ID: 948183018

View in Genome Browser
Species Human (GRCh38)
Location 2:235997919-235997941
Sequence GAGGCTGGTGTTACACATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948183010_948183018 13 Left 948183010 2:235997883-235997905 CCACAGTCGTCTTCCACGTAGCA 0: 1
1: 0
2: 0
3: 3
4: 56
Right 948183018 2:235997919-235997941 GAGGCTGGTGTTACACATGAAGG 0: 1
1: 0
2: 0
3: 12
4: 207
948183014_948183018 0 Left 948183014 2:235997896-235997918 CCACGTAGCATTTCGGGGTCTCG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 948183018 2:235997919-235997941 GAGGCTGGTGTTACACATGAAGG 0: 1
1: 0
2: 0
3: 12
4: 207
948183009_948183018 20 Left 948183009 2:235997876-235997898 CCACGAGCCACAGTCGTCTTCCA 0: 1
1: 0
2: 0
3: 8
4: 66
Right 948183018 2:235997919-235997941 GAGGCTGGTGTTACACATGAAGG 0: 1
1: 0
2: 0
3: 12
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948183018 Original CRISPR GAGGCTGGTGTTACACATGA AGG Intronic
900532032 1:3159169-3159191 GAGGCTGGAGGTACACAGGGCGG + Intronic
901698255 1:11027381-11027403 GAAGCTGTTTTTATACATGAAGG - Exonic
902054342 1:13587841-13587863 GGGGCTGGGGTTAGACATGTGGG - Intronic
904330670 1:29756019-29756041 GAGGCTGATGTTCTCCATGAGGG - Intergenic
904416005 1:30361575-30361597 GAGGCTGATGTTCTCCATGAGGG + Intergenic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
906445209 1:45890450-45890472 CAGGCTGGTGTACCACATAAAGG - Intronic
907189895 1:52639851-52639873 GAGGCTGCAGTGAGACATGATGG - Intronic
909050924 1:70767028-70767050 AAGGCTGGTTCAACACATGAAGG + Intergenic
909919046 1:81357333-81357355 GAGGCTGGTGTTATATATCCAGG - Intronic
910098545 1:83551798-83551820 CAGCCTGGTGTTAGACCTGAAGG + Intergenic
910928928 1:92423224-92423246 GAGGCTGCAGTGAGACATGATGG + Intergenic
911083403 1:93956319-93956341 GAAGCTACTGTTACACAAGATGG - Intergenic
915565151 1:156708818-156708840 GTGGCTGGTCTTACACCTGAAGG + Intergenic
915937553 1:160098292-160098314 GAGGCTGGAGGTACCCCTGACGG + Intronic
917246137 1:173003368-173003390 GAGGCTGCTGTGAGTCATGATGG + Intergenic
917628205 1:176867024-176867046 AAGACTAGTATTACACATGAAGG + Intronic
919267550 1:195290514-195290536 GAGGCTGATCTTACAAATTATGG - Intergenic
920527912 1:206682192-206682214 GAGCCTGGTGTTACACAAATAGG + Intronic
921064400 1:211612441-211612463 GAGGCTGCTGTGAGCCATGATGG - Intergenic
921874301 1:220176834-220176856 GAGGCTGGTGTGTCTCATGTTGG - Intronic
922454101 1:225760656-225760678 GAGGCTGTAGTGACCCATGATGG - Intergenic
1063511734 10:6651533-6651555 GAGGCTGGAGTGAGCCATGATGG - Intergenic
1065598935 10:27348747-27348769 GGGGCTTGTATTACACAGGAAGG - Intergenic
1067342504 10:45417235-45417257 TAGGCTGTTGTTAGCCATGATGG - Intronic
1070072692 10:73105043-73105065 GAGGCTGGTGGATCACTTGAGGG + Intergenic
