ID: 948189978

View in Genome Browser
Species Human (GRCh38)
Location 2:236051074-236051096
Sequence CAGTGTGACTAAAGAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948189978_948189983 25 Left 948189978 2:236051074-236051096 CCATCTTTTCTTTAGTCACACTG 0: 1
1: 0
2: 2
3: 27
4: 410
Right 948189983 2:236051122-236051144 GTAATTCCTCTCCAAGACTGTGG 0: 1
1: 0
2: 0
3: 27
4: 143
948189978_948189980 -5 Left 948189978 2:236051074-236051096 CCATCTTTTCTTTAGTCACACTG 0: 1
1: 0
2: 2
3: 27
4: 410
Right 948189980 2:236051092-236051114 CACTGGCTTTCCTAAAGAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948189978 Original CRISPR CAGTGTGACTAAAGAAAAGA TGG (reversed) Intronic
900998500 1:6135577-6135599 CAGTGTGGCTGAGGAAAAGAGGG - Intronic
901484202 1:9547144-9547166 CTGTGTGACTTAAGAAATTAGGG + Intronic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
901901464 1:12367148-12367170 CAATGTCACTAAAGACAAAATGG - Intronic
902121882 1:14173288-14173310 CAGATGGGCTAAAGAAAAGAAGG + Intergenic
902217301 1:14942491-14942513 CAGCTTGAATAAAGAACAGAAGG - Intronic
902458916 1:16556252-16556274 CTGTGTGACTACAGAAATGTTGG + Intergenic
902493240 1:16851664-16851686 CTGTGTGACTACAGAAATGTTGG - Intronic
902924147 1:19684661-19684683 CCTTGTGACTAAAGAATAAACGG - Intronic
903152100 1:21417009-21417031 CTGTGTGACTACAGAAATGTTGG + Intergenic
903408313 1:23117740-23117762 AAGTGTGACTTAGTAAAAGAAGG - Intronic
904738060 1:32650475-32650497 CAATTTGACTGAAGAACAGAAGG - Exonic
905486806 1:38304238-38304260 CAGTGTTCCTAAACAAAAGAAGG - Intergenic
905601975 1:39260037-39260059 CAGTGATACTAAAAAAAAAATGG - Intronic
905750402 1:40457588-40457610 CAGAGAGACTAATGAGAAGATGG - Intronic
906376164 1:45298609-45298631 AACTGTGACTAAAGGGAAGAGGG - Intronic
907219356 1:52894363-52894385 CATGCTGACTAAAGAAAACATGG + Exonic
907871488 1:58447618-58447640 CAGTGCTATGAAAGAAAAGAAGG + Intronic
908194297 1:61733970-61733992 ACGTGTGATTAAATAAAAGAAGG - Intergenic
908532040 1:65043166-65043188 CTCTGTGACTAAAGAAGACATGG + Intergenic
909214151 1:72864234-72864256 CACTGAGACTACAGAAAAGCAGG - Intergenic
909381625 1:75005401-75005423 CAGTGTGTTTCAAGAAAAAATGG - Intergenic
909656704 1:78040952-78040974 AAATTTGACTAAAGAAAAGTAGG - Intronic
909842391 1:80344708-80344730 CAGTCTGGATAAAGAAAATATGG + Intergenic
910219723 1:84878230-84878252 CAGTGAAACCAAAGAAAATAAGG - Intronic
910244509 1:85124079-85124101 CAGTGTTATTAAAGATGAGATGG + Intronic
910453884 1:87374770-87374792 CAGAGTGAATAAAGAAAATGTGG - Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912646986 1:111402421-111402443 CTGCGTAACAAAAGAAAAGAAGG - Intergenic
915718415 1:157965699-157965721 CAGTTAGACAAAAGAAGAGAAGG + Intergenic
917066994 1:171107592-171107614 CAGTATGAAAAAAGAAAAGTGGG - Intronic
917438211 1:175042405-175042427 CAGAATGAATAAAGAAAATATGG - Intergenic
