ID: 948179286

View in Genome Browser
Species Human (GRCh38)
Location 2:235966834-235966856
Sequence GTCTCTGCCTTAGGGCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948179279_948179286 2 Left 948179279 2:235966809-235966831 CCGACTGTGCAGAGAGGGGCGAG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 948179286 2:235966834-235966856 GTCTCTGCCTTAGGGCGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948179286 Original CRISPR GTCTCTGCCTTAGGGCGGCC AGG Intronic
900353692 1:2249467-2249489 GTCTCTGCCTTTGGTGGTCCCGG + Intronic
900518264 1:3093523-3093545 CTCTCTGCCTCTGGGCGCCCTGG + Intronic
901082055 1:6589077-6589099 GTCCCTGGCCCAGGGCGGCCTGG + Exonic
902164513 1:14559400-14559422 GTCTATGCTTTAGGATGGCCAGG + Intergenic
903770265 1:25759391-25759413 GTCCCTCCCTGAGGGCTGCCTGG + Intronic
906495696 1:46302726-46302748 GCCCCTGCCCTAGGGCAGCCGGG + Intronic
906687773 1:47773380-47773402 GCCTCTGCCTTAGGCAGGCAGGG + Intronic
907526721 1:55058076-55058098 GTCTCTGCCTCAACTCGGCCAGG - Exonic
911125629 1:94338526-94338548 TTCTCTGCCTTAGGGCAACTTGG - Intergenic
912526741 1:110289101-110289123 GTCTCTGCCTTTTGCCTGCCTGG - Intergenic
917499686 1:175575036-175575058 CTCTCTGCCTTCTGGAGGCCTGG + Intronic
1062909759 10:1205076-1205098 GTCTCTGCAGAATGGCGGCCGGG - Intronic
1067160296 10:43819667-43819689 ATCACTGCCATAGGGGGGCCAGG - Intergenic
1068166943 10:53342737-53342759 GTTTCTGCCCTAGGCGGGCCAGG + Intergenic
1075599393 10:123756306-123756328 GTCTGTTCCTTAGTGGGGCCCGG + Intronic
1076808064 10:132869214-132869236 GTCTCGCCCTTGGTGCGGCCAGG - Intronic
1076906635 10:133365641-133365663 GTCTCTGCCATGGGGAGGCTCGG - Intronic
1079431035 11:20388176-20388198 GCCTCTGCCCTAGGGTGCCCGGG + Intronic
1081051834 11:38350884-38350906 GTCTCTGCCTTAGGGCTCTGTGG - Intergenic
1088902408 11:114128203-114128225 GTCTCTTCCTTAGGAGAGCCTGG + Intronic
1089694920 11:120211072-120211094 GTCTCCGCCTCGGGGCCGCCGGG + Exonic
1089908526 11:122071691-122071713 TTCTCTGCCTCAGGGCGGGTTGG - Intergenic
1090520062 11:127469561-127469583 GGCTCTTCCCTAGGGCGACCTGG + Intergenic
1094649560 12:32362034-32362056 GTCAATGCCTTAGGGAGTCCAGG - Intronic
1096621617 12:52869118-52869140 GTCACTGCCCCAGGGAGGCCTGG + Intergenic
1096772558 12:53945373-53945395 CTCTCTGCCTCCGGGCGGCGCGG - Exonic
1096841199 12:54379976-54379998 GTCTCTGCCTTAGGTGGGATGGG - Intronic
1098663358 12:73127994-73128016 GTCTGTGCCTTGGGGAGGCAGGG + Intergenic
1118390342 14:65290337-65290359 GTCTCTGCCTTTGGGCCTCAAGG - Intergenic
1119126213 14:72129747-72129769 GTCTTAGCCTTTGGGAGGCCTGG - Intronic
1122346762 14:101065742-101065764 GTCGCTGCCTCAGTGGGGCCTGG + Intergenic
1122626974 14:103089838-103089860 GCCTCTGCCCCAGGGTGGCCGGG + Intergenic
1127753311 15:62067316-62067338 ATCTCTGCCTTAGGCCAGCCAGG + Intronic
1129334111 15:74842442-74842464 GACTCTGCCTTGAGGGGGCCAGG + Intronic