1071300483 10:84252743-84252765 GAGGCTGGTGGATCACTTGAAGG + Intronic
1072609767 10:97010415-97010437 GGGGCTGGTGTGACAGATAAAGG + Intronic
1074300481 10:112228672-112228694 GAGGCTGCAGTGACACATGATGG + Intergenic
1075464462 10:122641273-122641295 GGGGCTGGAGTTGCACATCATGG - Intronic
1077349807 11:2087382-2087404 GAAGCTGGTGTCTCACATGGCGG - Intergenic
1077601155 11:3575862-3575884 GATGCTGGTGACTCACATGACGG - Intergenic
1078861651 11:15253524-15253546 AAAGATGGTGTTACACATAAAGG + Intergenic
1078883641 11:15478376-15478398 GAGCCTGTTGTGACACCTGAGGG + Intergenic
1079461677 11:20685732-20685754 AAGGCAGATGATACACATGAGGG - Intronic
1081606619 11:44531208-44531230 GAGGCGGGTGGTAGAGATGAGGG - Intergenic
1083175278 11:60946055-60946077 GAGGCTGGAGTGAGCCATGATGG - Intronic
1084254417 11:67929913-67929935 GAGGCTGCTGTGAGCCATGACGG + Intergenic
1084257074 11:67950437-67950459 GATGCTGGTGACTCACATGACGG - Intergenic
1084716007 11:70873844-70873866 GAGGCTGGTGCTAGGAATGAAGG - Intronic
1084766237 11:71310663-71310685 GAGGCTGCAGTGAGACATGATGG + Intergenic
1084779545 11:71399395-71399417 GAGGCTGGAGTCCCAGATGAAGG + Intergenic
1084815704 11:71644831-71644853 GATGCTGGTGACTCACATGACGG + Intergenic
1084818453 11:71665970-71665992 GAGGCTGCTGTGAGCCATGACGG - Intergenic
1086362852 11:86077326-86077348 GAGGCTGGTGTTAATCATAGGGG - Intergenic
1088303874 11:108387590-108387612 GAGGCTGCAGTGACCCATGATGG - Intronic
1088652652 11:111972093-111972115 GAAGCAGGTGGTACACATGCAGG - Intronic
1089052097 11:115554607-115554629 GAGGCGGGAGTAACACTTGAGGG + Intergenic
1090266374 11:125355756-125355778 GAGGCTGGAGTGACACTTGCTGG - Intronic
1092427307 12:8385221-8385243 GATGCTGGTGACTCACATGACGG - Intergenic
1099140642 12:78969993-78970015 GAAACTGGTGTTTCAGATGAAGG + Intronic
1100125595 12:91420954-91420976 GAGGCGGGTGGATCACATGAGGG + Intergenic
1100716184 12:97308328-97308350 GAGGCTGGAGTGAACCATGATGG - Intergenic
1101785704 12:107881537-107881559 GAGGCTGGTTTCGCACATTAAGG + Intergenic
1101994430 12:109514718-109514740 GAGGCTGGTGATAGGAATGAAGG - Intronic
1102306844 12:111811417-111811439 CAGAGTGGTGTTTCACATGATGG - Intergenic
1103978564 12:124720571-124720593 GAGGTCGATGTTAAACATGATGG + Intergenic
1104400046 12:128467869-128467891 CATCCTGGTGTAACACATGATGG - Intronic
1104837028 12:131798237-131798259 GAGGCTGCTGTGAGCCATGACGG + Intronic
1106197112 13:27503368-27503390 GAGGCTGGTGTCAGGCAGGAAGG + Intergenic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1108003199 13:45923450-45923472 GAGGCTGGTGTTAGACTCAATGG - Intergenic
1108884107 13:55157683-55157705 GAGCAAGGTGTTTCACATGATGG - Intergenic
1109007134 13:56892725-56892747 TAGGTTGGTCTTTCACATGATGG - Intergenic