917787269 1:178472203-178472225 CAGTCTAACTAAAGGAAAGTAGG - Intronic
918021088 1:180691586-180691608 CAGGGAGACTAAAGAAGAAATGG - Intronic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
918511761 1:185320187-185320209 CAGGGTGAATAAAGAAAAGATGG - Intergenic
919328972 1:196144821-196144843 CACAGTGACTCAAGAAAAGCAGG + Intergenic
922094309 1:222429533-222429555 CAATGTGAATAAAGAAAATGTGG + Intergenic
922358973 1:224803650-224803672 AAGTGGGACTACAGAAAATAGGG - Intergenic
922955599 1:229596589-229596611 GTGTGTGACGACAGAAAAGACGG + Intronic
923261013 1:232268099-232268121 CAATGTGATCAAAGAAAGGAAGG - Intergenic
923911592 1:238452344-238452366 CAGTGGGGCTAAGGAAAAAAAGG - Intergenic
923927523 1:238650283-238650305 CAGTATCAGAAAAGAAAAGAGGG + Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924552037 1:245087956-245087978 CATTGGAACTAGAGAAAAGAAGG + Intronic
1063525366 10:6779588-6779610 CAGTGTGGCTAAAATAAAGCAGG + Intergenic
1063744305 10:8862395-8862417 CAGTGTGACAAAGGGAAACAGGG + Intergenic
1064512976 10:16115253-16115275 CAGTTTAACTAAGGAAAAGTGGG - Intergenic
1065638271 10:27753104-27753126 GAGAGAGAGTAAAGAAAAGAAGG - Intergenic
1066371828 10:34824154-34824176 TAGTGTGTCCAAAGCAAAGAGGG - Intergenic
1067393591 10:45889151-45889173 TAGTCTCACTAAGGAAAAGATGG - Intergenic
1067861915 10:49858294-49858316 TAGTCTCACTAAGGAAAAGATGG - Intronic
1068030777 10:51702241-51702263 CAGTGGGACTAAAGAGAACATGG - Intronic
1068310695 10:55270903-55270925 TAGAGTGAATAAAGAAAATATGG + Intronic
1068351438 10:55850837-55850859 CATTTTGACTGTAGAAAAGAAGG - Intergenic
1068922244 10:62496884-62496906 CAGTGAGAATAAATAAAAGAAGG - Intronic
1068957177 10:62828517-62828539 CAGGGTGACCAAGGAACAGAGGG - Intronic
1069530067 10:69211112-69211134 GAGACAGACTAAAGAAAAGATGG + Intergenic
1070345245 10:75535696-75535718 GGGTGTGACTAAAGAAAATCAGG + Intronic
1071673613 10:87634893-87634915 CAGTGTGACTAGAACAAAGCAGG - Intergenic
1071735542 10:88294957-88294979 AAGTGTGACAAAAGAGAAGGTGG - Intronic
1072004676 10:91233056-91233078 AAGTATGACCAAAGAAGAGAGGG + Intronic
1072557161 10:96528749-96528771 CATAGTGACTAAGAAAAAGAGGG - Intronic
1072803872 10:98411935-98411957 CAGTGGGACTCATGAACAGATGG + Intronic
1073523974 10:104162262-104162284 CAGTATCCCTAAAGCAAAGAGGG + Intronic
1073762232 10:106642308-106642330 CAGTGTGATTAATGCAGAGAGGG - Intronic
1073823973 10:107299141-107299163 TAGTGGGAGTAAATAAAAGATGG + Intergenic
1075013121 10:118891776-118891798 CAGAGTGAGAAAAGAAAGGAAGG + Intergenic
1075122828 10:119676718-119676740 GAGTGTGGCTACAGAAGAGAGGG + Exonic
1075660789 10:124194215-124194237 CAGTATGAAGAAAGAAAAGATGG + Intergenic
1078369644 11:10734344-10734366 CAGTGAGATGAAAGAAAGGAAGG + Intergenic
1079466278 11:20734174-20734196 CATGGTGACTAAAGTAGAGAAGG + Intronic
1080470346 11:32539394-32539416 CAGTGAGAAGAAAGAAAGGAAGG - Intergenic
