ID: 948182606

View in Genome Browser
Species Human (GRCh38)
Location 2:235994429-235994451
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948182605_948182606 17 Left 948182605 2:235994389-235994411 CCTCAAAATTCATTTCTTCTCAC 0: 1
1: 0
2: 4
3: 73
4: 608
Right 948182606 2:235994429-235994451 GCTTGTACTTGTGTGCCTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type