergenic
1097712910 12:62934802-62934824 CGGGGCATGCAGGCTGCGGTGGG + Exonic
1097878033 12:64661753-64661775 CAGGAGGTGGAGGCTGCAGTAGG - Intronic
1098296467 12:69009052-69009074 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1098304640 12:69090330-69090352 CAAGGCAGGAAGGCTGCTGAGGG - Intergenic
1098454277 12:70654459-70654481 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1098974302 12:76886556-76886578 CAGGGGAGGAGGGCTGGGGTTGG + Intergenic
1098976691 12:76909486-76909508 CAGGGGGTGGAGGTTGCAGTGGG + Intergenic
1099635996 12:85212209-85212231 CAGGAGATGGAGGCTGCAGATGG + Intronic
1100469958 12:94881915-94881937 CAGGAGGTTAAGGCTGCAGTGGG + Intergenic
1100969332 12:100050736-100050758 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1101442774 12:104715815-104715837 CTGGGGCTGCAGGCTGTTGTTGG + Intronic
1101498351 12:105277459-105277481 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1101890599 12:108711294-108711316 CAGGAAATCAAGGCTGCAGTGGG + Intronic
1101911298 12:108861953-108861975 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1101957805 12:109226195-109226217 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1102599003 12:114014567-114014589 CAGGAGGTGGAGGCTGCAGTGGG - Intergenic
1102958136 12:117072849-117072871 CAGGGGTTCAAGACTGCAGTGGG - Intronic
1103074603 12:117971968-117971990 CCAGGCATGAAGGCTGCTTTGGG - Intergenic
1103404930 12:120668400-120668422 CAGGAGGTGGAGGCTGCAGTGGG + Intergenic
1103554498 12:121758043-121758065 CAGGAGATTAAGGCTACAGTGGG + Intronic
1103575458 12:121873907-121873929 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1104673598 12:130697447-130697469 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1104908726 12:132229351-132229373 CAGGTGCTGGAGGCTGCTCTGGG - Intronic
1104948834 12:132429605-132429627 CAGAGGACGCAGGCTGCTGAGGG - Intergenic
1105026916 12:132855166-132855188 CAGGAGATGAATGTTGCAGTGGG + Intronic
1105512646 13:21063175-21063197 CAGGAGTTCAAGGCTGATGTGGG - Intergenic
1105615705 13:22010157-22010179 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1105731561 13:23222752-23222774 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1106138784 13:26993637-26993659 CAGGGGATGAAGGCCTCTGTCGG + Intergenic
1106285035 13:28311029-28311051 CAGGAGATGGAGGCTGCAGTGGG - Intronic
1106503066 13:30347789-30347811 CAGGAGTTCAAGGCTGCAGTAGG + Intergenic
1106507802 13:30386729-30386751 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1106857673 13:33870578-33870600 CCTGGGGTGAAGGCTGCTGCAGG + Intronic
1108080259 13:46727988-46728010 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1108579024 13:51812805-51812827 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1109400162 13:61816881-61816903 CAGGTCAGGCAGGCTGCTGTTGG - Intergenic
1110455459 13:75685959-75685981 CTGGAGATCAAGGCTGCAGTAGG - Intronic
1110608516 13:77461978-77462000 GAGGGAAGGAAGGCAGCTGTGGG - Intergenic
1112349116 13:98618352-98618374 CAGGAGGTCAAGGCTGCGGTGGG - Intergenic
1112479017 13:99756969-99756991 CTGGGGGTCAAGGCTGCAGTGGG - Intronic
1113317618 13:109199681-109199703 CTGGGGATTAAGGATGCTGCTGG - Intronic
1115025622 14:28741885-28741907 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1115088711 14:29548224-29548246 CAGGAGGTCAAGGCTGCCGTGGG + Intergenic
1115564982 14:34617532-34617554 CAGGGGACTGAGGCTGCCGTGGG + Intronic
1115706325 14:36002623-36002645 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1116831472 14:49723656-49723678 CAAGGGATGAAAGCAGCTATGGG + Intronic
1117363925 14:55005936-55005958 CAGGAGATTAAGGCTGCAGTGGG - Intronic
1117543584 14:56771997-56772019 GAGGTGATGAAGACTGCTTTAGG - Intergenic
1117953503 14:61105135-61105157 AAGTGGATCAAGGCTACTGTGGG - Intergenic
1118227403 14:63914849-63914871 CAGGAGGTGGAGGCTGCAGTGGG - Intronic
1118265442 14:64290143-64290165 CAGGAGATCAAGGCTGCAGTAGG - Intronic
1118354946 14:65005711-65005733 CAGGAATTCAAGGCTGCTGTGGG - Intronic
1119032425 14:71203106-71203128 CACGGAATGCAGGCTGCTCTGGG + Intergenic
1119188108 14:72659037-72659059 CAGGGGATGCAGCCTGCAGGAGG - Intronic
1119737304 14:76991347-76991369 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
1120023706 14:79558157-79558179 CAGGGGTTCAAGGCTTCAGTGGG - Intronic
1120312718 14:82851299-82851321 CAGGTGTTGGAGGCTGCCGTTGG - Intergenic
1120841606 14:89090387-89090409 CTGGGGTTGAATCCTGCTGTGGG - Intergenic
1121066717 14:90973962-90973984 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1121280710 14:92695573-92695595 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
1121331957 14:93055391-93055413 AAGGGGCTGAGGGCTGGTGTGGG - Intronic
1121443402 14:93963144-93963166 CAGGGGATGAAGGTGGGTGATGG - Intronic
1121556023 14:94838192-94838214 CAGGAGGTGGAGGCTGCAGTGGG - Intergenic
1121743980 14:96273723-96273745 CAGGAGAGGGAGGCTGCTCTGGG - Intergenic
1121948648 14:98148804-98148826 CAGGAGGTGAAGGTTGCAGTGGG - Intergenic
1122717491 14:103704264-103704286 AAGGGGAGGCAGGCTGCTGGGGG + Intronic
1202928377 14_KI270725v1_random:15159-15181 GAGGGAATGCAGGCTGCTTTGGG + Intergenic
1124227015 15:27903322-27903344 CAGGAGAGGAGGGCAGCTGTGGG - Intronic
1124422516 15:29535174-29535196 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1124423180 15:29539809-29539831 CAGGGGATTTTGGCTGCTCTGGG - Intronic
1125281073 15:38043199-38043221 CAGGGGGTCAAGGATGCTGGCGG + Intergenic
1125655288 15:41351711-41351733 CAGGAGGTTAAGGCTGCAGTGGG + Intronic
1125927975 15:43578760-43578782 CAGGAGGTGGAGGTTGCTGTGGG + Intronic
1125941119 15:43678331-43678353 CAGGAGGTGGAGGTTGCTGTGGG + Intergenic
1126101757 15:45122112-45122134 GAGGAGATGCAGGCTGCTGAGGG + Intronic
1126812579 15:52422788-52422810 CAGGAGTTGAAGGCTGCAGTGGG - Intronic
1127251542 15:57243950-57243972 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1127774700 15:62255648-62255670 CAGGGGATGAGGGAGGCTGTAGG + Intergenic
1128293774 15:66499528-66499550 AAAGGAAAGAAGGCTGCTGTTGG - Exonic
1128736385 15:70056208-70056230 CAGGGGATGAGGGGCGTTGTTGG + Intronic
1129241913 15:74257006-74257028 CAGGGCATGGGGGCTGCTCTGGG - Intronic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1129768284 15:78184245-78184267 CAGGGGTTTGAGGCTGCAGTGGG - Intronic