1081702394 11:45159989-45160011 CAATGTGACTCAAGAAGAAATGG - Intronic
1081741032 11:45440832-45440854 AAGTGAGACAGAAGAAAAGAAGG - Intergenic
1083518617 11:63285104-63285126 CTGAGTGAATAATGAAAAGAAGG + Intronic
1084427835 11:69095255-69095277 CAATTTGCCGAAAGAAAAGAAGG - Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087521186 11:99238900-99238922 CATTGTGACTGAAGAAAATTTGG + Intronic
1087696913 11:101389781-101389803 CAGTATGACCAAAGCACAGAAGG - Intergenic
1087852136 11:103044595-103044617 CAGCGGGACTAAGGAAAAGCAGG - Intergenic
1089086961 11:115828320-115828342 AAGTATGACTAAAGAAATCATGG - Intergenic
1090714058 11:129414466-129414488 CATTAATACTAAAGAAAAGAAGG - Intronic
1092817212 12:12322885-12322907 CAGAGTGATGAAAGAAAGGAAGG + Intergenic
1093301341 12:17460943-17460965 CATAGAGTCTAAAGAAAAGAAGG + Intergenic
1093868146 12:24253493-24253515 CAGTGTCTTTAAAGCAAAGATGG + Intergenic
1094443346 12:30503552-30503574 CAAGGTGACTGAAGAAAGGATGG - Intergenic
1098599545 12:72314566-72314588 CAGTGTCACTGAAGGAAAAATGG + Intronic
1099029659 12:77510441-77510463 CACTGTGGTTGAAGAAAAGAGGG - Intergenic
1099198127 12:79643195-79643217 CAGAGGGAGGAAAGAAAAGAAGG + Intronic
1099583449 12:84483844-84483866 CAGTGTGACTAGAATAAAGCAGG + Intergenic
1099888109 12:88556548-88556570 CTTGGTGACTAATGAAAAGAGGG + Intronic
1100513126 12:95297153-95297175 AAGTTTGACTTAAGAAAAGAAGG - Intronic
1100575549 12:95888939-95888961 CACGGTGAGTAAAGGAAAGAAGG + Intronic
1102409212 12:112702640-112702662 AAGAGTGACTGAAGAGAAGAGGG + Intronic
1103001582 12:117389087-117389109 CTGTGTGACTGAAGAAGACAAGG + Intronic
1105003105 12:132703802-132703824 GAGTGTGACTGAAGAACAGTAGG + Intronic
1106524449 13:30527618-30527640 CAGTGTGACACAAAAAGAGATGG + Intronic
1106757250 13:32835309-32835331 CACTATAACTAAAGAAAAGTGGG - Intergenic
1107023559 13:35776781-35776803 CAGTGAAACTGAAGGAAAGAGGG - Intronic
1107211744 13:37865985-37866007 TATTGTGAAAAAAGAAAAGAGGG - Intronic
1108094826 13:46890662-46890684 CAGTGTGGCTGAGGAAAAGATGG + Intronic
1108646651 13:52436649-52436671 GAGTGTGACTTTAGAAAATAAGG + Intronic
1109633941 13:65088587-65088609 CTGTGTGAGTAAAGAAGGGAAGG + Intergenic
1110061001 13:71038006-71038028 TAGAGTGAAAAAAGAAAAGATGG + Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1110679386 13:78290530-78290552 CAGAGTGAATAAAGAAGTGAAGG - Intergenic
1110967936 13:81725133-81725155 CAGTGTGAATAAAGCCAAAAGGG + Intergenic
1111590763 13:90345868-90345890 CGCTGTGACTAAAGAAACTAAGG - Intergenic
1111974786 13:94954365-94954387 CAGACTGGCTAAAGAAAATATGG + Intergenic
1112167454 13:96934908-96934930 CAGTGGGAAGAAACAAAAGAAGG - Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112623885 13:101080001-101080023 AAGTATGACTAACAAAAAGAAGG + Intronic
1113828245 13:113273676-113273698 GAGTGTGACAGAACAAAAGAAGG + Intergenic
