ID: 948181861

View in Genome Browser
Species Human (GRCh38)
Location 2:235988638-235988660
Sequence CTGTAACTTTCCAGTAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948181858_948181861 6 Left 948181858 2:235988609-235988631 CCATTGTCTCTGAAACACTTGCA 0: 1
1: 0
2: 0
3: 22
4: 288
Right 948181861 2:235988638-235988660 CTGTAACTTTCCAGTAATGAGGG 0: 1
1: 0
2: 2
3: 18
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948181861 Original CRISPR CTGTAACTTTCCAGTAATGA GGG Intronic
901931603 1:12599457-12599479 CCGTCACCTTCCAGTAATGTGGG + Intronic
907825827 1:58015969-58015991 CTGTCATTTTGCAGTGATGAAGG + Intronic
909939568 1:81595318-81595340 CTGTACCTTCCCAGTAAACATGG + Intronic
911445712 1:97989163-97989185 GTGTAACTTGCCAGAAAAGAAGG - Intergenic
911995666 1:104762650-104762672 CTTTAACTTTCTAGTAGTGCTGG + Intergenic
912040953 1:105389762-105389784 CTGTATCTTTGCAGAAATAAAGG + Intergenic
913058182 1:115181110-115181132 CTGTGACTTTCCTGAAATGGTGG + Intergenic
914729407 1:150357486-150357508 CTGTAAAGCTACAGTAATGAAGG + Intergenic
916854133 1:168732586-168732608 CTGTAACTTTGATGAAATGATGG - Intergenic
920460733 1:206137950-206137972 GTGTAGCTTTTCAGTAAGGATGG + Intergenic
920616103 1:207494351-207494373 CTCAAACTTTCAAGGAATGAGGG + Intergenic
923823305 1:237471476-237471498 CTGTAGCTTTCCAGTGATTCTGG - Intronic
1064199533 10:13272930-13272952 CTGTGACTTTCCAGAGATGCTGG + Intergenic
1064379246 10:14825668-14825690 CAGTATCATTCCAGTAATGAAGG + Intronic
1070240479 10:74675066-74675088 CTGTAACTTTCAAGTTTTGCTGG + Intronic
1070751318 10:78965531-78965553 CTGGAACTTCCCAGCAATGTGGG + Intergenic
1070952049 10:80439218-80439240 CGGTAACTTTCAAGTAACAAAGG - Intergenic
1072843986 10:98807897-98807919 CTTTGACTTTCCTTTAATGATGG + Intronic
1073874084 10:107901115-107901137 CTGTTACTGTCCATTAGTGAAGG + Intergenic
1075021266 10:118954173-118954195 CTGTCACTTTCCAGGAAGGCTGG - Intergenic
1080747460 11:35121085-35121107 CTGAATCTTTCCAGTACTGAGGG - Intergenic
1081260197 11:40950062-40950084 CTGTAACTTTCCAGTAATAGAGG + Intronic
1081319192 11:41669272-41669294 CTGTAGCATTTCAGTACTGATGG - Intergenic
1082028051 11:47587006-47587028 CTGTACCTTTCCAGTTCTGGGGG - Intronic
1084102061 11:66956295-66956317 CTGTAACTGGCCAGGCATGATGG + Intronic
1088891222 11:114046056-114046078 CTGTAACTTTGAAGAAATTAAGG - Intergenic
1092038620 12:5363471-5363493 CAGGAACTTGCCAGAAATGAAGG + Intergenic
1092687427 12:11066541-11066563 CTGTAACTTTCCCACAATGATGG + Intronic
1093235059 12:16599871-16599893 CTGTCATTTTCCTATAATGATGG + Intronic
1093786860 12:23202062-23202084 CTGTAACTTTCTATTATGGAAGG + Intergenic
1094452381 12:30596405-30596427 CTGTATCTTGAGAGTAATGATGG + Intergenic
1094465882 12:30754164-30754186 CTGCAAATGTCCAGTAGTGATGG - Exonic
1101150631 12:101879343-101879365 GTGCAAATTTGCAGTAATGATGG + Intronic
1102848579 12:116215789-116215811 CTGCATCTTTCCAAGAATGATGG + Intronic
1105256503 13:18746870-18746892 CTGTAGCTTTTCTGTACTGAGGG - Intergenic
1106060138 13:26282470-26282492 CTTTATCTTTCCATTTATGAAGG - Intronic
1107521980 13:41192652-41192674 CTGTGACATCCCAGTCATGAAGG - Exonic
1107862860 13:44677322-44677344 CTGCAACCTTCCATTAAGGAAGG - Intergenic