1130543271 15:84837191-84837213 CAGGGGCTGGAGGAGGCTGTGGG + Intronic
1130648774 15:85750552-85750574 CAGGCCAGGATGGCTGCTGTGGG - Intergenic
1130747536 15:86671996-86672018 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1131253275 15:90844940-90844962 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1131458510 15:92602098-92602120 CAGGGGAAGAATGCTGGTGGAGG - Intergenic
1131765123 15:95667830-95667852 CATGGGGTGAGGGCTGCTTTTGG - Intergenic
1132937958 16:2491460-2491482 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1133076729 16:3285780-3285802 CAGGGGAGGAAGGGTGCTGGGGG - Intronic
1133177129 16:4023834-4023856 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1133252366 16:4491576-4491598 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1133357037 16:5144146-5144168 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1133664954 16:7957939-7957961 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1133935676 16:10267363-10267385 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1134644171 16:15853217-15853239 CAGGAGTTCAAGGCTGCCGTGGG - Intronic
1134747182 16:16597422-16597444 CAGGAGATGGAGGTTGCAGTAGG - Intergenic
1135018025 16:18940189-18940211 CAGGGAGTCAAGGCTGCAGTGGG + Intergenic
1135074545 16:19382174-19382196 CAGGAGGTGGAGGCTGCAGTGGG + Intergenic
1135139681 16:19910921-19910943 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1135394970 16:22124105-22124127 CAGGGGCTCAAGGCTGCAGTGGG + Intronic
1135422944 16:22316860-22316882 CAGGGGCTCAGGGCTGCTGGGGG + Intronic
1135983124 16:27164111-27164133 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1136006307 16:27332049-27332071 CAGGAGGTTAAGGCTGCAGTGGG - Intronic
1136491180 16:30609605-30609627 CAGGAGATGAGGGCTGGTTTGGG + Exonic
1136555808 16:31007278-31007300 GACAGGATGAAGGCTGCTGAGGG - Intronic
1136582918 16:31164894-31164916 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1137736853 16:50731094-50731116 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1137973806 16:53012901-53012923 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1138264465 16:55650661-55650683 CAGGAGGTGGAGGCTGCAGTGGG - Intergenic
1138275058 16:55728330-55728352 AAGGGGATGAAGGCAGCTTGGGG + Intergenic
1138478565 16:57286407-57286429 TAGGGGTTGGAGGCTGCAGTAGG - Intergenic
1138690386 16:58762291-58762313 CAGGAGTTCAAGGCTGCAGTAGG + Intergenic
1139085061 16:63574482-63574504 CAGGAGTTCAAGGCTACTGTGGG + Intergenic
1139366454 16:66436647-66436669 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1139378994 16:66518454-66518476 CAGGGGTTTAAGGCTGTAGTGGG + Intronic
1139457451 16:67093019-67093041 CAGGATATTAAGGCTGCAGTGGG - Intronic
1140083883 16:71777149-71777171 GAGGGGAGGGAGGCAGCTGTGGG + Intronic
1140679225 16:77367948-77367970 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1140822720 16:78678300-78678322 CAGGAGGTCAAGGCTGCAGTAGG + Intronic
1140896197 16:79326745-79326767 AAGTGGATGAAGGCTGCATTTGG + Intergenic
1141148513 16:81548512-81548534 CTGGGGTGGAAGGGTGCTGTGGG - Intronic
1141402783 16:83764966-83764988 GAGAGGATGAAGGTTGTTGTAGG - Intronic
1141846237 16:86610913-86610935 CAGCGGCTGAGGGCTGCTCTGGG + Intergenic
1141999381 16:87655425-87655447 CAGGAGATCGAGGCTGCAGTGGG - Intronic
1142155692 16:88531995-88532017 CAGGGGAAGACGTCTTCTGTGGG - Exonic
1142398063 16:89844240-89844262 CAGGAGATGGAGGCTGCAGGTGG - Intronic
1143130525 17:4674374-4674396 CAGTGGACGAAGGCTGGTCTAGG + Intronic
1143238529 17:5423824-5423846 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1143534908 17:7532237-7532259 CAGGAGTTCAAGGCTGCAGTAGG + Intergenic
1143538185 17:7554161-7554183 GAGGGGAGGAAGGCTGATCTGGG - Intronic
1143567683 17:7734401-7734423 CGGGGAGTGAAGGATGCTGTTGG + Intronic
1143682615 17:8488613-8488635 AAGAGGATGATGGCTGGTGTGGG + Intronic
1144498187 17:15763724-15763746 CAGGAGTTGAAGGCTGCAGTGGG - Intergenic
1144595715 17:16568827-16568849 GACGGGGTGGAGGCTGCTGTGGG - Exonic
1144604920 17:16656665-16656687 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1144741091 17:17582639-17582661 CAGGGCATGAGGGCAGCTCTGGG - Intronic
1145104785 17:20105870-20105892 CTGGGGATGGAGGCTGTGGTGGG + Intronic
1145107908 17:20135523-20135545 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1145161566 17:20578765-20578787 CAGGAGTTGAAGGCTGCAGTGGG - Intergenic
1146037625 17:29421670-29421692 CAGGAGGTCAAGGCTTCTGTGGG - Intronic
1146051222 17:29555072-29555094 CAGGGAGAGAAGGCTGCTGAGGG + Intergenic
1146250975 17:31343880-31343902 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1146403053 17:32515365-32515387 CAGGAGGTGAAGACTGCAGTAGG - Intronic
1146611556 17:34309939-34309961 CAGGAGATGGAGGTTGCTGAGGG - Intergenic
1146756397 17:35435336-35435358 CAGGAGGTGAAGGCTGCAGTGGG - Exonic
1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG + Intronic
1147354892 17:39887257-39887279 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1147359396 17:39921665-39921687 TAGGGGAGGGAGGCTGCTGTGGG - Intronic
1147564664 17:41528778-41528800 CGGGAGATGGAGGCTGCAGTGGG - Intergenic
1147576259 17:41601105-41601127 GTGGGGTTGAAGGCTGATGTGGG - Intergenic
1147722797 17:42549002-42549024 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1148339646 17:46865687-46865709 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1148483205 17:47974020-47974042 CAGCGGATGAAGGCAAGTGTGGG + Exonic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1148607234 17:48939364-48939386 CTGGAGTTGAAGGCTGCAGTGGG + Intronic
1148886334 17:50775742-50775764 CAGGTGATCAAGCCTGCAGTGGG + Intergenic
1148929002 17:51112899-51112921 CTGGAGGTCAAGGCTGCTGTGGG + Intronic
1149798177 17:59540756-59540778 CAGGAGATCAAGGCAGCAGTGGG - Intergenic
1150040540 17:61855503-61855525 CAGGAGGTGAAGGTTGCAGTGGG + Intronic
1150050226 17:61954701-61954723 CAGGAGGTGAAGGCTACAGTAGG + Intronic
1150283753 17:63944211-63944233 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1150309179 17:64113755-64113777 CAGGAGGTGAAGGTTGCAGTGGG - Intronic
1150541336 17:66103149-66103171 CAGGAGGTGAAGGTTGCAGTGGG + Intronic
1150617679 17:66784837-66784859 CAGGGGGTGCAGGCTGCCGACGG - Intronic