1115283288 14:31689042-31689064 TAGACTGAATAAAGAAAAGATGG - Intronic
1115520808 14:34231408-34231430 TTGAGTGAATAAAGAAAAGAAGG + Intronic
1115564307 14:34612080-34612102 GAATGTGATTAAAGAAAAAAAGG - Intronic
1116007870 14:39315913-39315935 CAATGTGATAAAAGCAAAGAAGG - Intronic
1116748720 14:48853541-48853563 CAGGGTGACCAAAAAAAAAAGGG + Intergenic
1117725945 14:58673742-58673764 CAGTGAGACAAAAAAAAAAAGGG - Intergenic
1118815634 14:69311840-69311862 TAGTGTGACTATTGCAAAGATGG - Intronic
1119004676 14:70912797-70912819 CAGTGTGACTACAGCACAGTGGG - Intronic
1119208602 14:72812818-72812840 CATGGTGACCAAACAAAAGACGG + Intronic
1119286536 14:73459114-73459136 CATTGAGACCAAAGAAAAGAAGG - Intronic
1119493075 14:75053688-75053710 CAGTGAGATTGAAGAAAACAAGG + Intronic
1120150656 14:81029725-81029747 CATTTTTTCTAAAGAAAAGAGGG + Intronic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1121479466 14:94252211-94252233 CATTAAAACTAAAGAAAAGACGG + Intronic
1122689305 14:103524092-103524114 CTCTGTGAATAAAGCAAAGAAGG + Intergenic
1122765808 14:104069034-104069056 CAGCGTGGCTAAAGTAAAGCAGG + Intergenic
1125195742 15:37043985-37044007 CAGTGTGGATAAAGAAGAGACGG - Intronic
1126201701 15:45994003-45994025 AAGTGTGATTAAAGAAAATATGG - Intergenic
1127918440 15:63474376-63474398 AAGTCTGACTAATGAAGAGAGGG - Intergenic
1128479941 15:68028373-68028395 CAGAGTGACTAACGAGGAGATGG + Intergenic
1129968006 15:79753998-79754020 CAGTCTGTCTTAAGGAAAGAGGG - Intergenic
1130722238 15:86399794-86399816 CAGTGTCACTAAGGAGAAGCTGG - Intronic
1132155088 15:99490156-99490178 CAGTGGGACATAACAAAAGATGG - Intergenic
1133371811 16:5251031-5251053 TAGTGTGAATAAAAGAAAGAGGG - Intergenic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1135880856 16:26254797-26254819 CAGAATGAATAAAGAAAATATGG + Intergenic
1136538794 16:30916552-30916574 TAGTGTGACCAAAACAAAGATGG - Intergenic
1137040443 16:35606995-35607017 CTTTTTGACAAAAGAAAAGAGGG - Intergenic
1137582058 16:49639583-49639605 CAGTGGGAACAAAGAAAACAAGG - Intronic
1137935377 16:52630197-52630219 AGGTGAGAATAAAGAAAAGAGGG + Intergenic
1138863276 16:60785895-60785917 CAGAGAGACTAAAGTTAAGAGGG - Intergenic
1138934210 16:61698734-61698756 CAGTGTAACTCAAGAAGTGAAGG - Intronic
1140347601 16:74229024-74229046 CTAGGTGACTAAAGGAAAGAGGG + Intergenic
1144737032 17:17560989-17561011 CAGTGTGACTGAAGATAGCAAGG + Intronic
1146921336 17:36714578-36714600 TGGTGTGAATAAATAAAAGAGGG - Intergenic
1147415169 17:40283681-40283703 GATTGAGGCTAAAGAAAAGAAGG + Exonic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1150090640 17:62322109-62322131 CAGTGTGCCTAAAGCATATAAGG - Intergenic
1151633368 17:75326445-75326467 CAGTGGGACTAAGGGAAAGTGGG + Intronic
1153424454 18:4946448-4946470 CTGTGAAACTAAAGACAAGAAGG + Intergenic