1110667318 13:78133270-78133292 GAGGCTGGTCATACAAAGGAAGG - Intergenic
1111436882 13:88222693-88222715 GAGGCTGGTGGATCACCTGAGGG + Intergenic
1111554259 13:89859493-89859515 GAGGCTGCAGTGACCCATGATGG - Intergenic
1111814797 13:93138806-93138828 GAGTCTGGGTTTTCACATGATGG - Intergenic
1114364857 14:22014824-22014846 GATGGTGGTGTTATTCATGATGG - Intergenic
1114495635 14:23129844-23129866 GAGACTGGTATTACAGATTAGGG + Intronic
1115219584 14:31046186-31046208 GAGGCTGGTGGATCACCTGAGGG - Intronic
1117186912 14:53249167-53249189 TATGCTCGTTTTACACATGAGGG - Intergenic
1121904146 14:97724209-97724231 AAGGCTGGTGTTTCTCTTGATGG - Intergenic
1122472876 14:101983906-101983928 GAGGCAGGTGGAACACTTGAAGG - Intronic
1123003121 14:105307235-105307257 GAGGCAGGTGGGACTCATGATGG - Exonic
1124981484 15:34571731-34571753 GAGGGTGGTTATACACATTAGGG + Intronic
1126439368 15:48671340-48671362 GAGGCTGGTGTTCTACAGGCAGG + Intergenic
1127104035 15:55594100-55594122 TAGGCTGCAGATACACATGAAGG + Intergenic
1127325815 15:57894308-57894330 GAGTCTCCTTTTACACATGAGGG + Intergenic
1128669503 15:69563939-69563961 GAGGCTGCTGTGAGCCATGATGG - Intergenic
1128999163 15:72318972-72318994 GGGGCTGTTGTTGAACATGAGGG + Intronic
1129067982 15:72924518-72924540 GAGGCTGTAGTAACCCATGATGG + Intergenic
1129946403 15:79542657-79542679 GTGGCTGGTATTAAAAATGAGGG + Intergenic
1130679421 15:85983525-85983547 GAGGGTGATGTTATACTTGAGGG - Intergenic
1131310030 15:91282129-91282151 GAGGCTGATGCTATACACGAAGG + Intronic
1133462796 16:6001506-6001528 GACTCTGGAGTTAGACATGATGG - Intergenic
1135623815 16:23978299-23978321 AAGGCTGGTGTGACACAGAAGGG - Intronic
1137730679 16:50687372-50687394 GAGACTGGTGATACACAGGACGG + Intergenic
1138064199 16:53923726-53923748 AACGCTGGTGTTTCAGATGATGG - Intronic
1140741846 16:77948394-77948416 GATGATGGTGTTGCAAATGAGGG - Intronic
1141611461 16:85183455-85183477 GAGGCTGGTGTTCCACAGCCAGG + Intronic
1141894920 16:86953250-86953272 GGGGCTGGTTTTACAGGTGAGGG - Intergenic
1148010967 17:44480969-44480991 GAGGCTGGAGTGAGCCATGATGG - Intronic
1149062091 17:52434530-52434552 GAGGCTGGAGGTACAAATCAAGG - Intergenic
1149181963 17:53950563-53950585 GAGGCTGTTGGGACACAAGACGG - Intergenic
1152080437 17:78184062-78184084 CAGGGTGGTGTTACACCTGGTGG - Intronic
1153571194 18:6475237-6475259 GAGGATGATGTTCCACAAGAGGG - Intergenic
1155963956 18:32018983-32019005 CAGGCTGGTGTAACACCTCAAGG - Exonic
1156518614 18:37702159-37702181 GAGGCTGGTGGCAGACAGGAAGG + Intergenic
1157257720 18:46153352-46153374 GAGGCTGAAGGTGCACATGAGGG + Intergenic
1158045288 18:53148299-53148321 AAGGATGGTGATGCACATGAAGG + Intronic
1160710519 19:549091-549113 GCGGCTGTTGTTACACATGCGGG - Exonic
1161824980 19:6557374-6557396 GAGGCTGCAGTGACCCATGATGG - Intergenic
