ID: 948185689

View in Genome Browser
Species Human (GRCh38)
Location 2:236019623-236019645
Sequence CAGCAGCCTGCACCTGGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948185678_948185689 20 Left 948185678 2:236019580-236019602 CCAGGAGCTCTCAGGAAGACGGG 0: 1
1: 0
2: 1
3: 8
4: 231
Right 948185689 2:236019623-236019645 CAGCAGCCTGCACCTGGACGGGG 0: 1
1: 0
2: 1
3: 24
4: 223
948185676_948185689 21 Left 948185676 2:236019579-236019601 CCCAGGAGCTCTCAGGAAGACGG 0: 1
1: 0
2: 0
3: 8
4: 178
Right 948185689 2:236019623-236019645 CAGCAGCCTGCACCTGGACGGGG 0: 1
1: 0
2: 1
3: 24
4: 223
948185675_948185689 22 Left 948185675 2:236019578-236019600 CCCCAGGAGCTCTCAGGAAGACG 0: 1
1: 0
2: 3
3: 12
4: 169
Right 948185689 2:236019623-236019645 CAGCAGCCTGCACCTGGACGGGG 0: 1
1: 0
2: 1
3: 24
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948185689 Original CRISPR CAGCAGCCTGCACCTGGACG GGG Intronic
900090854 1:919828-919850 CTGCAGCCTGGACCTGGCCCGGG - Intergenic
901139825 1:7021296-7021318 CTGGAGCCTGCACCTGAACCGGG + Intronic
901704191 1:11061001-11061023 TTGCAGCCTCCACCTGGAGGTGG + Intergenic
905734203 1:40314986-40315008 CAGCAGCCAGGGCCTGGCCGGGG + Intronic
906242197 1:44248913-44248935 CAGCAACCTCCACCTGGGGGGGG + Intronic
907213586 1:52843282-52843304 CAGCAGCCCGCACTGGGGCGAGG - Intronic
907926985 1:58964539-58964561 CAGCAGCCAGGATCTGGAGGAGG - Intergenic
908402322 1:63783041-63783063 CAGCAGCCTGCAGCTGCTCTGGG + Intronic
908966261 1:69767964-69767986 CTGCAGCCCTCACCTGGATGTGG - Intronic
915321414 1:155058360-155058382 CAGCTGGGTGCACCTGGACCTGG + Exonic
915630886 1:157153635-157153657 CATCAGCCAGCCCCTGGAAGGGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
919398666 1:197081770-197081792 CAGCAGCTTGCACCTGCACTTGG + Intergenic
919777515 1:201203854-201203876 CAGCATCCTCCACCTTGACCTGG - Exonic
920345655 1:205304252-205304274 AAGCAGCATGCACCTGGTGGGGG - Exonic
920455210 1:206095906-206095928 CTGCAGCCTCAACCTGGACTCGG + Intronic
922675494 1:227546725-227546747 TAGCAGCAGGCACTTGGACGTGG + Intergenic
922972640 1:229755833-229755855 TGGCAGTCTGCACCTGGAAGAGG - Intergenic
923402866 1:233632048-233632070 CAGCAGCACGCACGTGGAAGAGG - Intronic
923550767 1:234961071-234961093 AAGCAGCTTGCACCTGCACGTGG - Intergenic
924527368 1:244864115-244864137 CGGCAGCCTAGACCTGGGCGGGG - Exonic
1066261346 10:33732643-33732665 TCTCAGCCTTCACCTGGACGTGG - Intergenic
1067217893 10:44317552-44317574 CACCAGGCTGCACCAGGACTGGG - Intergenic
1069589893 10:69635167-69635189 CTGCAGCCTGCAGCTGGGAGTGG + Intergenic
1069822127 10:71234755-71234777 CAGCAGCCTGGAACTGGCTGGGG - Intronic