1155555600 18:27015719-27015741 CAGAGTGATAAAGGAAAAGAAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157412027 18:47471093-47471115 CAGTGTGACTCCAGTAAATAGGG + Intergenic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1159984062 18:74820889-74820911 CAGTCTGGCTCAGGAAAAGAGGG + Intronic
1160458726 18:79021235-79021257 CTGTGTGACTCCAGAACAGAAGG - Intergenic
1161651866 19:5490657-5490679 CTGGGTGATTAGAGAAAAGAGGG - Intergenic
1161915970 19:7228407-7228429 CAGTGAGGCTAAAGACAGGAAGG + Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165842946 19:38799909-38799931 GAGAGTGAATAAAGAATAGATGG + Intergenic
1167909183 19:52688175-52688197 CCCTGTTACCAAAGAAAAGAAGG - Intronic
1168547009 19:57261275-57261297 TATTGTGACTGTAGAAAAGACGG + Intergenic
925223855 2:2164907-2164929 CACTGTGACAGAAGGAAAGAAGG + Intronic
927635829 2:24815914-24815936 CAGAGTTTCAAAAGAAAAGAGGG - Intronic
928480775 2:31681245-31681267 CTGGGTGAATAAAGAAATGAAGG - Intergenic
928907572 2:36383601-36383623 CAGAGTGAGTATAGAAATGAGGG + Intronic
930141678 2:47956950-47956972 CAGTCTGGATAAAGAAAATATGG + Intergenic
930294128 2:49531857-49531879 CAGTGAGAGTAACAAAAAGAAGG + Intergenic
930356271 2:50324759-50324781 GAGTGTGACTAAGGAAATGTTGG - Intronic
930626713 2:53706926-53706948 CAGTGTTCCTAAAGACAATATGG - Intronic
931181962 2:59910621-59910643 CACTCTGATTAAAAAAAAGAAGG - Intergenic
931268860 2:60684304-60684326 CAGTGAGACTCAAGAAAGGAAGG + Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932803165 2:74760847-74760869 GAGTGTGACTATGGAAAAGGAGG + Intergenic
935306552 2:101742271-101742293 CAGTCTGCCTAAAGAAATCAAGG - Intronic
935568440 2:104634339-104634361 CAGTGTGAATAAATAAATGATGG - Intergenic
935607244 2:104983460-104983482 CAGAGTGAGTAAATAAAAGGAGG + Intergenic
935955560 2:108373398-108373420 CAGAATGACTAAAAAAAATACGG + Intergenic
936845590 2:116827368-116827390 TAGTATGAATAAAGAAAAAATGG + Intergenic
938117340 2:128611070-128611092 TAGGGAGACTTAAGAAAAGAAGG - Intergenic
939133950 2:138272254-138272276 CACTCTGCCTAAAGAAAAGAAGG - Intergenic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
939833413 2:147099723-147099745 CAGTGTGGCTAAAGAGGAAAAGG - Intergenic
939888107 2:147703330-147703352 CAGAGAGACTAAAGAAACAAAGG - Intergenic
940841574 2:158588786-158588808 CAGAGTCACTAAAGAAAATATGG - Intronic
941069835 2:160943514-160943536 CAGTGTGACTAATTAAGATATGG - Intergenic
943952722 2:194150857-194150879 TTGTGTGAATAAAGAAATGAAGG - Intergenic
944209825 2:197195460-197195482 GACTGTGATTAAAAAAAAGATGG - Intronic
944272898 2:197804022-197804044 CAGTGTGAGTAAATATAACAAGG - Intergenic
944875756 2:203962887-203962909 GAGTGTGACTAGACAGAAGATGG + Intergenic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946607603 2:221422738-221422760 CATTGTGACTAAATAAACAAAGG + Intronic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948724844 2:239928328-239928350 AATCATGACTAAAGAAAAGAAGG + Intronic