1150683599 17:67302726-67302748 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
1150891403 17:69154496-69154518 CAGGAGATCAAGGCTGCAGCAGG - Intronic
1151450095 17:74193543-74193565 CTGGGGAGGAAGCCTGCTGGTGG - Intergenic
1151539911 17:74759555-74759577 TGGGGGATGAAGCCTGGTGTGGG - Intronic
1151706527 17:75771847-75771869 CAGGAGTTGAAGGCTTCAGTGGG - Intergenic
1151781655 17:76250676-76250698 CAGGAGGTCGAGGCTGCTGTGGG - Intergenic
1151825434 17:76521350-76521372 CAGGGACTTAAGGCTGCAGTGGG + Intergenic
1152113298 17:78369307-78369329 CAGAAGATGCAGGCTACTGTGGG + Intergenic
1152359560 17:79825154-79825176 GTGGAGAGGAAGGCTGCTGTGGG - Intergenic
1152415873 17:80161545-80161567 CAGGAGGTCAAGGCTGCAGTAGG - Intergenic
1152422268 17:80200308-80200330 CAGGGGGTGGAGGTTGCAGTGGG - Intronic
1152692230 17:81724128-81724150 CAGGAGGTGGAGGCTGCAGTGGG + Intergenic
1153033428 18:736097-736119 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1153840820 18:9006149-9006171 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1153964221 18:10166011-10166033 CAGGGGATGAGGGCTAGTGCAGG + Intergenic
1155162440 18:23206882-23206904 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1155565203 18:27126809-27126831 ATGGGGAGGAAGGCTGCTTTAGG + Intronic
1155850235 18:30765552-30765574 CACTGGAGGAAGGCTGATGTTGG - Intergenic
1156401137 18:36741695-36741717 CAGGAGTTCAAGGCTGCAGTAGG + Intronic
1157083439 18:44552984-44553006 CAGGGGTATAAGCCTGCTGTTGG - Intergenic
1157116142 18:44864381-44864403 AGGGAGATGAAGGATGCTGTGGG - Intronic
1157192714 18:45594856-45594878 CAGGGTGTGACGGCTGCTGGGGG - Intronic
1157223999 18:45846445-45846467 CAGGAGGTGAAGGTTGCAGTGGG + Intergenic
1157866524 18:51191377-51191399 CTGGAGATGGTGGCTGCTGTTGG + Intronic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1159970749 18:74648962-74648984 CAGGGGATCAAGGGTGCGGAGGG - Intronic
1160416022 18:78711532-78711554 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1160468568 18:79104815-79104837 CTGGAGGTCAAGGCTGCTGTGGG - Intronic
1160488498 18:79316425-79316447 CATGGGAAGAAGGCTGCTGAGGG - Intronic
1160505915 18:79426826-79426848 CAGGGCATGGTGGCTGCTATGGG - Intronic
1161192782 19:2968401-2968423 CAGGGGATGGAGGGGGCTTTTGG - Intergenic
1161262640 19:3346216-3346238 GAGGGGCTGAAGGCTGCTGGAGG - Intergenic
1161275012 19:3411087-3411109 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1161287114 19:3474347-3474369 CTGGGGAAGGAGGCTGCTTTTGG - Exonic
1162141305 19:8586937-8586959 CAGGGGAGGCAGGCAGGTGTTGG - Intronic
1162433293 19:10642304-10642326 CAGGGGGTGGGGGCTGCTCTGGG + Intronic
1162965579 19:14154322-14154344 CAGGCCATGGAGACTGCTGTTGG - Intronic
1162998497 19:14351261-14351283 CAGGGAATAAAGGCTGCCCTCGG + Intergenic
1163055514 19:14714692-14714714 CAGGGGATGAGGGATGATCTGGG + Intronic
1163138058 19:15327468-15327490 CGGGGGGTGGAGGCTGCAGTGGG + Intronic
1163286349 19:16350669-16350691 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1163427606 19:17247716-17247738 CAGGTGTTCAAGGCTGCAGTGGG + Intronic
1163446493 19:17349717-17349739 CAGGAGCTGAAGGCTGCAGTGGG - Intergenic
1163614462 19:18318452-18318474 CAGGGGAGGAGGGCTGCGGGCGG + Intronic
1163741584 19:19017109-19017131 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1163762209 19:19143726-19143748 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
1163854808 19:19692967-19692989 CAGGAGGTGAAGGCTGCAGTGGG + Intergenic
1164484923 19:28647169-28647191 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1165063061 19:33214223-33214245 CAGGGCTTGCACGCTGCTGTGGG - Intronic
1165520765 19:36312057-36312079 TAGGGGATGAAGGCTGGACTTGG + Intergenic
1165623307 19:37266528-37266550 TAGGGGATGAAGGCTGGACTTGG - Intergenic
1165782013 19:38440463-38440485 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1166015697 19:39977889-39977911 CAGGAGATTAAGGTTGCAGTGGG - Intronic
1166565532 19:43763152-43763174 CCTGGGATGAAGGGGGCTGTTGG + Intergenic
1166575423 19:43832914-43832936 CTGGGGATGGAGGCTGAGGTAGG + Intronic
1166599104 19:44078535-44078557 CAGGGGTTCAAGGCTGCAGTGGG - Intronic
1166676674 19:44745438-44745460 CATTGGAGGGAGGCTGCTGTGGG + Intergenic
1166800685 19:45455303-45455325 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1166894770 19:46016467-46016489 CAGGGGATGGAGACTGATGGTGG - Intronic
1167045732 19:47047770-47047792 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1167279933 19:48561056-48561078 CAGGAGACGGAGGTTGCTGTGGG + Intronic
1167857072 19:52250834-52250856 CAGGAGGTGGAGGCTGCAGTGGG - Intergenic
1168187266 19:54708284-54708306 CTGGTGAACAAGGCTGCTGTGGG - Intergenic
1168434933 19:56309505-56309527 AAAGGGATGCAGGCTGCAGTTGG + Intronic
1168506812 19:56942360-56942382 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1168512718 19:56986248-56986270 CAGGGGAAGATGGCCGCTATCGG + Intergenic
1168617864 19:57852924-57852946 CAGGAGGTGAAGGTTGCAGTGGG - Intronic
1168659249 19:58153780-58153802 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
925178075 2:1798745-1798767 AGGGGCATGAAGGCTGCTGCAGG + Intronic
925238870 2:2304242-2304264 CAGGGGATACAGTCTGGTGTTGG + Intronic
925382934 2:3439365-3439387 CAGGGGCTTGAGGCTGCAGTGGG - Intronic
925761887 2:7192634-7192656 CAGGAGTTCAAGGCTGCTGCAGG + Intergenic
925901475 2:8512215-8512237 CTGTGGGTGAAGGCTGCTGAAGG - Intergenic
926387764 2:12354404-12354426 CAGGGGATGTTGGCTGGTCTAGG - Intergenic
927482337 2:23464354-23464376 CATGGGCTGAAAGCTGCTGGCGG - Intronic
927804501 2:26134187-26134209 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
928112479 2:28521933-28521955 CAGGGAGTGCAGGCTGCTGCAGG - Intronic
928306477 2:30174095-30174117 CAGGAGGTGGAGGCTGCAGTGGG - Intergenic
928603927 2:32926851-32926873 CAGGGGAGGAATGCTGATGGGGG - Intergenic
929249824 2:39740778-39740800 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
929499282 2:42476401-42476423 CAGGAGGTTAAGGCTGCAGTGGG + Intronic
929704455 2:44195601-44195623 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
929729683 2:44474371-44474393 CAGGAGATGGAGGTTGCAGTGGG + Intronic
929941541 2:46337676-46337698 CAAAGGAAGAAGGCTGCTGATGG + Intronic
930184552 2:48399629-48399651 CAGGAGTTTAAGGCTGCAGTGGG - Intergenic
