ID: 948188255

View in Genome Browser
Species Human (GRCh38)
Location 2:236038371-236038393
Sequence CTGAATTAGGTCGAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948188255_948188265 24 Left 948188255 2:236038371-236038393 CCTGCCACCTCGACCTAATTCAG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 948188265 2:236038418-236038440 TTCCCATTCCACACCTTGCCAGG 0: 1
1: 0
2: 0
3: 20
4: 167
948188255_948188262 -8 Left 948188255 2:236038371-236038393 CCTGCCACCTCGACCTAATTCAG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 948188262 2:236038386-236038408 TAATTCAGGAAGATCTGGGATGG 0: 1
1: 0
2: 8
3: 166
4: 665
948188255_948188263 -5 Left 948188255 2:236038371-236038393 CCTGCCACCTCGACCTAATTCAG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 948188263 2:236038389-236038411 TTCAGGAAGATCTGGGATGGTGG 0: 1
1: 0
2: 4
3: 27
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948188255 Original CRISPR CTGAATTAGGTCGAGGTGGC AGG (reversed) Intronic
902997308 1:20236547-20236569 TTGAATTAAGTCTAGATGGCTGG - Intergenic
915566198 1:156714471-156714493 ATGAATTTGGGGGAGGTGGCTGG - Intergenic
918896090 1:190348413-190348435 CTGAATTATTTGGAGGTGACTGG - Intronic
920114374 1:203609652-203609674 CTGATTCAGTTCAAGGTGGCTGG + Intergenic
923929063 1:238672590-238672612 ATGTATTAGGTAAAGGTGGCGGG - Intergenic
1064061082 10:12137708-12137730 ATAATTTAGGTCAAGGTGGCTGG + Intronic
1064578914 10:16773633-16773655 CTGTATTACGTGGAGGAGGCAGG - Intronic
1073865321 10:107796720-107796742 CTGAGTTAGGTCAGAGTGGCAGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076499788 10:130928587-130928609 CTCAAACAGGTCCAGGTGGCAGG + Intergenic
1077411782 11:2407070-2407092 CTGGGTGAGGCCGAGGTGGCGGG - Intronic
1082897228 11:58204862-58204884 CTGGATCAGGTCGTGATGGCAGG + Intergenic
1086818833 11:91408973-91408995 ATTAATTAAGTCAAGGTGGCTGG - Intergenic
1088687702 11:112298622-112298644 CTGAGAGAGGCCGAGGTGGCTGG - Intergenic
1089200546 11:116722364-116722386 CTGAGTTAGGTCCAGGTGGTTGG - Intergenic
1096322171 12:50624573-50624595 CTTCAGTAGGTCGAGGTGGGTGG - Intronic
1100002884 12:89858542-89858564 CTGAGTTAGGTGGAGGTTGTAGG + Intergenic
1102644844 12:114397146-114397168 ATGAATTTGGTCAAGGGGGCGGG - Intronic
1113882609 13:113636033-113636055 CTGAGTTGGGTGGCGGTGGCCGG - Exonic
1114429127 14:22645488-22645510 CTAAATAAGGTAGAGGGGGCTGG + Intergenic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1116502818 14:45640865-45640887 CTGAACTTGGTCGAGGTCGTGGG - Intergenic
1121184734 14:91956682-91956704 TTGAATCAGGTGGAGGTTGCTGG + Intergenic
1124440844 15:29685371-29685393 CTGACTTATGGCGAGGTGGTGGG + Intergenic
1134073002 16:11272259-11272281 GAGAATTAGCTCAAGGTGGCTGG + Intronic
1135393032 16:22110079-22110101 CTGGAATTGGTGGAGGTGGCTGG - Intronic
1137616512 16:49851268-49851290 CTGATTTAGGTGGTGGTGGTGGG - Intronic
1142028138 16:87825219-87825241 CTGAAGGAGGGCGAGGTAGCAGG + Intergenic
1144766849 17:17737794-17737816 CTGGAGTAGGCGGAGGTGGCTGG - Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146926593 17:36750003-36750025 CTGAAGAAGGGCGAGGTGCCTGG - Intergenic
1152413191 17:80141038-80141060 ATAAATTAGGTCGAGGTGGGTGG - Intronic
1164551031 19:29212785-29212807 CTGAATCAGGTCGGGCTGGGCGG - Intronic
1167862586 19:52297327-52297349 CTGAATTTGGTCGGGGTAGAGGG - Intronic
1168411352 19:56142053-56142075 CTGACTGGGGTAGAGGTGGCGGG - Intronic
925572027 2:5322672-5322694 ATGAATGAGGTCGAGGGGGATGG + Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926476671 2:13330539-13330561 CTGAATCAGGTCAGAGTGGCTGG - Intergenic
928180724 2:29066586-29066608 CTGAACAAGATCGAGGTGGGTGG + Intronic