1108012193 13:46028390-46028412 CTGAATCTTTCCATTTATGATGG - Intronic
1109165032 13:59023277-59023299 TTTTAAATTTCCAGAAATGAAGG + Intergenic
1109313682 13:60725004-60725026 CTGTAACTCTTCAGAAATTAAGG - Intergenic
1109700719 13:66021226-66021248 CTTTACCTTTCCAGTCATGTAGG + Intergenic
1110936757 13:81300009-81300031 ATATAACTTTCCAGTAATATTGG + Intergenic
1111658263 13:91178414-91178436 CTGTAATTTTCCATTAATTCTGG - Intergenic
1114714113 14:24806530-24806552 CCGAAACTTTCCAATACTGAAGG - Intergenic
1120948707 14:90021587-90021609 CTCTGACTATCCATTAATGAAGG + Intronic
1121237007 14:92398945-92398967 CTGTAACTCTCCAGTATTTGAGG + Intronic
1124034504 15:26042344-26042366 CTGTATGTTTCCAGTTAGGATGG + Intergenic
1126536481 15:49771094-49771116 CAGTAACTTTCTCTTAATGATGG + Intergenic
1127559118 15:60118321-60118343 TTGTGACTTTCCAGTATTTAGGG - Intergenic
1128109923 15:65069782-65069804 CTGCAACATTCGAGTCATGAAGG - Intronic
1128485377 15:68080977-68080999 CTGTGACCTTCCATTATTGAAGG - Intronic
1129570393 15:76676942-76676964 CAGTATCTTTCAAGTAAAGAGGG + Intronic
1134858618 16:17541038-17541060 CTGGAACATTCCAGAAATGAAGG - Intergenic
1138133230 16:54499928-54499950 CTGAAAATTTCTAATAATGAGGG + Intergenic
1140792888 16:78409299-78409321 CTGTATCTTGACAGTGATGATGG - Intronic
1142158264 16:88542885-88542907 CTGTAAATGTTCATTAATGAGGG + Intergenic
1142834875 17:2577680-2577702 CTGTACCTTTCCAGTCTTCAAGG + Intergenic
1143397726 17:6615803-6615825 GTGTAACTTGTCAGCAATGAGGG - Intronic
1145709669 17:26960035-26960057 CTGTCACCTTCCAGTGCTGAGGG - Intergenic
1148655040 17:49276956-49276978 CTGTAACTTCTCAGTGATGATGG + Intergenic
1149326196 17:55532154-55532176 CTGAAGCTTTGCAGTAATGGAGG + Intergenic
1152459538 17:80433988-80434010 CTGGAACTAAACAGTAATGATGG - Intronic
1152866375 17:82726216-82726238 CTGTAGCCTTCCAAGAATGAAGG - Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154021227 18:10665704-10665726 CTGCATCCTTCAAGTAATGAGGG - Intergenic
1156711252 18:39948776-39948798 CTGTAACTAGCCAGAAATGTGGG - Intergenic
1163654116 19:18535762-18535784 CTGTAACTTTCCAGGGGGGAGGG + Intronic
1166914272 19:46184041-46184063 TCTTAACTTTCCAGTGATGATGG + Intergenic
1167321006 19:48797120-48797142 CTGTAACCTGCCAGGAATGATGG + Intronic
927041887 2:19238353-19238375 CTGTAACTTTACAGTCAAGGTGG + Intergenic
927228615 2:20797094-20797116 ATGTACTTTTCCAGTAGTGAAGG - Intronic
929080453 2:38117205-38117227 CTCTAAATTTCCAGTTATGAGGG - Intergenic
930130130 2:47841325-47841347 TAGAAACATTCCAGTAATGAAGG + Intronic
930927216 2:56832871-56832893 ATGTAAATTTCCAATTATGATGG - Intergenic
935674643 2:105584185-105584207 CTTAAACATTCCAGAAATGAAGG - Intergenic
936395009 2:112119960-112119982 CTGTAACTTTACAGAAAAGTTGG - Intergenic
936641110 2:114313716-114313738 CTGCATCTTTTAAGTAATGATGG - Intergenic
937647399 2:124281089-124281111 CTGTAACACTCCAGCAATGAGGG + Intronic
939247093 2:139639265-139639287 CTGTAACTTCCCTTTTATGATGG - Intergenic
939891329 2:147739926-147739948 CTGTTATTTTCCATTAATGAAGG - Intergenic
940905864 2:159168989-159169011 CTGTCTCTTTCCAGGAATAATGG + Intronic
942548360 2:177088816-177088838 CAGTCACTTTCCAGCAATGTAGG + Intergenic
943052849 2:182937552-182937574 CTGTATCCTTCAAGCAATGAGGG + Intronic