1070054109 10:72918093-72918115 AAGCAGTCTGCCCCTGGAGGTGG - Intronic
1070338207 10:75473520-75473542 CAGCAGCCTGCATTTGGAGGTGG + Intronic
1073321205 10:102617280-102617302 CAGGAGCCTGCCCCTGGAGATGG - Exonic
1075914520 10:126156107-126156129 CAGCAGCTAGCACCTGGCAGCGG - Intronic
1076720371 10:132389753-132389775 CAGCAGCGTGCAGCTGGGCTGGG - Intergenic
1077147665 11:1053229-1053251 CAGGAGCCTGCACCCCTACGCGG + Intergenic
1079112101 11:17610715-17610737 CACCAGCCTGCCCCTGGCCAAGG + Exonic
1079617969 11:22518532-22518554 CAGCTGCCTACACATGGAAGAGG + Intergenic
1081878761 11:46429542-46429564 CAGAAGCCTGCAACTGGGCAGGG - Intronic
1083054944 11:59810644-59810666 CAGCAGCCTCCACATGGTCACGG + Exonic
1083334154 11:61913144-61913166 CTGCAGCCTGAGCCTGGATGAGG + Intronic
1083443232 11:62690509-62690531 CAGGAGCCTGAACCTGGGCCAGG + Exonic
1083642198 11:64151455-64151477 CTGCAGGCTGCCCCTGGAGGTGG - Intronic
1084072530 11:66745392-66745414 CAGAAACCTGCACCTGCACCGGG - Intronic
1084769954 11:71336175-71336197 CACCACCGTGCACCTGGATGTGG - Intergenic
1085616617 11:78004903-78004925 CAGCAGCCAGAAGCTGGAAGAGG - Intergenic
1088625970 11:111731095-111731117 CCGCAGCCTGCACAAGGACAGGG + Intronic
1089542021 11:119194957-119194979 CACCAGCCTGTGCCTGGACTCGG + Exonic
1090619556 11:128549056-128549078 CCGGAGCCTGCAGCTGGAGGAGG - Intronic
1091079764 11:132655310-132655332 CACCTGCCTGCACCTGGGCTTGG - Intronic
1091317957 11:134628890-134628912 CAGCACCATGCACTTGGAGGAGG + Intergenic
1092001756 12:5038621-5038643 CACCAGCCTGCCCGTGGAGGAGG + Intergenic
1092061939 12:5558121-5558143 CACCAGCCTGCACTGGGAGGAGG - Intronic
1092568519 12:9695803-9695825 AAGCAGTCTGCCCCTGGAGGTGG + Intronic
1094038943 12:26102747-26102769 CAGCTGTCTGCAACTGGAAGAGG + Intergenic
1094372104 12:29749996-29750018 CAACAGCCTGCACCACGAAGAGG + Intronic
1095389874 12:41692906-41692928 CAGCAGGCTGCAACTGGGTGGGG + Intergenic
1095773610 12:45989988-45990010 TAGGACCCTGCACCCGGACGGGG + Intronic
1096154283 12:49333152-49333174 CGTCATTCTGCACCTGGACGTGG - Exonic
1096555288 12:52400071-52400093 CAACAGCCGGGAGCTGGACGTGG - Exonic
1096599355 12:52718396-52718418 CAGCTGCCTGTGCCTGGATGGGG - Intergenic
1100919087 12:99462275-99462297 AAGCAGCTTGCACCTGGAAGGGG - Intronic
1101744003 12:107523971-107523993 CAGCCTCCAGCACCTGGACTGGG + Intronic
1101908640 12:108846512-108846534 CAGCAGCCTGCACATGCAGAAGG + Intronic
1103556522 12:121770006-121770028 CTGAAGCTTGCACTTGGACGAGG + Intronic
1104897325 12:132170791-132170813 CACCAGCCTCCCGCTGGACGGGG - Intergenic
1105708465 13:22983083-22983105 CAGCAGCCTGCACATGGCATGGG + Intergenic