930320965 2:49854188-49854210 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
931388247 2:61816532-61816554 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
932394882 2:71436587-71436609 CAGGAGATGGAGGTTGCGGTGGG - Intergenic
932442504 2:71746685-71746707 CAGAGGATGAAGGCTGAAATGGG - Intergenic
933327697 2:80859821-80859843 CAGGAGATCAAGGCTGCATTGGG - Intergenic
933855715 2:86412324-86412346 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
934529279 2:95075089-95075111 CAGGTGACGAAGGCTCCTGGAGG + Intergenic
934550962 2:95261366-95261388 CAGGGGGCGAAGGTTGCAGTGGG - Intergenic
934842031 2:97631585-97631607 CAGGAGGTGAAGGTTGCAGTGGG + Intergenic
935267349 2:101406403-101406425 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
935797190 2:106654674-106654696 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
936074126 2:109390893-109390915 CCCGGCATGAATGCTGCTGTGGG + Intronic
936973345 2:118195610-118195632 CAGGAGCTCAAGGCTGCAGTGGG - Intergenic
937056996 2:118946331-118946353 CAGGGGTTGATGACTGCTGGTGG - Intronic
937270222 2:120645154-120645176 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
938077727 2:128348845-128348867 CAGGTCCTGAGGGCTGCTGTTGG + Intergenic
938641871 2:133289615-133289637 CAGGAGGTGAAGGTTGCAGTGGG + Intronic
938891720 2:135712335-135712357 CAGGAGATGGAAGCTGCAGTAGG - Intronic
938910981 2:135885806-135885828 CATGGGATGCAGGCTGCCCTTGG + Intergenic
940682377 2:156803372-156803394 CAGGGCAGGAAGGTTCCTGTCGG - Intergenic
940869051 2:158844590-158844612 CAGGGGTTTAGGGCTGCTGTTGG + Intronic
940943364 2:159588448-159588470 CAGGAGTTGGAGGCTGCAGTGGG + Intronic
940947109 2:159630247-159630269 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
941583693 2:167331344-167331366 CTGGGGATGATGGCAGCAGTGGG + Intergenic
941930732 2:170936298-170936320 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
943594926 2:189844929-189844951 CAGGAGATGGAGGCTGTAGTGGG - Intronic
944571434 2:201049048-201049070 CAGGAGGTCAAGGCTGCAGTAGG + Intronic
945249813 2:207755304-207755326 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
946112417 2:217431622-217431644 CAGGCATTGAAAGCTGCTGTGGG + Intronic
946242523 2:218365632-218365654 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
946424399 2:219585324-219585346 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
947161581 2:227220531-227220553 CAGGAGTTGGAGGCTGCAGTTGG - Intronic
947397234 2:229698128-229698150 CAGGAGTTCAAGGCTGCGGTGGG + Intronic
947415671 2:229892790-229892812 CAGGAGATGGAGACTGCAGTGGG + Intronic
947883165 2:233538953-233538975 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
947883427 2:233542602-233542624 CAGGAGGTCAAGGCTGCAGTAGG + Intronic
948176911 2:235950571-235950593 CAGGGGATGAAGGCTGCTGTAGG + Intronic
948202189 2:236137228-236137250 CCGGGCAAGAAGGCTGCTGCTGG - Intergenic
948439206 2:237975710-237975732 CAGGAGGTGAAGGTTGCAGTGGG - Intronic
948811657 2:240481487-240481509 CAGGGCATGGAGGCTGCCTTTGG + Intronic
949027993 2:241775202-241775224 CAGGGGGTGAAGGTGGCTGGTGG + Intergenic
1169337004 20:4764935-4764957 CATTGGTTGAAGGCTGCTCTTGG - Intergenic
1169340485 20:4792760-4792782 CAGGTGATGAAGGGTGCAGATGG + Intronic
1169438642 20:5615557-5615579 CAGGAGGTGGAGGCTGCAGTGGG - Intergenic
1169746351 20:8946889-8946911 CAGGGGAGGAAAGCTGCAGCAGG - Intronic
1169769409 20:9184994-9185016 CAGGTGGTCAAGGCTGCAGTGGG - Intronic
1170431237 20:16278794-16278816 CAGGGGATGGCGGGTGCTGTGGG - Intronic
1170729917 20:18964806-18964828 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1171132102 20:22663495-22663517 CAGGGGAATAAAGCTGCTGTTGG - Intergenic
1172021582 20:31918443-31918465 CAGGAGATCAGGGCTGCAGTGGG - Intronic
1172252938 20:33492586-33492608 CAGGAGGTTGAGGCTGCTGTGGG - Intronic
1172476094 20:35238946-35238968 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1172844524 20:37921914-37921936 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1172936681 20:38625490-38625512 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1174337747 20:49875242-49875264 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1175063810 20:56268165-56268187 CAGGAGATGAAGGTTGCAGTGGG - Intergenic
1175309481 20:58001717-58001739 CAGGGGAGGTAGGCTGCTTGGGG + Intergenic
1175413645 20:58787343-58787365 CAGGGGAGGAGGGCTGCTCAGGG + Intergenic
1175414924 20:58794920-58794942 CTGGGGAAGGAGGCTGCTGCAGG - Intergenic
1175673156 20:60923629-60923651 CAGGTGATCAAGGCTGATGCAGG - Intergenic
1176590403 21:8643802-8643824 GAGGGAATGCAGGCTGCTTTGGG + Intergenic
1177526418 21:22297160-22297182 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1177666758 21:24169562-24169584 CAGCAGATCAAGGCTGCAGTGGG + Intergenic
1177667962 21:24186159-24186181 CAGGTGGTGGAGGCTGCAGTGGG + Intergenic
1178019911 21:28396135-28396157 CAGGGGATGAACCCTCCTCTGGG + Intergenic
1179374561 21:40838358-40838380 CAGGGGCTGAGGGGGGCTGTTGG - Intronic
1179551449 21:42146435-42146457 CTGGGGAGGAAGGCTGTGGTGGG + Intergenic
1179551512 21:42146651-42146673 CTGGGGAGGAGGGCTGCAGTGGG + Intergenic
1180056019 21:45359620-45359642 GAGGGGATGGGGGCTGCTCTAGG + Intergenic
1180220262 21:46354174-46354196 CAGGGGAGGAAGGCTGCTTGCGG + Intronic
1180273233 22:10620835-10620857 GAGGGAATGCAGGCTGCTTTGGG + Intergenic
1181491235 22:23262156-23262178 CAGCGGAGGAAGCCTGCTTTAGG - Intronic
1181587593 22:23862052-23862074 GAGGGGGTGGAGGCTGTTGTTGG + Intronic
1181754127 22:25011048-25011070 CAGGAGGTGAAGGCTGCAGTGGG - Intronic
1181803571 22:25362067-25362089 CAGGGCATGAGGGATGCTCTGGG - Exonic
1181933050 22:26418102-26418124 CGGGAGTTGAAGGCTGCAGTGGG + Intergenic
1182039567 22:27225943-27225965 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1182076882 22:27500958-27500980 CAGGAGTTCAAGGCTGCAGTAGG + Intergenic
1182119064 22:27775187-27775209 CAGCGGCTGGAGGGTGCTGTGGG + Intronic
1182185129 22:28393618-28393640 CAGGAGGTAAAGGCTGCAGTGGG + Intronic
1183218687 22:36497868-36497890 CCTAAGATGAAGGCTGCTGTGGG - Intronic
1183397952 22:37583790-37583812 CAGGAGGTCAAGGCTGCAGTCGG + Intergenic
1183839570 22:40486897-40486919 TAGGGGGTCAAGGCTGCAGTGGG + Intronic
