ID: 948187606

View in Genome Browser
Species Human (GRCh38)
Location 2:236033974-236033996
Sequence CATTATGAGATCAACTCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948187606 Original CRISPR CATTATGAGATCAACTCGAC AGG (reversed) Intronic
913041905 1:115035199-115035221 CTTTTTGAGATCAAGTCTACAGG - Intergenic
921104871 1:211966609-211966631 CATAATGTTATCAACTCGAATGG + Intronic
1063533284 10:6857003-6857025 CATTAAGACATCAACTTTACAGG - Intergenic
1069521900 10:69128523-69128545 CATTAAAAGATCAAATCGCCAGG - Intronic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1080043362 11:27783048-27783070 CATTATGAGACCCACTTCACTGG - Intergenic
1097375211 12:58835263-58835285 CATCATGAGAACAACTCCAAAGG + Intergenic
1101110237 12:101479429-101479451 CATAATGAGATAAACACCACAGG + Intronic
1104117924 12:125767516-125767538 AATTATAAGATCAGCTGGACTGG + Intergenic
1105847019 13:24302142-24302164 TATTATGACAACAACTTGACAGG - Intronic
1106202340 13:27550139-27550161 CATGATGACATCAACTCCGCTGG + Intronic
1106470418 13:30049429-30049451 AATTATGAGATCAGGTAGACAGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1111324666 13:86678075-86678097 AAGTTTGAGATCAACTCCACTGG - Intergenic
1112974656 13:105302609-105302631 AAATATGATATCAACTTGACTGG - Intergenic
1114373513 14:22116728-22116750 AAATATGAGTTCAACTCCACTGG - Intergenic
1124414624 15:29464888-29464910 CAAGATGAGATCATCTCAACAGG + Intronic
1127342311 15:58060214-58060236 AATTATGTGATCAACTGGCCAGG - Intronic
1131807817 15:96141349-96141371 CATTGTGAGATAAAATTGACAGG + Intergenic
1133095205 16:3440337-3440359 CTTTAAGAGATCATCTCGGCCGG + Intronic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1141220651 16:82066329-82066351 CATTATGAGATGAACGCCTCTGG - Intronic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1159750526 18:72295119-72295141 GATTCTGATGTCAACTCGACTGG - Intergenic
1161472038 19:4462751-4462773 CATTAAAAGATAAACTCGGCCGG + Intergenic
928667029 2:33559749-33559771 GTTTATGAGAACAATTCGACAGG - Intronic
942786917 2:179710631-179710653 CATTTTGAGACCAACACCACTGG - Intronic
948187606 2:236033974-236033996 CATTATGAGATCAACTCGACAGG - Intronic
948593330 2:239064726-239064748 CATTATGAGAGGAACCCCACTGG - Intronic
1168979973 20:1996006-1996028 CATTGTGAGATCCACACCACAGG - Intergenic
1169481934 20:5990477-5990499 CATAATGAGATCAACTGGAGAGG - Intronic
1178264312 21:31128271-31128293 CATTATGAAATCCACTCTAGTGG - Intronic
1180530391 22:16345493-16345515 TGTTATGAAATCAACTCGAGTGG + Intergenic
1203319256 22_KI270737v1_random:40319-40341 TGTTATGAAATCAACTCGAGTGG - Intergenic
953731780 3:45456066-45456088 CATTTTGAGATCTACTGCACAGG + Intronic
958876378 3:99622356-99622378 CATTTTGAGATCCAAGCGACAGG + Intergenic
977657886 4:99543788-99543810 TGTTATGAGAACAACTTGACTGG - Intergenic
1003928958 6:10904837-10904859 CATTAAAAGATCGACTCGGCCGG + Intronic
1006618709 6:35347388-35347410 CATTAAAAGATAAACTCCACAGG + Intronic
1023436524 7:40146132-40146154 CATTATGAGCACAGCTCAACAGG - Intronic
1025636769 7:63327408-63327430 GAAAATGAGATAAACTCGACAGG - Intergenic
1025645927 7:63420694-63420716 GAAAATGAGATAAACTCGACAGG + Intergenic
1031544301 7:123033125-123033147 CATTATGAGATGAATTCTAGTGG + Intergenic
1031885665 7:127243401-127243423 CCTTATAAGATCAACTTGCCTGG + Exonic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1046698079 8:117365085-117365107 CATTATTAGGTCAACACAACTGG - Intergenic
1050159007 9:2697708-2697730 CAGTATGAGAACCACTGGACTGG - Intergenic
1056016456 9:82393573-82393595 CATTCTGAGAGCAAATCCACAGG - Intergenic
1058635124 9:107031068-107031090 CATTATGAGATAAATTCATCAGG + Intergenic
1059626837 9:116076138-116076160 CATTAGGAGATTCACTCAACAGG + Intergenic
1060764037 9:126280596-126280618 CATTAGGAGATCAAATTGACAGG + Intergenic
1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG + Intronic