1109024605 13:57142389-57142411 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1109025592 13:57148959-57148981 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1109026582 13:57155532-57155554 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1109027574 13:57162103-57162125 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1109028560 13:57168668-57168690 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1111761492 13:92471369-92471391 CAACAGCCTGCAGATGGATGTGG + Intronic
1112272071 13:97977048-97977070 CGGCACCCCACACCTGGACGGGG - Intronic
1113747500 13:112755217-112755239 CTGCAGGCTGCACGTGGACTGGG + Intronic
1114474039 14:22981828-22981850 GGGCAGCCTGCTGCTGGACGGGG - Exonic
1119444693 14:74653429-74653451 AAGCAGCCTGGAACTGGAGGCGG - Intronic
1119703940 14:76772641-76772663 CAGCTGCCTGAGCCTGGATGTGG - Intronic
1119714018 14:76845391-76845413 CAGCAGCAAACACCTGGACATGG + Intronic
1120880112 14:89409042-89409064 CAGCAGCCAGCAGCTGGCCTGGG + Intronic
1121321340 14:92993380-92993402 CAGGAGCCTGCAGCTGGCAGGGG + Intronic
1121621995 14:95356644-95356666 CAGCAGAAGGCAGCTGGACGAGG - Intergenic
1122096253 14:99375006-99375028 CAGCACCCAGCACCTGCATGGGG + Intergenic
1122536950 14:102472010-102472032 CAGCAGCCTGCCTCTGCACTGGG - Intronic
1122772491 14:104103615-104103637 CAGCAGCATGGAGCAGGACGTGG + Exonic
1122968641 14:105143587-105143609 CAGCAGCCTGATCCAGGGCGCGG - Exonic
1202860296 14_GL000225v1_random:77865-77887 CAGCAGCCTGAACCTAGACAAGG - Intergenic
1123975888 15:25554238-25554260 CAACAGCCTGCAGCTGGAAGAGG + Intergenic
1124372325 15:29110803-29110825 CAGAACCCTGCACCTGGGCTTGG - Intronic
1124994434 15:34709198-34709220 AAGCAGCCTGGACTTGGATGTGG - Intergenic
1128308270 15:66614190-66614212 CAGCTCCCTGCACCTGGAGCTGG + Intronic
1128509006 15:68302191-68302213 CTGCAGCCTGCCCCTAGACATGG - Exonic
1128880291 15:71236286-71236308 CAGCAGCCTGCAGCTATAGGGGG - Intronic
1130720051 15:86377710-86377732 TGGCAGCCCCCACCTGGACGAGG - Intronic
1132457657 16:33057-33079 CCACTGCCTGGACCTGGACGGGG - Intergenic
1132584920 16:701937-701959 CAGCAGCCTGAGCCTGGCCTGGG + Intronic
1132956424 16:2596743-2596765 CAGGAGCCTGCGCTTGGAAGTGG - Intronic
1133385473 16:5366210-5366232 AAGCAGGCTGCCCCTGGAGGTGG + Intergenic
1134091031 16:11391849-11391871 CTGCCGGCTGCACCTGGACAGGG + Exonic
1134227155 16:12399982-12400004 CACCAGCCTGCAGCAGGACATGG - Intronic
1134629281 16:15745308-15745330 CAGCATCCTGAACCTGCACAGGG + Intronic
1136252022 16:29011623-29011645 AGGCAGCCTGGACCTGGATGTGG - Intergenic
1136275553 16:29177420-29177442 CACCAGCCTGGAACTGGAAGTGG + Intergenic