1183996154 22:41634257-41634279 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1184050710 22:42001972-42001994 AAGAGGAGGCAGGCTGCTGTGGG + Intronic
1184161530 22:42700157-42700179 CAGGGGACGAGGGCTGCGCTGGG - Intronic
1184583183 22:45430620-45430642 CTGGGAGTGGAGGCTGCTGTAGG + Intronic
1184723648 22:46330407-46330429 AAGGAGATGCAGGCTGCAGTGGG + Exonic
1185097714 22:48820830-48820852 CAGAGGCTCAAGGCTGGTGTTGG - Intronic
1185119526 22:48957685-48957707 TCGGGTCTGAAGGCTGCTGTGGG - Intergenic
1185263561 22:49885118-49885140 CGGGGGAAGAAGGGTGATGTGGG + Exonic
1185346967 22:50314685-50314707 GAGGGGCTGCAGGCAGCTGTGGG + Exonic
949136875 3:577873-577895 GAGGGAATGCAGGCTGCTTTGGG - Intergenic
949525872 3:4902764-4902786 CAGGTGATTAAGGCTGCAGTGGG + Intergenic
949988103 3:9554896-9554918 CAGGAGTTCAAGGCTGCTGTGGG + Intergenic
950140015 3:10608987-10609009 CGGGGAAGGAAGGTTGCTGTTGG - Intronic
950552376 3:13674604-13674626 CAGAGGATGCAGAGTGCTGTGGG + Intergenic
950663135 3:14479322-14479344 GAGGGGAGGAAGGCTGCTCCAGG + Intronic
950807020 3:15614195-15614217 CAGGAGTTTAAGGCTGCAGTGGG - Intronic
951134289 3:19085080-19085102 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
951473566 3:23081492-23081514 CATGGGTTGAAGGCTGCTTCTGG - Intergenic
951641443 3:24840441-24840463 CAAGGAATGATGGTTGCTGTGGG + Intergenic
952309385 3:32174189-32174211 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
952424462 3:33160479-33160501 CAGGAGATTGAGGCTGCAGTGGG + Intronic
952485466 3:33805506-33805528 CAGGAGATCGAGGCTGCAGTAGG - Intronic
952623652 3:35377083-35377105 CAGGGGAAGAAGGCCTCCGTGGG + Intergenic
952642616 3:35615181-35615203 CAGGAGGTGGAGGCTGCAGTGGG + Intergenic
952923116 3:38300880-38300902 CAGGAGTTTAAGGCTGCAGTGGG - Intronic
952957462 3:38565891-38565913 CAGGGGGAGAAGGCTACTGAAGG - Intronic
953232106 3:41074499-41074521 CATGGGTTGAGGGCTGCTGGAGG - Intergenic
953265236 3:41380700-41380722 CAGGGGAAGAAGGCTGACCTGGG - Intronic
953295157 3:41707752-41707774 CAGGAGATCAAGGCTGCAGTGGG + Intronic
953738548 3:45516805-45516827 GGGGAGATGAAGGGTGCTGTGGG - Intronic
954017296 3:47704841-47704863 CAGGAGATGGAGGCTGCAATGGG + Intronic
954389938 3:50263423-50263445 CTGGAGGTCAAGGCTGCTGTGGG + Intergenic
954563786 3:51581169-51581191 CAGGAGATGGAGGTTGCAGTGGG - Intronic
954819327 3:53312022-53312044 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
954954731 3:54508978-54509000 CAGAGTATGCAGGCTGCTGGAGG + Intronic
955259498 3:57371585-57371607 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
955260500 3:57384568-57384590 CAGGAGATGGAGGCTGCAGTGGG + Intronic
955683253 3:61524696-61524718 CAGGGCGTCAAGGCTGCAGTGGG + Intergenic
956695361 3:71914228-71914250 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
956839043 3:73120286-73120308 CAGGGGACGGAGGTTGCAGTAGG - Intergenic
958450340 3:94265350-94265372 AAGGGGATGAAGTAGGCTGTGGG - Intergenic
958544168 3:95519441-95519463 CAGGAATTGAAGGCTGCAGTAGG - Intergenic
959457490 3:106580830-106580852 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
959570006 3:107872933-107872955 CAGGAGTTCAAGGCTGTTGTTGG + Intergenic
959944509 3:112112612-112112634 TAAGGGATGAAGGCTGGGGTTGG + Intronic
960077340 3:113502298-113502320 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
960252950 3:115476987-115477009 CAGGAGGTTAAGGCTGCAGTGGG + Intergenic
960831257 3:121851249-121851271 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
960960522 3:123067415-123067437 CAGGGGCAGGAGGCAGCTGTGGG + Intronic
961237799 3:125383264-125383286 CATTCAATGAAGGCTGCTGTTGG + Intergenic
961501055 3:127336374-127336396 GAGGGCATGAAAGCGGCTGTGGG - Intergenic
961662918 3:128479892-128479914 CAGGGGGTGAAGGCAGGAGTTGG - Exonic
961745602 3:129061915-129061937 CACGGACTGAAGGCTGTTGTTGG - Exonic
961832387 3:129630380-129630402 CAGGGGTTTGAGGCTGCAGTGGG - Intergenic
961853456 3:129845112-129845134 CAGGCGATGGAAGCTGCAGTTGG + Intronic
963130741 3:141855623-141855645 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
964334368 3:155639385-155639407 CAGGAGGTTAAGGCTGCAGTGGG + Intronic
964929307 3:161997126-161997148 CAGGAGCTGGAGGCTGCAGTGGG - Intergenic
965970176 3:174544947-174544969 TAGGAGATCAAGGCTGCAGTGGG - Intronic
966377229 3:179308688-179308710 CAGGAGGTCAAGGCTGCAGTAGG + Intergenic
967009354 3:185417616-185417638 AAAGGAAAGAAGGCTGCTGTTGG - Intronic
967114790 3:186327458-186327480 CAGGAGTTCAAGGCTGCTGTGGG - Intronic
967475206 3:189908566-189908588 CAGGGGAAGATGACTTCTGTGGG + Intergenic
967870308 3:194224070-194224092 CAGGGGTTGAAGGGTGCTGGTGG - Intergenic
967918074 3:194593882-194593904 CAGGAGATGGAGGCAGCAGTGGG - Intronic
968756828 4:2420599-2420621 CATGGGATGAAGGCTGAACTTGG + Intronic
969137155 4:5039058-5039080 CAGGAGTTGGAGACTGCTGTGGG - Intergenic
969254151 4:5991146-5991168 GAGGGCATGGAGGGTGCTGTGGG - Intergenic
969337567 4:6520643-6520665 GAGGTGAGGAAGGCTGCTGTTGG - Intronic
969562651 4:7959482-7959504 GAGGGGATGAAGGCTGGGGTCGG - Intergenic
969808111 4:9626667-9626689 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
970160100 4:13179660-13179682 TGGGGGAGCAAGGCTGCTGTTGG - Intergenic
972219371 4:36936162-36936184 CAGGGGAAAGAGGCGGCTGTGGG + Intergenic
972286901 4:37657836-37657858 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
972367899 4:38393212-38393234 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
972630308 4:40836401-40836423 CAGGAGATGGAGGTTGCAGTAGG + Intronic
972906932 4:43761511-43761533 CTGGAGATGAAGGTTGCAGTGGG - Intergenic
972987354 4:44780711-44780733 CAGGAGGTTAAGGCTGCAGTGGG - Intergenic
973234206 4:47880338-47880360 CAGGAGGTGCAGGCTGCAGTGGG + Intronic
975100123 4:70503452-70503474 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
975585758 4:75946881-75946903 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
976605091 4:86975322-86975344 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
978600079 4:110418734-110418756 GAGGGGGTGGAGGCCGCTGTGGG + Intronic
978737266 4:112098203-112098225 CTGGGGATGAAGTCTGCAATTGG - Intergenic
978840623 4:113207933-113207955 CAGGGGATGAAGTGTGCTATGGG + Intronic
980927058 4:139148219-139148241 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