1169454636 20:5741477-5741499 CAGTAGGTCTAAGGAAAAGAAGG - Intergenic
1169848368 20:10021727-10021749 CAAAGTGACTAAAGAGAAGCAGG + Intronic
1170593588 20:17789401-17789423 ACGTGTGACAAAAGAAAAGCTGG - Intergenic
1173124954 20:40328112-40328134 CAGTGTGAAGAAAGGAAAAAAGG - Intergenic
1175342853 20:58245748-58245770 CATTGTCATTAAAGAGAAGATGG - Intergenic
1177044692 21:16154884-16154906 CAGGGTGAGAAAAGAAAAGGAGG + Intergenic
1177231921 21:18332860-18332882 TAGACTGACTAAAGAAAAGGTGG + Intronic
1177493501 21:21858997-21859019 CACTGTGAGAGAAGAAAAGAAGG + Intergenic
1178194955 21:30334032-30334054 CACTGTTTCTAAAGACAAGAGGG - Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179361962 21:40718194-40718216 CAGTTTCACTAACGTAAAGAGGG + Intronic
1180790575 22:18573512-18573534 CAGTGTGACTAAAAGAAGGCAGG - Intergenic
1181231163 22:21421803-21421825 CAGTGTGACTAAAAGAAGGCAGG + Intronic
1181247488 22:21513065-21513087 CAGTGTGACTAAAAGAAGGCAGG - Intergenic
1183875116 22:40773658-40773680 CAGGGTGACTGAAGTATAGAAGG + Intronic
1183969648 22:41467396-41467418 AAGTGTTACTAAACAAAAGGAGG + Intronic
949672845 3:6419626-6419648 CAGAGTAAATAAAGACAAGAAGG + Intergenic
949898084 3:8785168-8785190 CAGTGTGTCTAGAGAAGGGATGG + Intronic
950037041 3:9893699-9893721 CATTGAGACTAAAGGAAATAGGG + Exonic
951551957 3:23883091-23883113 AATTGATACTAAAGAAAAGATGG - Intronic
951983800 3:28595501-28595523 CAGTCTGAGGAAAGGAAAGAGGG + Intergenic
952163745 3:30723006-30723028 CAATGTAACTCAAGAAAATATGG - Intergenic
952268485 3:31809612-31809634 AAGTGTGACTAAGGACAATAAGG + Intronic
952525979 3:34211015-34211037 TAGAGTGAGTACAGAAAAGATGG - Intergenic
952635545 3:35524974-35524996 CAGAGTGACTATAGCACAGAGGG - Intergenic
953740496 3:45534540-45534562 CAGAATGACTAAAGAAAACATGG + Intronic
954049684 3:47963855-47963877 CAGTGGGACGAAAAAATAGAAGG + Intronic
954543495 3:51412751-51412773 CAGTGTGAGTCCAGAAAAAAAGG + Intronic
957215080 3:77309708-77309730 CAGTGTCTCTAAAGAAGAGAAGG - Intronic
959760441 3:109956829-109956851 AAGTTTTACTGAAGAAAAGAGGG - Intergenic
960141343 3:114154490-114154512 CTGTCTGACCAAATAAAAGATGG - Intronic
960411452 3:117331524-117331546 CAGTGTCACAAAAGATGAGAAGG - Intergenic
960782655 3:121336867-121336889 CAGATTGAATAAAGAAAATATGG + Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962247713 3:133810756-133810778 CAGTGTGAGTATAGCAAAGTAGG - Intronic
963833543 3:150033881-150033903 CATTGTGACAAAACAAAAGGAGG - Intronic
963857704 3:150272207-150272229 TATTGTGAATAAAGAAAATAGGG + Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964561395 3:158000551-158000573 TAGACTGAATAAAGAAAAGATGG + Intergenic
964782000 3:160349923-160349945 TAGTGTGATGAAAGATAAGAAGG - Intronic
964979660 3:162664283-162664305 CAGATTGAATAAAGAAAACATGG + Intergenic
965248519 3:166309199-166309221 CAATGTGATTACAGAAAAAAAGG + Intergenic