1136679236 16:31945891-31945913 CAAGAGCCTACGCCTGGACGTGG - Intergenic
1138016682 16:53434715-53434737 CAGCCGCCTCAACATGGACGAGG + Exonic
1138541418 16:57689901-57689923 CAGCACCCAGCATCCGGACGGGG - Intergenic
1139644200 16:68316091-68316113 CAGCAGGCTGCAGCTGGGTGGGG + Intronic
1141082206 16:81062091-81062113 CAGCTGCCTGCATCTGGCCGAGG - Exonic
1141507637 16:84489305-84489327 GAGCAGCCAGCACCTGCACCCGG + Exonic
1141704327 16:85656337-85656359 CTGCAGGCTGCAGATGGACGAGG + Exonic
1141920461 16:87132357-87132379 CAGGAGCCTGCACCTGTTCCTGG - Intronic
1141952900 16:87350367-87350389 CAGCAGCCTGCACACAGCCGGGG - Intronic
1142079913 16:88143486-88143508 CACCAGCCTGGAACTGGAAGTGG + Intergenic
1142263025 16:89051325-89051347 CAGGAGCCTCCACCTTGAAGGGG - Intergenic
1143083995 17:4402302-4402324 CAGCAGCCAGCAGCTAGAAGAGG + Intergenic
1143330538 17:6131767-6131789 CAGGAGCCTGCACCAGGTCCAGG - Intergenic
1143967478 17:10767134-10767156 CAGCAGCAAACACCTGGCCGGGG + Intergenic
1144639034 17:16927512-16927534 CAGCAGCCTGGGTCTGGACATGG - Intergenic
1145234272 17:21197749-21197771 CAGGAGACTGCTCCTGGGCGGGG + Exonic
1147949343 17:44098285-44098307 CAGCACCAAGCACCTGGAAGGGG + Intronic
1148019091 17:44541876-44541898 CAGCATCCTCCACTTGGCCGAGG - Intergenic
1148769975 17:50061020-50061042 CAGAGGCCTGCACATGGATGGGG - Intronic
1148786938 17:50150198-50150220 CAGCAGCCTGAACGAGAACGTGG - Exonic
1149641327 17:58204804-58204826 CAGCAGCCTGCACTTGCTCCAGG - Exonic
1150295270 17:64004013-64004035 CAGCAGCCTCCCCCTGGCCAGGG + Intronic
1152089771 17:78240074-78240096 CAGCAGCCTGTGCCAGGACAAGG - Exonic
1152447626 17:80355224-80355246 CAGAAGCTTGGACCTGGAAGGGG - Intronic
1152790056 17:82273850-82273872 CAGGAGCCTGCACGTGGAAGGGG - Intergenic
1154191801 18:12236362-12236384 CAGCAGCTGGCACCTGGCGGAGG + Intergenic
1155537661 18:26833560-26833582 CAGAGGCCTGCACTTGGGCGCGG + Intergenic
1157681799 18:49613291-49613313 CAGCCGCCTGCACCCAGAGGGGG - Intergenic
1158524757 18:58202638-58202660 CACCAGCCTCCCCCTGGAAGGGG + Intronic
1158878049 18:61751872-61751894 AAGCAGCTTCCACCTGGAGGAGG + Intergenic
1158945311 18:62442529-62442551 CACCATCCTGCATCTGGACCTGG + Intergenic
1160902115 19:1433859-1433881 CACCCGCCTGCACCGGGAGGTGG + Intronic
1161061287 19:2216418-2216440 CAGCCGGCTGCACCTGGAGCTGG + Exonic
1161332150 19:3693484-3693506 CAGCAGGCGCCAGCTGGACGGGG - Intronic
1161956899 19:7501152-7501174 CGGCAACCTGCACCTGCACGAGG + Exonic
1162754938 19:12852238-12852260 CACCAGCCGGCACCTGGAAAGGG - Exonic
1162903410 19:13808876-13808898 CAACTGCTGGCACCTGGACGAGG + Exonic
1162997990 19:14348553-14348575 CAGCAGCCAGACCCGGGACGGGG + Intergenic