980940318 4:139268041-139268063 CAGGAGTTCAAGGCTGCAGTAGG + Intronic
980966618 4:139527482-139527504 CAGGAGCTCAAGGCTGCAGTGGG + Intronic
981306954 4:143256583-143256605 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
981514066 4:145588072-145588094 CTGGGGATTGAGGCTGTTGTTGG - Intergenic
982552547 4:156821300-156821322 CAGGAGATCAAAGCTGCAGTGGG - Intronic
983255732 4:165397976-165397998 CAGGAGTTGGAGGCTGCAGTGGG + Intronic
983552214 4:169029125-169029147 CAGGAGATGGAGGCTGCAGATGG + Intergenic
984076658 4:175189997-175190019 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
984628631 4:182037219-182037241 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
985486407 5:154077-154099 CAGGAGGTGGAGGTTGCTGTGGG - Intronic
985545033 5:505159-505181 TAAGGGAGGGAGGCTGCTGTGGG + Intronic
986341264 5:6791273-6791295 GAGGGGATGAATGAGGCTGTGGG - Intergenic
988009747 5:25466882-25466904 GAGGGGGTCAAGGCTGCAGTGGG + Intergenic
988040195 5:25879097-25879119 CAGGGGTTGAAGGCTGCAGTGGG + Intergenic
988159614 5:27502755-27502777 CAGCCCATGAAGGCAGCTGTGGG - Intergenic
988563088 5:32298339-32298361 TAGGGAAAGAAGGGTGCTGTTGG + Intronic
989075450 5:37560883-37560905 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
989147333 5:38261866-38261888 CTGGGGATTAAGGCTGGTGAGGG + Intronic
989225770 5:39026267-39026289 CAGGAGGTTAAGGCTGCAGTGGG + Intronic
990112955 5:52350561-52350583 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
990556653 5:56943070-56943092 CAGGAGGTCAAGGCTGCAGTTGG + Intronic
990678297 5:58213298-58213320 CATTGGCTGAAGGCTACTGTTGG - Intergenic
990800639 5:59598868-59598890 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
991772837 5:70055876-70055898 CAGGAGGTGGAGGCTGCAGTAGG - Intronic
991852130 5:70931300-70931322 CAGGAGGTGGAGGCTGCAGTAGG - Intronic
992250884 5:74875177-74875199 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
992840894 5:80693729-80693751 CAGGAGATGGAGGTTGCAGTGGG - Intronic
993953284 5:94201479-94201501 CAAAGGATCAAGGCTGCAGTAGG - Intronic
993982893 5:94564283-94564305 CAGGAGGTCAAGGCTGCAGTAGG - Intronic
994203673 5:97008422-97008444 CAGGGGTTTGAGGCTGCAGTGGG - Intronic
996749352 5:126873485-126873507 CAGGTGATGCAGCCTGCTGCTGG - Intronic
997296311 5:132771130-132771152 CTGGTGATGAGGGCTGCTCTAGG - Intronic
997303753 5:132824276-132824298 CAGGGGGTGAATGGTTCTGTAGG - Exonic
997303919 5:132825130-132825152 CAGGAGATGCAGGCTGGTGAGGG - Intronic
997352868 5:133243603-133243625 CAGGGCATGTAGGTGGCTGTAGG + Intronic
997482287 5:134195322-134195344 CAGGAGATGGAGGTTGCAGTGGG - Exonic
999036207 5:148353488-148353510 CAGGGGATGTCAGCTGCTGCTGG - Intergenic
999826737 5:155280952-155280974 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1000306932 5:160003242-160003264 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1000888175 5:166772263-166772285 CAGGGAAAGCAGGCTGCTGTGGG + Intergenic
1000971180 5:167716308-167716330 CAGGAGATGAAAGCTGAAGTCGG - Intronic
1001118993 5:168963243-168963265 CAGGAGATGGAGGTTGCAGTAGG - Intronic
1002034363 5:176455373-176455395 TAGGAGGTGAAGGCTGCAGTGGG + Intronic
1002072613 5:176689244-176689266 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1002097980 5:176843284-176843306 CAGGGGAAGGACGCTGCCGTGGG + Intronic
1002101723 5:176861215-176861237 CAGGGAGCGTAGGCTGCTGTTGG - Intronic
1002141285 5:177141402-177141424 CAGGAGATGGAGGTTGCCGTGGG - Intronic
1002207372 5:177572818-177572840 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1002362265 5:178681812-178681834 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
1002656650 5:180753810-180753832 CAGGGGAGCGTGGCTGCTGTGGG - Intergenic
1003193564 6:3895185-3895207 CAGGAGCTCAAGCCTGCTGTGGG + Intergenic
1003817907 6:9862578-9862600 CAGGCCATGAAAGCAGCTGTGGG - Intronic
1003916590 6:10792356-10792378 CAGAGGAGGCAGGCTGCTGCTGG - Intronic
1004194369 6:13489922-13489944 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1004459559 6:15823053-15823075 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1004462050 6:15846872-15846894 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1004927601 6:20430949-20430971 CAGGAGATGGAGGTTGCAGTGGG + Intronic
1004944049 6:20592540-20592562 CAGGAGGTGAAGGTTGCAGTGGG - Intronic
1005873429 6:29994391-29994413 CCAGGGATGGAGGGTGCTGTGGG + Intergenic
1005898934 6:30200693-30200715 CAGGGGCAGGAGGCTGCTCTTGG - Intronic
1005961735 6:30698553-30698575 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1006100767 6:31684784-31684806 CAGGGGATTAACTCTTCTGTTGG + Intergenic
1006536896 6:34706576-34706598 CAGGAGATTGAGGCTGCGGTGGG - Intergenic
1006607883 6:35272029-35272051 CAGGAGATCAAGGCTGCAGTGGG + Intronic
1006814877 6:36843361-36843383 CAGTGGCTGAGGGCTGCTTTTGG + Intergenic
1007586400 6:42992746-42992768 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1007609489 6:43140038-43140060 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1008838653 6:55869802-55869824 CAGTGGGTGGAGGCTGCAGTTGG + Intronic
1008965927 6:57312426-57312448 CAGGAGGTGGAGGCTGCAGTGGG + Intergenic
1009576652 6:65471320-65471342 CAGGAGGTTGAGGCTGCTGTGGG + Intronic
1010224747 6:73478610-73478632 CAGGGGGTGGAGGTTGCAGTGGG - Intronic
1010472042 6:76240271-76240293 AAAGCAATGAAGGCTGCTGTTGG + Intergenic
1010873975 6:81078306-81078328 CAGGAGTTCAAGGCTGCAGTTGG - Intergenic
1011460075 6:87593768-87593790 CTGGAGATGGAGGCTGCAGTGGG - Intronic
1012798166 6:103790223-103790245 CAGGGAATGAAGGCTGCCTCTGG + Intergenic
1012917898 6:105190147-105190169 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
1013129183 6:107215316-107215338 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1013724598 6:113078026-113078048 GAGGGGATGAATCCAGCTGTGGG + Intergenic
1014214366 6:118738454-118738476 CAGGGGATAGAGGCTGCAGTGGG + Intergenic
1014254335 6:119146502-119146524 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1014783484 6:125591525-125591547 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1014843416 6:126246171-126246193 CAGGAGATCGAGGCTGCAGTGGG + Intergenic
1015792048 6:136973694-136973716 CAGGAGAAGAAGGTTGCAGTGGG - Intergenic