1162998078 19:14348982-14349004 GAGGCTGCTGTGAGTCATGATGG + Intergenic
1165160004 19:33810446-33810468 GAGGCAGGTGGATCACATGAGGG + Intronic
925468076 2:4128397-4128419 GTGGCTGTTGTTACACTTGCTGG + Intergenic
926168217 2:10534766-10534788 CAGGCTGATGTTAGACAGGAGGG + Intergenic
926493653 2:13557269-13557291 GAGGCAGGTGTGGCACATGTGGG - Intergenic
929346729 2:40893500-40893522 TAGACTGATGTTACAGATGAGGG - Intergenic
929563716 2:42971497-42971519 GAGGAAGGTGTAACACATTATGG + Intergenic
929715073 2:44301830-44301852 GAGGCTGGTGGATCACCTGACGG + Intronic
930566651 2:53028928-53028950 GAGGATGGAGTTACCCATGATGG + Intergenic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
932101748 2:68907746-68907768 GAGGGCAGTGTTAGACATGAGGG + Intergenic
932244517 2:70185167-70185189 GAGGCGGGTGGAACACCTGAGGG + Intronic
932895383 2:75634566-75634588 GAGGCGGGTGGTTCACTTGAGGG + Intergenic
933105228 2:78316257-78316279 GAGGCTGATGGTTCACCTGAGGG + Intergenic
935182481 2:100703289-100703311 GAGGATTGTGTAACACATGGCGG - Intergenic
937393103 2:121509604-121509626 GAGGCAGGTGGAACACACGAGGG + Intronic
937528550 2:122800614-122800636 GAGGGTAGTGTGACACATGGTGG - Intergenic
938591267 2:132738436-132738458 GATGCTGGTGTTAAACAGTATGG - Intronic
942990072 2:182189954-182189976 AAGGCTGGTGTTGCTCATGAAGG - Intronic
944414360 2:199467991-199468013 GAGGGTGGTGTTACTCTTGTTGG - Intronic
945661525 2:212691530-212691552 GAGGCAGGAGGTACACATTAAGG - Intergenic
946228889 2:218279554-218279576 GAGGCTGGTGTTGGACAGGAGGG - Intronic
946936536 2:224727122-224727144 GAAGCAGGTGTTTCACATGGTGG - Intergenic
947073115 2:226313428-226313450 CAGGCTGGTGATACACACAAAGG - Intergenic
948183018 2:235997919-235997941 GAGGCTGGTGTTACACATGAAGG + Intronic
1168764294 20:371383-371405 GGGCCTGGGGTCACACATGATGG + Intronic
1172239925 20:33406131-33406153 GAGGGTGGTGTTCCAAGTGAAGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1179788844 21:43744026-43744048 GTGGCTGGTGTGAGACAGGAAGG + Intronic
1179943467 21:44654597-44654619 GTGGCTGGTGTGGCACATGATGG + Exonic
1182716287 22:32358362-32358384 GAGGCTGGTTTCCCACATCAAGG + Exonic
1183038425 22:35158005-35158027 GAGGCTGCTTTCACACAAGATGG + Intergenic
1183703255 22:39461678-39461700 GGGGCTGGTGTCACAGAGGAAGG - Intronic
1184995997 22:48208070-48208092 GAGGCTGGTGTGACGCAGGCAGG - Intergenic
1185245840 22:49772307-49772329 GAGGCAGGTGTATCACTTGAGGG + Intergenic
950750488 3:15124284-15124306 GATGCTGGTGACTCACATGACGG + Intergenic
951487996 3:23235603-23235625 GAGGATGGTGTTATAGATTATGG + Intronic
952007211 3:28855685-28855707 GAGGCTGGTATGAGCCATGACGG - Intergenic
952161344 3:30696487-30696509 GAGGAGGGAGTTACCCATGAGGG + Intergenic