944504037 2:200391279-200391301 CAGTAAGTTTGAAGTAATGACGG - Intronic
945191173 2:207189140-207189162 CTGTGCCTTTTCAGTAATGAAGG - Intergenic
947195044 2:227554930-227554952 CTGTTACTTTCCAGTAGCAATGG - Intronic
948181861 2:235988638-235988660 CTGTAACTTTCCAGTAATGAGGG + Intronic
948207580 2:236170363-236170385 CTGTAACTATCTCATAATGAGGG - Intergenic
1170887021 20:20349315-20349337 CAGGAAATTTCCAGTCATGATGG + Intronic
1171014452 20:21527448-21527470 ATGTCACTTTCCAGTAATATTGG + Intergenic
1174096988 20:48097440-48097462 CTGTAGCTTCCAAGGAATGACGG + Intergenic
1178558745 21:33617987-33618009 CTGGAACTTTATAGAAATGATGG + Intronic
1178735661 21:35147588-35147610 CTGGAACTTTTCATTACTGAGGG + Intronic
949168495 3:969681-969703 CATTAACTTTCCAGGAAAGATGG + Intergenic
950598581 3:14009425-14009447 CTTTAATTTTCCAGTAAGAATGG + Intronic
952464877 3:33571974-33571996 CTGTCACACTCCATTAATGAAGG - Intronic
952486898 3:33821327-33821349 CTGGAACTTTCCTGTACTGTTGG - Intronic
952726663 3:36593750-36593772 GGGTAACTTTCCAGAAAAGATGG + Intergenic
956899419 3:73699297-73699319 CTTAACCTTTCCACTAATGATGG - Intergenic
958615262 3:96485934-96485956 CTGTAACTAATCAGTAATTATGG + Intergenic
959302295 3:104618737-104618759 CTGTAACAGCCCAGTAAAGAAGG - Intergenic
960585953 3:119321993-119322015 CTATAAATGTCCAGTAATGGAGG - Intronic
962005040 3:131340288-131340310 CTGTAACTTTTCTGTAAGTATGG + Intronic
964029658 3:152122428-152122450 CTGTGTCTTTCTTGTAATGATGG - Intergenic
965427244 3:168542170-168542192 CTACAATTTTCCAGTACTGAAGG - Intergenic
965729092 3:171751551-171751573 CTCAACCTTTCCAGTAATCAGGG + Intronic
965776343 3:172235679-172235701 CTATACCTTTCCAGAAATGAAGG - Intronic
967479782 3:189959833-189959855 CTGTAACTCTCCAGGACTGGAGG + Intronic
967959989 3:194912756-194912778 CTGTAACAATCCTGTAATAATGG - Intergenic
968603141 4:1519853-1519875 CTGCAACCTTCCAATAATGCAGG + Intergenic
970081473 4:12291953-12291975 CTGTAAGTTTCCAGGCTTGAGGG - Intergenic
972128380 4:35799967-35799989 CTGTAATTTTCAAGGAATCAGGG - Intergenic
980061022 4:128129630-128129652 CTGTAAAGCTGCAGTAATGAAGG + Intronic
982693791 4:158576831-158576853 CTGGAACTTTCCAGGAAGGATGG + Intronic
984613291 4:181866213-181866235 CTGTAATTTTCAAGAAATCAAGG + Intergenic
985311514 4:188604954-188604976 CTGTAACATTCCAGGCATGAAGG + Intergenic
985376220 4:189341830-189341852 CTTTAAATTTCCTGTAAGGAAGG - Intergenic
986575016 5:9203284-9203306 CTGTATCTTTCCATTAATTTTGG - Intronic
987871516 5:23624926-23624948 ATATAACTGTTCAGTAATGATGG + Intergenic
989527402 5:42468849-42468871 CTGTAACTGCCCAGGCATGATGG + Intronic
990365604 5:55067094-55067116 CTGAAAGTTTCCAGTGATGGAGG - Intergenic
990492428 5:56315413-56315435 CTGTAAATGTCCCTTAATGAAGG - Intergenic
992769970 5:80037809-80037831 CTTTACATTTCCACTAATGAGGG - Intronic
993786072 5:92138943-92138965 CTGTATCTTTCAAGCAATAATGG - Intergenic
994079583 5:95692721-95692743 TTATAACTTCCCAGTAATTAAGG + Intronic
994333074 5:98530683-98530705 CTGTAAGTTACCAGTATTAAAGG - Intergenic
994522636 5:100860534-100860556 CTTTGACTTTCCTGTCATGAAGG + Intronic
998777653 5:145619951-145619973 CTGAAAATTTCAAGTATTGATGG + Intronic
999133440 5:149301462-149301484 CTGTGACTTCCCAGTCAGGAAGG - Intronic