928406473 2:31018863-31018885 CTGAGCTAGGTAGAGGTCGCAGG - Intronic
928709044 2:33983815-33983837 TGGGATTAGGTGGAGGTGGCTGG + Intergenic
929214427 2:39396282-39396304 CTTCATGAGGTCGAGGTGGGAGG - Intronic
932152774 2:69387687-69387709 AAGAATTAGGTTGAGGTGGGAGG + Intergenic
932215441 2:69963146-69963168 CTGAATCAGGTGGAAGGGGCTGG - Intergenic
941567633 2:167128651-167128673 GTGAATTAAGTGGGGGTGGCGGG - Intronic
945056178 2:205871278-205871300 CTGAATGGGGACGAGATGGCTGG - Intergenic
947512413 2:230768667-230768689 GTCAATTAGGTGGAGGTGGTGGG + Intronic
948188255 2:236038371-236038393 CTGAATTAGGTCGAGGTGGCAGG - Intronic
1173207660 20:41007342-41007364 CTGAAGTGGGCCAAGGTGGCAGG + Intergenic
1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG + Intergenic
1185219347 22:49621796-49621818 CTGACCTTGGTGGAGGTGGCTGG - Intronic
957538816 3:81541456-81541478 ATGAATTTGGGCGAGGTGGCGGG - Intronic
959512748 3:107232836-107232858 CTGGATTAGTTCCATGTGGCCGG - Intergenic
960708224 3:120502183-120502205 CAGAATCAGGTGGCGGTGGCTGG - Intergenic
962188032 3:133280704-133280726 CTGAATCTGGTCCAGGTTGCTGG - Intronic
968869616 4:3235039-3235061 CTGAGTTAGGCCGAGAGGGCAGG + Intronic
969148955 4:5151973-5151995 CTGAATATGGTCCATGTGGCTGG - Intronic
969455379 4:7297145-7297167 CTGCATTAGGTGGAGGGGGCTGG + Intronic
972232796 4:37094944-37094966 CTGAATCATGATGAGGTGGCAGG + Intergenic
974203126 4:58666485-58666507 TTGAATGATGTCTAGGTGGCTGG - Intergenic
975077855 4:70235297-70235319 CTGAAGAAGGAAGAGGTGGCAGG + Intergenic
976700732 4:87966443-87966465 CTGGAGGAGGCCGAGGTGGCAGG - Intergenic
984471760 4:180184490-180184512 CTGAATTTGGTTGTGGTGGTGGG + Intergenic
985503551 5:264520-264542 CTGGATTAGGCCGGGGTGCCCGG - Intergenic
988190574 5:27927420-27927442 CTGTAATTGGTGGAGGTGGCTGG - Intergenic
988393246 5:30663107-30663129 CTGAAATCGGTCAATGTGGCAGG - Intergenic
1001135564 5:169099811-169099833 CTGCATTAGGTCAAGAAGGCAGG + Intronic
1007652436 6:43431906-43431928 ATGAGTTAGGTTCAGGTGGCCGG + Intronic
1009643155 6:66363009-66363031 CTGGAGGAGGCCGAGGTGGCAGG + Intergenic
1016318315 6:142814480-142814502 CTGAATTGGGCAGAGGTGGTGGG + Intronic
1017902873 6:158733621-158733643 TTAAAATAGGTAGAGGTGGCCGG - Intronic
1021755042 7:23843435-23843457 CAGAATTAGGGAGAGGTCGCAGG - Intergenic
1021934928 7:25620895-25620917 CAGAATAAGGTGGTGGTGGCTGG - Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1029211385 7:98911068-98911090 CTGTATTAGGTCCAGATAGCAGG + Exonic
1030920057 7:115372583-115372605 CTGCAGTAGGTCAAGGTGGAAGG + Intergenic
1033423734 7:141224843-141224865 CTGAATGAGGTTGAAATGGCTGG + Intronic
1034285296 7:149879979-149880001 CTGAGGGAGGTCCAGGTGGCAGG - Exonic
1035076925 7:156185759-156185781 CTGCATTAGGTAGAAATGGCTGG - Intergenic
1039743908 8:40406712-40406734 ATGAACTAGGCCGAGGAGGCTGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1049215512 8:141406090-141406112 CTGACTTAGGTCGAGGACACTGG + Intronic
1049851383 8:144832952-144832974 TTGAAGTAGGCCGAGGTGGGCGG + Intronic
1050182274 9:2934237-2934259 CTAGAGGAGGTCGAGGTGGCAGG - Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1057170884 9:92962384-92962406 CTGAACCAGGTGGTGGTGGCAGG + Intronic
1060089657 9:120731742-120731764 CTGAATGAGAACGAGGAGGCAGG + Intergenic
1185741580 X:2537279-2537301 CTGAATGTGGTGGTGGTGGCTGG - Intergenic
1186357993 X:8807415-8807437 CAGAATGACTTCGAGGTGGCTGG + Intergenic
1190615906 X:52231184-52231206 ATCAATTAGGTCGAGTTGGTTGG - Intergenic
1193631913 X:83899746-83899768 CTTGTTTTGGTCGAGGTGGCAGG - Intergenic
1195276098 X:103282336-103282358 ATTAATTAGGTCAAGGTGACAGG + Intergenic