1130373392 15:83306239-83306261 GTCTCTACCTTAAGGCAGGCGGG - Intergenic
1130659585 15:85820162-85820184 GTCTCTGCGTCAGGGTGACCCGG + Intergenic
1131880000 15:96852252-96852274 GTCCCAGCCTTTGGGAGGCCAGG - Intergenic
1132050212 15:98601512-98601534 GACTCTGCCTTGGTGGGGCCGGG - Intergenic
1132770680 16:1561071-1561093 GTCTGAGCCTTAGGTCAGCCAGG + Intronic
1137483446 16:48871728-48871750 AGCTCTGACTTAGGGCTGCCAGG + Intergenic
1138207999 16:55139075-55139097 CTCTCTTCTTTAGGGTGGCCCGG - Intergenic
1145278848 17:21454125-21454147 TTCTCTGCCCAAGGGTGGCCTGG - Intergenic
1145399011 17:22516355-22516377 TTCTCTGCCCAAGGGTGGCCTGG + Intergenic
1146689150 17:34861171-34861193 GTCTCTGCCTTTGTGTGGTCAGG - Intergenic
1151050175 17:70969498-70969520 GTCTTTGCCTTAGGGTGGGGCGG - Intergenic
1153281098 18:3415153-3415175 GGCTCTGCCTTCCGGCGACCCGG + Intronic
1153285016 18:3449382-3449404 GTCTCTGCCCGGGGACGGCCGGG - Intronic
1156481581 18:37439781-37439803 ATCTCTGGCTTAGGGTGGGCAGG + Intronic
1157325194 18:46664078-46664100 GTCTCTTCCTTAGCCAGGCCTGG + Intergenic
1160453678 18:78980919-78980941 GGCTCTGCCTAATGGCCGCCCGG + Intronic
1160730528 19:639856-639878 GGCTCTGCCTTCGCGCGGCGGGG - Intergenic
1161018735 19:1997588-1997610 GCCTCTGCCATCGGGGGGCCTGG - Intronic
1161407112 19:4096724-4096746 GTCTCTGCATCAGAGCGTCCTGG - Intronic
1161456709 19:4373255-4373277 GCCTCTGCCTTGGGGCTGACTGG + Intronic
1164432066 19:28197347-28197369 GTCTTTGCCTGAGGGCTGCTGGG - Intergenic
1164806770 19:31123062-31123084 CTCTCTGCCCAAGGGCAGCCAGG + Intergenic
1165487966 19:36106869-36106891 GACTCTGCCTCAGGGAGTCCAGG + Intergenic
1165595360 19:37008049-37008071 GTCCCTGCCTCAGGCCTGCCCGG + Intronic
1166345659 19:42163625-42163647 GTCCCTCCCTGAGGGAGGCCAGG + Intronic
1166734324 19:45075548-45075570 GTCCCTGCCCTAGGACGGGCAGG + Intronic
1166768458 19:45266114-45266136 GGCTGTGCCTTGGGGAGGCCTGG + Intronic
926142821 2:10378416-10378438 GTGTCTGCATTTAGGCGGCCCGG - Intronic
927787243 2:25982361-25982383 GCCTCTGCCCTCGGGAGGCCCGG - Exonic
935943640 2:108267509-108267531 GTCTCTGCATTAGAGCGTCTTGG + Intergenic
938096668 2:128468398-128468420 CACTCTGCCTGAGGGAGGCCTGG + Intergenic
938328132 2:130427965-130427987 GCCGCTGCCCTAGGGCGCCCTGG + Intergenic
938361817 2:130693513-130693535 GCCGCTGCCCTAGGGCGCCCTGG - Intergenic
941401182 2:165032808-165032830 CTCTCTGCCTCAGGGAGGCAGGG + Intergenic
943332426 2:186575509-186575531 GACTCTGACTTAGGGAAGCCAGG + Intergenic
944205777 2:197156930-197156952 GTCTCTCCCTTAGGCCCGTCAGG - Intronic
946618118 2:221531448-221531470 ATTTCTGCCTAAGGGCTGCCAGG - Intronic
948179286 2:235966834-235966856 GTCTCTGCCTTAGGGCGGCCAGG + Intronic
948816590 2:240513446-240513468 GGCTCTCCCTTAGGACGGCAGGG - Intronic
948835469 2:240624135-240624157 GTCCCTGCTTGACGGCGGCCGGG + Intronic
1174819794 20:53716486-53716508 GTCTCTGACTTAAGGAGGCAAGG + Intergenic