1015972578 6:138757676-138757698 CAGGGGGTGAAGGTTGCAGTGGG - Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016513002 6:144864279-144864301 CAGCCCATGAAGGCAGCTGTAGG + Intergenic
1016958519 6:149649544-149649566 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1016961604 6:149677944-149677966 CAGGAGATGGAGGTTGCAGTGGG + Intronic
1017001261 6:149999327-149999349 CAGGGGAGCTAAGCTGCTGTTGG - Intergenic
1017539277 6:155383460-155383482 CAGGAGTTGGAGGCTGCAGTAGG + Intergenic
1018014919 6:159703238-159703260 CAGGAGATGGAGGTTGCAGTGGG + Intronic
1018406737 6:163493202-163493224 CAGGAGGTGAAGGTTGCAGTGGG - Intronic
1018450407 6:163902047-163902069 CCAGGGAAGAAGGCTGCTGGGGG + Intergenic
1019042990 6:169121456-169121478 CAGGGAATGGAGGCTACTTTGGG + Intergenic
1019155857 6:170038450-170038472 CCTGGGATGACGGCTGCAGTGGG + Intergenic
1019787204 7:2984625-2984647 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1019791375 7:3016022-3016044 CAGGAGTTCAAGGCTGCAGTAGG + Intronic
1019894627 7:3974108-3974130 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1021629404 7:22629677-22629699 AAGGGGATGAAGGTCACTGTCGG + Intronic
1021725239 7:23542252-23542274 CAGGAGTTGTAGGCTGCAGTGGG - Intergenic
1022002712 7:26241183-26241205 CAGGAGATGTAGGCTGCAGTGGG - Intergenic
1022495049 7:30847811-30847833 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1022547485 7:31202298-31202320 CAGAGAATCAAGGCTACTGTGGG + Intergenic
1023023744 7:36033365-36033387 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG + Intergenic
1023307060 7:38841675-38841697 CAGGAGATGGAGGTTGCAGTAGG - Intronic
1023504777 7:40888219-40888241 TAGGAGAGGAAGCCTGCTGTAGG - Intergenic
1023561991 7:41484811-41484833 CAGGAGTTAAAGGCTGCGGTGGG + Intergenic
1023806513 7:43876624-43876646 CAGGTGTAGGAGGCTGCTGTGGG - Exonic
1024541529 7:50479162-50479184 CAGGGGACACAGGCTGCTCTGGG - Intronic
1024614138 7:51093818-51093840 CAGGGATTGAAGGCTGCAGGAGG + Intronic
1024667685 7:51563008-51563030 CCGGGGGTGAAGGTTGCAGTGGG - Intergenic
1025034586 7:55585796-55585818 CAGGAGGTGAAGGTTGCAGTGGG + Intergenic
1025929322 7:65981886-65981908 CAGGGGAAGAAGTCTGCGGGGGG + Intronic
1026051786 7:66952923-66952945 CAGGGGAGGAAGCCTGCTGGAGG + Intronic
1026098806 7:67368072-67368094 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1026385790 7:69846563-69846585 AAGGGGAAGAAAGTTGCTGTGGG - Intronic
1026409640 7:70106644-70106666 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1026502953 7:70958465-70958487 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
1026534274 7:71227288-71227310 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1026552492 7:71380407-71380429 CAGGAGTTCAAGGCTGCTGGGGG - Intronic
1026729197 7:72896410-72896432 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1027113570 7:75460426-75460448 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1027114807 7:75470704-75470726 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1027285820 7:76645021-76645043 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1027384009 7:77642348-77642370 CAGGTGGTCAAGGCTGCAGTAGG - Intergenic
1027404975 7:77850566-77850588 CAGGAGATTGAGGCTGCAGTGGG + Intronic
1027620380 7:80477982-80478004 CAGGAGGTCAAGGCTGCAGTAGG - Intronic
1028185354 7:87778367-87778389 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1029250603 7:99233489-99233511 CAGGGGAAGGAGGCTGATCTGGG - Intergenic
1029743478 7:102504180-102504202 CAGGAGGTGGAGGCTGCAGTGGG - Intronic
1029761467 7:102603339-102603361 CAGGAGGTGAAGGCTGCAGTGGG - Intronic
1029904345 7:104075044-104075066 CAGGAGGTGGTGGCTGCTGTGGG + Intergenic
1030039599 7:105437740-105437762 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1030673487 7:112362455-112362477 CAGGGAATGAAAGCTGATGAAGG - Intergenic
1031014226 7:116555363-116555385 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1031404561 7:121369051-121369073 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1031500471 7:122508536-122508558 CAGGAGTTCAAGGCTGCAGTAGG - Intronic
1032788264 7:135219251-135219273 CAGGAGGTTAAGGCTGCAGTGGG - Intergenic
1032871820 7:135993966-135993988 CAGGAGGTGAAGGTTGCAGTGGG + Intergenic
1033176327 7:139127232-139127254 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
1033242055 7:139688511-139688533 CAGGAGCTGATGGCTGCTGCCGG + Intronic
1033315476 7:140293763-140293785 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1033485983 7:141789711-141789733 CAGGAGATGGAAGCTGCAGTGGG - Intergenic
1033935724 7:146583316-146583338 CAGTGGATGGAGGCAGCTGTTGG + Intronic
1034193863 7:149230981-149231003 CAGGAGCTCAAGGCTGCAGTGGG - Intergenic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1035882887 8:3261625-3261647 CAGGGAATGGAGGCAGCAGTTGG - Intronic
1036098066 8:5746674-5746696 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1036471273 8:9054852-9054874 CAGGGTGTCAAGGCTGCAGTGGG + Intronic
1036513605 8:9422785-9422807 CAGGAGGTGGAGGCTGCAGTGGG + Intergenic
1036655918 8:10677238-10677260 GAGGGGCGGAAGGCAGCTGTAGG - Intronic
1036658033 8:10690424-10690446 CGGGGGATGAAGGATGCTGTTGG + Intronic
1036702036 8:11019337-11019359 CAGGGGATGGAGGCTTCCCTGGG - Intronic
1036809897 8:11860548-11860570 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1037254476 8:16937557-16937579 CAGGTGATTAATGATGCTGTTGG - Intergenic
1037258695 8:16983073-16983095 CAGGAGATTAAGGCTTCAGTGGG + Intergenic
1037518126 8:19653718-19653740 CAGGGGATCAAGGCTACAATCGG + Intronic
1038258668 8:25973747-25973769 CAGGAGGTGGAGGCTGCAGTGGG - Intronic
1038504255 8:28070916-28070938 CAGGAGTTGTAGGCTGCAGTGGG + Intronic
1038610288 8:29054555-29054577 CAGTGGATGAAGGCTGGGGAGGG + Intronic
1038874944 8:31538383-31538405 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1039891891 8:41691150-41691172 CAGGAGTTTAAGGCTGCAGTGGG + Intronic
1039906152 8:41787739-41787761 CAGGAGGTGGAGGCTGCAGTGGG + Intronic
1040472820 8:47749750-47749772 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
1040672905 8:49713790-49713812 CATGGAATGTAGCCTGCTGTGGG - Intergenic
1041679445 8:60573418-60573440 AAGTTGCTGAAGGCTGCTGTGGG + Intronic
1041717814 8:60948150-60948172 CAGGAGGTGGAGGCTGCAGTGGG - Intergenic
1042137489 8:65645597-65645619 CAGGAGGTGGAGGCTGCAGTGGG - Intronic