1163492793 19:17626673-17626695 CAGCAGCGTGGCCCAGGACGCGG - Exonic
1165773028 19:38389315-38389337 CAGCAGCCTGCAGGTGGGGGAGG + Intronic
1165831135 19:38730997-38731019 CTGCAGCCAGCACCTGGATGGGG - Exonic
1165999379 19:39869257-39869279 CAGCAACCAGCAACTGGAAGAGG + Intronic
1166148417 19:40852723-40852745 CACCAGTCTGCACCTGGGCCTGG + Intronic
1166152560 19:40884508-40884530 CACCAGCCTGCACCTGGGCCTGG + Intronic
1167513339 19:49908670-49908692 CACCAGCCTGCACCGCGAGGTGG - Exonic
925076859 2:1023829-1023851 GAGCAGCCTGCAGCCGGACCTGG - Intronic
926112010 2:10189509-10189531 CAGCAGCCTGCCCCTTGCTGGGG + Intronic
926273789 2:11388366-11388388 CAGCAGCCTGCACCAGGATCTGG + Intergenic
927191468 2:20519862-20519884 CAGCAGCCTCCACCGGGACTCGG + Intergenic
928365090 2:30694341-30694363 CAGCTGCCTGCACCTCGCCAGGG + Intergenic
928431114 2:31219097-31219119 CAGCACCCTGCACCTGGCACAGG + Intronic
928539028 2:32266943-32266965 CAGCCACCTGCAGCTGGAAGAGG + Intergenic
929963244 2:46512270-46512292 CAGCAGCCTCCACCAGGAGGAGG + Exonic
931881578 2:66575872-66575894 CCGCAGCCTCCACCAGGACCCGG - Intergenic
932094561 2:68836214-68836236 CACCACCCTCCACCTGGACTAGG - Intergenic
935594047 2:104866251-104866273 GAGCAGCCTGCACCTGAAACGGG + Intergenic
937434298 2:121867509-121867531 AAGCAGGTGGCACCTGGACGTGG - Intergenic
945084350 2:206116440-206116462 CTGCAGCCTGCACGTGGTCCTGG - Intronic
947523755 2:230866279-230866301 CAGAAGCCTGCATCTGGAAGTGG - Intronic
947537047 2:230946714-230946736 CTGCAGCCCACACCTGGACCAGG + Intronic
948185689 2:236019623-236019645 CAGCAGCCTGCACCTGGACGGGG + Intronic
948907957 2:240988816-240988838 GAACAGCCTGCACCAGGAGGTGG + Intronic
948939957 2:241190667-241190689 CAGCAGCCTGCGGGTGGACACGG + Intronic
949041242 2:241850900-241850922 CTCCAGCCTGCACCTGCACCAGG - Exonic
1171414184 20:24966406-24966428 CAGGTGTCTCCACCTGGACGTGG - Intronic
1172240365 20:33408872-33408894 CTGCAGCCTGCACGTGGAATGGG - Exonic
1172951931 20:38727846-38727868 CAGCAGACTGAACTTGGACACGG - Exonic
1173838507 20:46140885-46140907 AAGCAGCCTGATCCTGGAGGGGG + Intergenic
1175712579 20:61232837-61232859 CAGCAGCATTCACCTCGACTAGG + Intergenic
1176019044 20:62953287-62953309 CTGGAGCCTGCAGCTGGACGGGG + Intronic
1180048304 21:45319846-45319868 CAATGGCCTGCAGCTGGACGTGG + Intergenic
1184710601 22:46247301-46247323 CAGCAGCCTGCACCTCTGCAGGG + Intronic
1184716949 22:46287920-46287942 CAGCAGCCTGCTGCGGGACAAGG + Intronic
1185015222 22:48338942-48338964 CAGCAGCCTGGACCTGGGCTGGG - Intergenic
1185044992 22:48524320-48524342 CATGAGCCTGCACCTGAAAGAGG - Intronic
1185326763 22:50229493-50229515 CAGCAGCCTGCTCTCGGAAGTGG - Exonic