953314748 3:41916451-41916473 GAGGCTGGAGTGAACCATGATGG - Intronic
953548523 3:43883016-43883038 GAGCCTGAGGTTGCACATGAAGG - Intergenic
956401516 3:68884547-68884569 GAGACTGGTTATACATATGATGG - Intronic
956431522 3:69191185-69191207 GAGGTTGGTGTATCACTTGAGGG + Intronic
957656796 3:83089787-83089809 AAAGCTGGTGTATCACATGATGG + Intergenic
958794566 3:98693185-98693207 GGGGCTGGTCTTCGACATGAGGG - Intergenic
960003925 3:112762591-112762613 CAGTCTGGTGTTACACTGGATGG + Intronic
961282126 3:125772171-125772193 GATGCTGGTGACTCACATGACGG + Intergenic
962518825 3:136179249-136179271 GAGGCTGGTTTGAACCATGATGG - Intronic
964335115 3:155646465-155646487 GAGGCTGGAGTTGCACATTATGG - Intronic
965219132 3:165903782-165903804 AAGGCTGGTGATACACAAAATGG + Intergenic
966894201 3:184430378-184430400 GAGGCTGCAGTGACCCATGATGG - Intronic
969158445 4:5233719-5233741 GAGGCTGGGGTCACACATGCGGG + Intronic
970882407 4:20947398-20947420 GAGGCAGGTGGACCACATGAGGG - Intronic
971210350 4:24610329-24610351 AAGGCTGCTGTTACACAATAAGG + Intergenic
972031117 4:34459269-34459291 GAGGCTGTGGTTTCATATGAAGG - Intergenic
974382730 4:61162069-61162091 GAGGCTGGGTTTACAGATGAAGG + Intergenic
974852619 4:67421911-67421933 GAGCCTTGTGTCACACCTGATGG + Intergenic
976904862 4:90225126-90225148 GAGGCTGCAGTTAGCCATGATGG - Intronic
977724708 4:100282394-100282416 GAGGATGGTGTTCCACACTAAGG + Intergenic
987348028 5:16996272-16996294 GAGGCTGCAGTGACCCATGATGG - Intergenic
992068218 5:73126444-73126466 GAGGCTGCTGTGGCTCATGAAGG + Intronic
994223321 5:97222072-97222094 CATGCTGGTGCTACATATGAGGG - Intergenic
994993323 5:107026963-107026985 GAGGCTTTTGTTAAAAATGATGG - Intergenic
995096728 5:108244752-108244774 GAGGCTGAAGTTATACATCAGGG + Intronic
995619652 5:114010529-114010551 GATGCTGGAGTTGCACATGGTGG + Intergenic
997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG + Intronic
997551353 5:134756175-134756197 GAGGCGGGTGGATCACATGAGGG - Intergenic
998064464 5:139146491-139146513 GAGGCTGCAGTTAGTCATGATGG + Intronic
1001078362 5:168647138-168647160 CAGGCTGTTGCTACACCTGAGGG + Intergenic
1002256814 5:177963912-177963934 GAGGCTGCAGTTACCCTTGATGG - Intergenic
1002902074 6:1417560-1417582 GAGGCTGCTGTGACGAATGACGG - Intergenic
1004212665 6:13666696-13666718 GAGGCTGCAGTAAGACATGATGG + Intronic
1006136659 6:31900246-31900268 GAAGCTGGTCTTCCACATGCGGG - Exonic
1007543618 6:42673136-42673158 GAAGATGGTGGTACAAATGAGGG - Intronic
1009572425 6:65404166-65404188 GAGGCTGGTTTTAAAGATGGAGG - Intronic
1010016865 6:71114907-71114929 GATGCTGGAGTTACATCTGAAGG - Intergenic
1011256532 6:85427483-85427505 GAGGTTGGTGTAACCCATGTGGG - Intergenic
1014879309 6:126703270-126703292 GAGGCTGCAGTTAGCCATGACGG - Intergenic