1042248869 8:66736529-66736551 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1042716657 8:71780636-71780658 CAGGGGATGAAATGTGCTGATGG - Intergenic
1042905811 8:73770677-73770699 CAGGAGATCAAGGCTGCAGTGGG + Intronic
1043861116 8:85318292-85318314 AAGGGTTTGAAAGCTGCTGTGGG - Intergenic
1044774087 8:95669626-95669648 CAGGGGATATAGGTTGGTGTTGG - Intergenic
1045270651 8:100658252-100658274 TAGGAGATGGAGGCTACTGTTGG + Intronic
1045999240 8:108399275-108399297 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1046214491 8:111126181-111126203 CAGGGGATGGAGGTTGCAGTGGG - Intergenic
1046754893 8:117962850-117962872 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1047429569 8:124779446-124779468 CAGGAGGTCGAGGCTGCTGTGGG - Intergenic
1047764551 8:127979951-127979973 CAGGAGATCAAGGCTGTAGTGGG - Intergenic
1047781762 8:128117398-128117420 CAAAGGATGAAGGCAGCTGGCGG - Intergenic
1048883598 8:138890520-138890542 CAGGAGTTCAAGGCTGCAGTAGG - Intronic
1049536185 8:143183540-143183562 CAGTGGAGGAAGGCTCCTGAGGG + Intergenic
1050492410 9:6202101-6202123 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1050548627 9:6730034-6730056 CAGGAAATGGAGGCTGCAGTGGG + Intronic
1050623287 9:7477161-7477183 AAAGGAAAGAAGGCTGCTGTTGG - Intergenic
1051245638 9:15108250-15108272 CAGGAGGTTGAGGCTGCTGTGGG + Intergenic
1051365941 9:16321511-16321533 CAGGCATTGAAGGCTACTGTGGG + Intergenic
1053190495 9:36062549-36062571 CAGGAGGTGGAGGCTGCAGTGGG - Intronic
1053394136 9:37757155-37757177 CAGGAGATCAAGGCTCCAGTGGG - Intronic
1057097452 9:92325210-92325232 CAGAGAAAGAAGGCTGCCGTGGG - Exonic
1057272321 9:93658081-93658103 CTGGGCATGAAGGCACCTGTGGG + Intronic
1057581949 9:96295078-96295100 CAGGAGGTGAAGGTTGCAGTGGG - Intronic
1057616635 9:96596783-96596805 CAGGAGGTCAAGGCTGCAGTGGG + Intronic
1057976374 9:99609922-99609944 GAGGGCATGTAGGCTGCTGGAGG - Intergenic
1059210077 9:112505794-112505816 CACGGGATCCAGGCAGCTGTAGG + Intronic
1059406720 9:114103180-114103202 CAGGTGGTGGAGGTTGCTGTGGG + Intergenic
1059858905 9:118434969-118434991 CAGGAGGTGAAGGTTGCAGTGGG - Intergenic
1059936656 9:119318618-119318640 CAGGGGATGAAGGCGATTGTTGG + Intronic
1060573867 9:124670316-124670338 CAGGAGTTGGAGGCTGCAGTGGG + Intronic
1060608006 9:124934971-124934993 CAGGAGGTTAAGGCTGCAGTGGG + Intronic
1060654557 9:125360933-125360955 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1060729390 9:126027633-126027655 CAGGGGAAGTGGGATGCTGTGGG - Intergenic
1060842073 9:126801668-126801690 CAGGAGATTGAGGCTGCAGTGGG - Intergenic
1060898113 9:127232380-127232402 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1061152218 9:128835427-128835449 CAGGGGCTGGAGGCTGCAGGGGG - Intronic
1061416821 9:130451576-130451598 CAGGTGGAGAAGGATGCTGTGGG - Intronic
1061551462 9:131337154-131337176 CAGGGGATGTGGGCTGATCTTGG - Intergenic
1061592690 9:131608240-131608262 CAGGAGAGGACGGCTGCTGCTGG - Intronic
1061716593 9:132522113-132522135 CAGGGGATGGGGGCTGTTGCAGG + Intronic
1061772080 9:132933137-132933159 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1061789085 9:133049119-133049141 CAGGGGTCGAAGGGTGCTGATGG - Intronic
1062026578 9:134343414-134343436 CAGGGGCTGCAGGATGCTGACGG - Intronic
1062205756 9:135335981-135336003 ATGGGGATGAAGGGTGCTGTGGG - Intergenic
1062702435 9:137914346-137914368 CAGGGTATGAAGTCTGGGGTGGG - Intronic
1203452523 Un_GL000219v1:133063-133085 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1203620411 Un_KI270749v1:122467-122489 GAGGGAATGCAGGCTGCTTTGGG + Intergenic
1185630228 X:1511591-1511613 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1185693022 X:2172114-2172136 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
1185722309 X:2391851-2391873 CAGGAGGTGAAGGTTGCAGTGGG + Intronic
1186077925 X:5900645-5900667 CAGGAGGTCAAGGCTGCAGTGGG - Intronic
1186142733 X:6593919-6593941 CAGAGGTTGGAGGCTGCAGTGGG + Intergenic
1186225808 X:7397769-7397791 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
1186486772 X:9939712-9939734 CAGGAGGTCAAGGCTGCGGTGGG - Intronic
1186907415 X:14126701-14126723 CAGGAGTTGAGGGCTGCTGTGGG - Intergenic
1188258009 X:27986017-27986039 CAGGAGGTCAAGGCTGCAGTGGG + Intergenic
1189337792 X:40181117-40181139 CAGGGGATGAATATTGGTGTAGG + Intergenic
1189722261 X:43932512-43932534 AGGGGGATGAAGGCTGCAGATGG + Intergenic
1190248759 X:48707164-48707186 CAGGGGTTGAAGAATGCTGGGGG - Intronic
1190716402 X:53107828-53107850 CATGAGTTCAAGGCTGCTGTGGG - Intergenic
1192049420 X:67710392-67710414 CAGGGGTTCCAGGCTGCAGTGGG - Intronic
1192187503 X:68960732-68960754 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1192233076 X:69278972-69278994 CCGGGAATAAAGTCTGCTGTGGG + Intergenic
1192694783 X:73401910-73401932 CTGGGGAAAAAGGCAGCTGTGGG + Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1193810270 X:86042747-86042769 CAGGAGGTTAAGGCTGCAGTGGG + Intronic
1193826926 X:86237728-86237750 CTGGGCATGATGGCTGCGGTGGG + Intronic
1194699214 X:97093112-97093134 CAGGAGATTGAGACTGCTGTAGG + Intronic
1195392261 X:104375020-104375042 CAGGAGGTCAAGGCTGCAGTAGG - Intergenic
1195793773 X:108621226-108621248 CAGGGGTTTGAGGCTGCAGTGGG - Intronic
1196024705 X:111029061-111029083 CAGGAGATGCAGGCTGCTGTGGG + Intronic
1196892274 X:120302700-120302722 CTGGAGCTGAAGGCTGCTGGGGG - Intronic
1198081657 X:133245858-133245880 CAGGAGATCAAGGCTGCAGTGGG - Intergenic
1198963718 X:142207132-142207154 CAGGGGCTGAGGGCTGGGGTTGG - Intergenic
1199761919 X:150911514-150911536 CAGGAGGTCAAGGCTGCAGTGGG - Intergenic
1199782929 X:151080080-151080102 CCTGGGATGAGGGCAGCTGTGGG + Intergenic
1200003323 X:153072834-153072856 CAGGGGAGGAGGGCGGCTGGGGG + Intronic
1200004400 X:153077175-153077197 CAGGGGAGGAGGGCGGCTGGGGG - Intergenic
1200736243 Y:6799289-6799311 TAGGAGATCAAGGCTGCAGTGGG - Intergenic
1200790606 Y:7295989-7296011 CAGGGGTTGAAGACTGCCCTGGG + Intergenic
1201340211 Y:12925425-12925447 CAGGGGAAGAAAGGTTCTGTTGG + Intergenic
1201441243 Y:14010639-14010661 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1201443328 Y:14032069-14032091 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1201736356 Y:17266625-17266647 CAGGGTATGAAGAGTGGTGTGGG - Intergenic