951088095 3:18538622-18538644 CAGCAGCCAGCACCTGGCACAGG + Intergenic
960535375 3:118809448-118809470 CAGCAGCCTGCAACCCGAAGCGG - Intergenic
961353918 3:126321968-126321990 CAGCTGCCAGAACCTGGAGGTGG - Intergenic
961452915 3:127010530-127010552 CAGCTTCCTGCACCTGGCAGAGG + Intronic
962825930 3:139101048-139101070 CAGCCCTCTGCACATGGACGTGG + Intronic
965656208 3:170988469-170988491 CAGGACCCTGCTCCTGGACCTGG + Intergenic
966499892 3:180627122-180627144 CAGCAGCCTGCAGCAGGGCAGGG + Intronic
966878386 3:184336230-184336252 GAGGAGCCTGCACCGGGAGGCGG + Intronic
967201128 3:187073580-187073602 CAGCAGCCTGCATCAGGGAGAGG - Intronic
968951952 4:3699953-3699975 CTGCAGCCTGCTCCTGGCTGTGG + Intergenic
968971931 4:3800375-3800397 CTGCCCCCTGCACCTGGACTGGG - Intergenic
969230373 4:5826467-5826489 CACCAGCCTGCAGGAGGACGAGG + Intronic
969528997 4:7719537-7719559 CAGCAGCCTGCACCAGGGAACGG - Intronic
971910352 4:32788389-32788411 CAGCAGTCTGCAACTAGAAGAGG + Intergenic
971977753 4:33712178-33712200 CAGCAGCCAGCACCCTGACCAGG - Intergenic
975675179 4:76820902-76820924 CAGCTGCCTGGAGCTGGAGGAGG + Intergenic
980532228 4:134070722-134070744 CAGCAGACTGCACCTGACCATGG - Intergenic
981079210 4:140622368-140622390 CACCAGCCTGGACCGGGACTGGG - Exonic
983353947 4:166631453-166631475 CTGCAGCCTGGACCTGGGCCTGG - Intergenic
985680458 5:1253245-1253267 GAGGACCCTGCACCTGGATGGGG - Exonic
985887179 5:2688737-2688759 CTGCACCTTGCACCTGGAAGGGG - Intergenic
986608403 5:9545427-9545449 CATCAGCAGGCACCTGGGCGGGG - Intronic
986829591 5:11561015-11561037 CAGGAGCCTCAACCTGGACGAGG + Intronic
986873736 5:12081192-12081214 CAGCAGCCTGCAGCTGCTGGAGG - Intergenic
988428733 5:31094033-31094055 CTGCAGCCTGCACACGGAAGAGG - Intergenic
992950208 5:81850995-81851017 CATCAGCCTTCACCTGGAGAAGG + Intergenic
994226333 5:97255029-97255051 GAGCTGCCTGCACCTAGAAGTGG - Intergenic
997399828 5:133593602-133593624 CAGCCACATGCACCTGGACAGGG + Intronic
999271457 5:150298539-150298561 CAACTGCCTGCCCCTGGACCAGG - Exonic
1001174757 5:169457797-169457819 CACCAGCTTGCACTTGGACTAGG - Intergenic
1002043398 5:176529757-176529779 CATCAGCCTGGACCTGGACGTGG - Exonic
1004304953 6:14492150-14492172 CAGCAGCCACCACCAGGAAGAGG + Intergenic
1006731817 6:36242007-36242029 TAGCAGTCTGCAGCTGCACGTGG + Intergenic
1007411753 6:41667325-41667347 AAGCAGTCTGCCCCTGGAAGTGG + Intergenic
1008109476 6:47477607-47477629 CCGCTCGCTGCACCTGGACGCGG + Intergenic
1008471714 6:51891935-51891957 CAGCAGCCAGGACCTGGTCAGGG + Intronic
1017529636 6:155275938-155275960 TCGCAGCCTGCACGTGGATGGGG - Exonic