999518002 5:152320411-152320433 CTGCTACTTTCCGGTCATGAAGG + Intergenic
1007049582 6:38813435-38813457 GTGTAAGTTTTCAGTAATGACGG + Intronic
1010002160 6:70958180-70958202 CTGTAACTTACCAGGAAGAAGGG + Intergenic
1012116591 6:95306757-95306779 TTGTAATTTGCCAGTTATGATGG - Intergenic
1012265627 6:97138366-97138388 CTGTAAATTTTCTGTAGTGATGG - Intronic
1014051865 6:116964203-116964225 ATGTAGCTTTCCAGGAATGGGGG + Intergenic
1015657566 6:135536577-135536599 CAGCAATTTTCCATTAATGAGGG - Intergenic
1017609300 6:156167579-156167601 TTGTAGCTGTACAGTAATGATGG - Intergenic
1017704926 6:157113459-157113481 CTGGAAACTTCCAGTCATGATGG + Intronic
1021181870 7:17516569-17516591 CAGTAACTTTCCATTAAGGGTGG + Intergenic
1021889234 7:25171506-25171528 CTTTCAGTTTCCAGTAATGGCGG + Intronic
1022435746 7:30383006-30383028 CTGTAATTCTACAGTAATCAAGG - Intronic
1024799167 7:53056389-53056411 CTTTAACTCTCTATTAATGAAGG - Intergenic
1024920716 7:54551024-54551046 ATGTAATTTTCCATTACTGATGG - Intronic
1026012379 7:66646676-66646698 CTGTAAGTTTCTTTTAATGAGGG - Intronic
1027642029 7:80747849-80747871 GTTTAATATTCCAGTAATGAGGG + Intronic
1029406772 7:100379951-100379973 CTGTAAAGTTTCAGTAATGCTGG + Intronic
1030766844 7:113420966-113420988 GTGTAAAATTCCAGAAATGAGGG + Intergenic
1035665790 8:1378706-1378728 GTGTGACTTTCCAAAAATGAGGG - Intergenic
1035942915 8:3924122-3924144 CTGTATCTCTCCATTTATGAAGG + Intronic
1037186393 8:16068523-16068545 CAGTATCTTTGCATTAATGAAGG - Intergenic
1037341513 8:17850515-17850537 ATGTAACTTTCCTGTAACTAGGG + Intergenic
1045383109 8:101646463-101646485 CTGTAACCTTCCAGCAATAACGG + Intronic
1046279112 8:112001711-112001733 CTGTAATTTTCCAGAAATAGTGG - Intergenic
1053030117 9:34768340-34768362 CTGTAACTTTCCAGAAAAGAAGG - Intergenic
1055122065 9:72672003-72672025 CTGTAACATTCCAGGAATTGTGG + Intronic
1055123245 9:72687436-72687458 CTGAAAGTTTGCAATAATGAAGG - Intronic
1055128835 9:72751309-72751331 CTGTAAAATTCCAGTAATGGGGG + Intronic
1055864574 9:80797535-80797557 CTGTATTTTTCCAGAACTGATGG + Intergenic
1056503301 9:87232090-87232112 CTGTAACTGTCCATTAAGGGTGG - Intergenic
1058275285 9:103033536-103033558 CAGTAACTTTGTAGTGATGAAGG + Intergenic
1059316383 9:113429269-113429291 CTTTAACTTTTCAGAAATTATGG + Exonic
1060655655 9:125371003-125371025 CTGTGGCTTTTCAGTAATGGCGG - Intergenic
1186616769 X:11196525-11196547 CTGTTTCTTTCCAGTAGTGGTGG + Intronic
1187979490 X:24740213-24740235 CTGGAAGTTTCCAGTGATAATGG - Intronic
1188880773 X:35489371-35489393 CTGAAACTTTCCTGTGATGTTGG - Intergenic
1189186704 X:39061160-39061182 CTGTCTCTTTCCACTAATGTGGG + Intergenic
1190443921 X:50503980-50504002 CAGCAACTTTCCAGCAATGATGG - Intergenic
1194582018 X:95685370-95685392 CTGTAATATTCCAGTAAGCAGGG + Intergenic
1194866009 X:99068080-99068102 CAATAATTTTACAGTAATGATGG - Intergenic
1195743296 X:108088625-108088647 ATGTAACTTTCCAGTCATAAAGG + Intronic
1202172479 Y:22065608-22065630 CTTTAACTTTACAGTAAATAAGG - Intergenic
1202218884 Y:22520763-22520785 CTTTAACTTTACAGTAAATAAGG + Intergenic
1202324302 Y:23675288-23675310 CTTTAACTTTACAGTAAATAAGG - Intergenic
1202546469 Y:25994766-25994788 CTTTAACTTTACAGTAAATAAGG + Intergenic