1175403764 20:58714546-58714568 GTCTCGGTCCTAGGGAGGCCAGG - Exonic
1175906168 20:62380664-62380686 GTCTCTGCCCCAGGTGGGCCTGG + Intergenic
1176256554 20:64156064-64156086 TCCTCTGCCTCAGGGTGGCCAGG + Intronic
1180104549 21:45609360-45609382 GTCAATGCTTTAGGGCTGCCCGG + Intergenic
1180104561 21:45609418-45609440 GTCAATGCTTTAGGGCTGCCCGG + Intergenic
1180104573 21:45609476-45609498 GTCAATGCTTTAGGGCTGCCTGG + Intergenic
1180104603 21:45609649-45609671 GTCAATGCTTTAGGGCTGCCTGG + Intergenic
1180104612 21:45609707-45609729 GTCAATGCTTTAGGGCTGCCCGG + Intergenic
1181629312 22:24142249-24142271 GTCCCTGCCTTGGGGTGTCCAGG - Intronic
1182685395 22:32119146-32119168 GACTCTGTCTTGGGGCGGCAGGG + Intergenic
1185100367 22:48837013-48837035 GTCTGAGCCTTGGGGCAGCCTGG + Intronic
954059245 3:48055810-48055832 GTCTCAGACTATGGGCGGCCGGG - Intronic
954296167 3:49675534-49675556 GTCTCTGCCTCAGGGAGGAAAGG + Intronic
967395333 3:189002192-189002214 GTATCTGCATCAGGGTGGCCTGG - Intronic
967776121 3:193387793-193387815 GTCACTGGCTCAGGGCTGCCTGG - Intergenic
968978329 4:3833481-3833503 GTGTCTGCCTGGGGGAGGCCTGG + Intergenic
970909942 4:21263209-21263231 GTCTCTACCTTAGTGCTGCCTGG - Intronic
980932857 4:139198098-139198120 ATCTCTGCATTAGGGAGGCTAGG - Intergenic
985785738 5:1893092-1893114 GTCTCTGCCTTACGGAGGTGCGG - Intergenic
990496576 5:56354094-56354116 GTCTCTCCCTCAGGCTGGCCAGG - Intergenic
997605970 5:135176235-135176257 GTATCTGCCTGAGGAGGGCCTGG + Intronic
997907702 5:137835824-137835846 GACTCTGCCCTGGGGAGGCCAGG + Intergenic
999769612 5:154765397-154765419 GACCCTGCCTTGGGGCGGCGGGG - Intronic
1001313982 5:170629900-170629922 GTCCCTGCCTTAGGATGGGCTGG - Intronic
1004205844 6:13591576-13591598 GTCTCTGCCTTAGGGAGGAAGGG + Intronic
1013588986 6:111604588-111604610 GTCTCTGCGGGAGGGCTGCCTGG - Intronic
1015573975 6:134651308-134651330 GGCTCAGCCTTAGAGGGGCCAGG + Intergenic
1017833820 6:158157907-158157929 GTCTTTGCCTTACGGGGGCTCGG - Intronic
1019652305 7:2166700-2166722 GTCACAGCCTCAGGCCGGCCGGG - Intronic
1019920094 7:4157861-4157883 GTCTCTGCCTGCAGCCGGCCAGG + Intronic
1019996129 7:4725543-4725565 CTCACTGCCTTTGTGCGGCCGGG + Intronic
1033996776 7:147359783-147359805 GTTTCTACTTTAGGGCGGTCAGG - Intronic
1034416053 7:150964781-150964803 CTCTCTGCCTGGGGGCGGACAGG - Intronic
1045474129 8:102538669-102538691 GGCTCTGCCTTAGGCAGGCTTGG - Intergenic
1049043027 8:140126742-140126764 ATCTCTGCCTTTGTGGGGCCTGG - Intronic
1060243658 9:121926182-121926204 GTCTCTGCTTCAGAGGGGCCCGG + Intronic
1060684413 9:125595661-125595683 GACTCTGACTTAGGACGGCAGGG - Intronic
1061060121 9:128246077-128246099 GTCCCTGCCTGAGGCTGGCCTGG + Intronic
1061587251 9:131577080-131577102 GTCTGTTCCTTTGGGGGGCCCGG - Exonic
1061944739 9:133902314-133902336 GGCTCTGCCTTCGTGGGGCCAGG - Intronic
1062185479 9:135216035-135216057 GTCTCTGGCCTTGGGCGACCAGG - Intergenic