1018974415 6:168554498-168554520 GGGCAGCCTGCCCCTGGAAGGGG + Intronic
1018974653 6:168555725-168555747 CAGCAGCCTGCAGCGGGGAGTGG + Intronic
1019750300 7:2725037-2725059 CAGCAGCATCCACCAGGACGGGG + Intronic
1020071644 7:5230887-5230909 CAGCGCCCTGCGCCTGGATGAGG + Exonic
1024776198 7:52789301-52789323 CAGCACCCTGAACCTGCACCTGG + Intergenic
1028909541 7:96192522-96192544 CAGCAGCTGACACCTGGAGGAGG + Intronic
1029437288 7:100570354-100570376 CAGCAGCCTGCGCGTGGCGGCGG + Intergenic
1029740585 7:102489353-102489375 AAGAAGCCTGCAGCTGGAGGGGG - Intronic
1029758582 7:102588525-102588547 AAGAAGCCTGCAGCTGGAGGGGG - Intronic
1029776520 7:102687604-102687626 AAGAAGCCTGCAGCTGGAGGGGG - Intergenic
1032077997 7:128845185-128845207 CCGCAGGCTGCACATGGACACGG - Exonic
1032415682 7:131733630-131733652 CTGCAGCCTGCACATGAACTGGG + Intergenic
1033332181 7:140426042-140426064 CAACAGCCTGCACCTATATGGGG + Exonic
1033933999 7:146560188-146560210 CACCTGCCTGCACCTTGACTTGG - Intronic
1035995288 8:4539954-4539976 CTGCAGGCAGCACCTGGACGGGG - Intronic
1040537143 8:48320316-48320338 CAGCAGCTTGCGCCAGGCCGAGG - Intergenic
1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG + Intergenic
1040795122 8:51281848-51281870 CACCTGCCTCCACCTGGAGGAGG + Intergenic
1043982432 8:86657781-86657803 CAGCAGCCTGGCCCAGGACAAGG - Intronic
1047499853 8:125432182-125432204 CAGCAGCGAGCCCCGGGACGGGG - Intronic
1049519556 8:143080959-143080981 CAGCTTCCTGCTCCCGGACGGGG - Intronic
1049647336 8:143741382-143741404 CAGGAGCCTGTACCTGGAGAAGG + Intergenic
1050561105 9:6834973-6834995 CACCATCCTGCATCTGGACCTGG + Intronic
1051359713 9:16271046-16271068 CAGCAGTCTGCAAGTGGAAGAGG + Intronic
1052403654 9:28032233-28032255 AAACAGCCTGCACCTGGACCTGG - Intronic
1057306736 9:93916702-93916724 CAGCTGAGTGAACCTGGACGAGG + Intergenic
1061147917 9:128810582-128810604 CAGCAGTCTGCAGCTGGGGGAGG + Intergenic
1061619079 9:131799278-131799300 CAGCAGCCAGCTCCTGGGGGTGG + Intergenic
1061840485 9:133356256-133356278 CTGCAGCCCTCACCTGGGCGCGG + Exonic
1062675955 9:137743922-137743944 CAGCAGCCTGCACGTGAATGGGG + Exonic
1185462988 X:340903-340925 CCGCTGCATGGACCTGGACGGGG - Exonic
1186514768 X:10158713-10158735 CAGCTGCATGCACCCGGCCGGGG + Intronic
1186753053 X:12641450-12641472 CAGCATCCAGCACCTGGACTTGG - Intronic
1186791522 X:13004190-13004212 CAACAGCCTGCGGCTGGGCGTGG - Intergenic
1187180481 X:16939198-16939220 TTGCACCCTGCACCTGGAAGAGG - Intergenic
1188809799 X:34639451-34639473 CAGCAGCCTTCACCTTGCAGTGG + Intronic
1200755318 Y:6985207-6985229 CAGCAGCCAGCAGCAGGACAGGG + Intronic
1201177376 Y:11317097-11317119 CAGTAGCCTGAACCTAGACAAGG + Intergenic