1015186253 6:130419945-130419967 GAAGGTGGTGCTACACATGGTGG + Intronic
1018124706 6:160670468-160670490 AATGCTGGTTTTACAAATGAGGG + Intergenic
1020411092 7:7892460-7892482 GAGGCTGCAGTGAGACATGATGG - Intronic
1022705594 7:32799293-32799315 GAGGCTGCAGTTAACCATGATGG - Intergenic
1025986572 7:66458162-66458184 GAGGCAGGTGGATCACATGAGGG + Intergenic
1027804551 7:82800554-82800576 GAGGTTGGAATGACACATGAAGG + Intronic
1028827839 7:95294331-95294353 GAGGCTGCAGTAAGACATGATGG - Intronic
1029074272 7:97923871-97923893 GATGCTGGTGACTCACATGACGG - Intergenic
1029639446 7:101810312-101810334 GAGGCTGCAGTGAGACATGATGG + Intergenic
1032443501 7:131960501-131960523 GAGATTGGTGTTAAACATTAGGG - Intergenic
1032502525 7:132410587-132410609 GAGGCTGGTGTCATAGAGGAAGG + Intronic
1033360849 7:140638047-140638069 GTTGCTGGTGTTACAAAAGATGG - Intronic
1033619864 7:143052447-143052469 GATGATGGTGTTTCCCATGAAGG - Exonic
1034202544 7:149291404-149291426 GAGGCTGGGCTTGCACCTGAAGG + Intronic
1035484071 7:159208773-159208795 GAGGATGATGTCATACATGATGG - Intergenic
1035484103 7:159208974-159208996 GAGGATGATGTTGTACATGATGG - Intergenic
1035484107 7:159209014-159209036 GAGGATGATGTCATACATGATGG - Intergenic
1035957248 8:4094613-4094635 GAGGCGTGTGTCACACATGTGGG + Intronic
1036243435 8:7097417-7097439 GATGCTGGTGACTCACATGACGG + Intergenic
1036829290 8:12009774-12009796 GATGCTGGTGACTCACATGACGG - Intergenic
1038609845 8:29050267-29050289 GAAGATGGTGTTACAAATAAGGG - Intronic
1042600944 8:70499125-70499147 GAGGCGGATGTTTCACCTGAGGG + Intergenic
1046438516 8:114227695-114227717 GAGGCTGCAGTGACTCATGATGG + Intergenic
1047003746 8:120598337-120598359 GGGGCTGGTGTTACAGATAGGGG - Intronic
1049039480 8:140101202-140101224 GAGGCTGGAGTTAGCCAAGATGG - Intronic
1051751137 9:20341962-20341984 GAAGATGGTGTTAGACATGAGGG + Exonic
1052235497 9:26209249-26209271 GAGATGGGTGTTACACAAGAGGG + Intergenic
1052632974 9:31064521-31064543 GAGGCTGGTGTTAGGGAGGATGG + Intergenic
1055745222 9:79436894-79436916 GATTCAGGTGGTACACATGAAGG - Intergenic
1057854154 9:98589777-98589799 GAGGCTGCTGTGAGCCATGATGG - Intronic
1058377124 9:104335690-104335712 AAGGCTGGTGATTCATATGAAGG + Intergenic
1059981347 9:119775572-119775594 GAGGCTGGTTTTATTCATCAGGG - Intergenic
1061744098 9:132727165-132727187 AAGGCTGCTGTTTCACATGCTGG + Intronic
1062647713 9:137557585-137557607 GAGGCAGGTGGATCACATGAGGG + Intronic
1187275387 X:17812335-17812357 AAGCTTGGTGTTACACCTGACGG + Intronic
1187485996 X:19704237-19704259 GAGGCTGGTATTGTAGATGATGG + Intronic
1188330442 X:28864705-28864727 GAGGCTAGTGTTGGGCATGAAGG + Intronic
1200058411 X:153473323-153473345 GGGGCTGGAGTTAGACCTGAGGG + Intronic
1200612757 Y:5343680-5343702 GAGGCTGCAGTGACCCATGATGG - Intronic