966044802 3:175534877-175534899 CAGTGTGAACAAAGAAAGAAAGG - Intronic
966141224 3:176758464-176758486 CAGTATGACTAAAGACTGGAGGG + Intergenic
966147182 3:176824992-176825014 TGGTGAGAGTAAAGAAAAGAGGG + Intergenic
966458124 3:180141502-180141524 CCATGTGGCTAAGGAAAAGACGG - Intergenic
967232263 3:187351030-187351052 CAAAGTGACTTAAGAAAAAAAGG + Intergenic
967785870 3:193494859-193494881 TAGTCAGACTAAAGAAAAAAAGG + Intronic
968054264 3:195679187-195679209 CAGCGTGACTAAGGCACAGAAGG + Intergenic
968101623 3:195969959-195969981 CAGCGTGACTAAGGCACAGAAGG - Intergenic
968111462 3:196051299-196051321 CAGTGTCATTTATGAAAAGAGGG - Exonic
968179007 3:196576355-196576377 TAGTTTGACTAAAGTAGAGAAGG + Intronic
968743808 4:2346865-2346887 GAATGGGAATAAAGAAAAGATGG + Intronic
969672443 4:8597288-8597310 CAGTGTGGCTAAAGACAACTGGG - Intronic
969836921 4:9849948-9849970 AAGAGTGACTAGATAAAAGATGG + Intronic
969991736 4:11271416-11271438 CAGTGGGACTAAAACAAAGCAGG - Intergenic
970923852 4:21427400-21427422 CATTGTGACTAATTAAAAAAGGG + Intronic
971106471 4:23530149-23530171 CAGATTGAATAAAGAAAATATGG + Intergenic
972087251 4:35234395-35234417 CAGATTGAATAAAGAAAATATGG + Intergenic
972396250 4:38662221-38662243 AAGTGTGACCCAAGATAAGAAGG - Intergenic
972858023 4:43131616-43131638 CAGGGTGAGGAAAGAAAATAGGG + Intergenic
972927818 4:44033642-44033664 GAGTGTGAATGAAGAAGAGAAGG + Intergenic
973100260 4:46258952-46258974 AAGTTTGAATACAGAAAAGAGGG + Intronic
973791402 4:54381242-54381264 CAGTGAGACTCAAGAAAGAAAGG + Intergenic
974578540 4:63762422-63762444 CAGTGTGGATAAAGGAAAAAGGG + Intergenic
974919202 4:68216757-68216779 CAGTATGATGAAAGAAAAGGTGG + Intergenic
975219763 4:71800455-71800477 CAGACTGCATAAAGAAAAGATGG - Intronic
975338917 4:73215036-73215058 TAGTATGTCTTAAGAAAAGATGG - Intronic
975657397 4:76655304-76655326 CACTGTGTCTAAAGAGAACATGG - Intronic
975769035 4:77700989-77701011 CACTGTCACTAAAGAAAAACTGG + Intergenic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977182722 4:93897519-93897541 CAGTGTGACTAAAAAGTTGAAGG + Intergenic
977313188 4:95412384-95412406 AAGTGTGAGAAAAGAAAAGCAGG - Intronic
977373195 4:96167029-96167051 AAGTATGATTAATGAAAAGAAGG + Intergenic
977514558 4:98005193-98005215 CAGTGTGGCTAGAAAAAAGGAGG - Intronic
978297057 4:107217720-107217742 TAGTGTGGATAGAGAAAAGAAGG - Intronic
978549755 4:109912813-109912835 AAGTGTCACTAAAGGAAAGGAGG + Intergenic
978556744 4:109989117-109989139 CTGTGTGTATAAAGAAAAGGAGG + Intronic
978670304 4:111240705-111240727 CACTGTGACAGAAGAAAACATGG + Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
980197741 4:129613350-129613372 CAGAGTGAATAAAGAAAATGTGG + Intergenic
981122848 4:141072456-141072478 CAGTGGGACAAAAGGAAAAAAGG + Intronic
981601261 4:146491634-146491656 CTGTGTGAAGAAAGAAAGGAAGG + Intronic
982048190 4:151470682-151470704 CAATGAGAATAAAGAGAAGAGGG + Intronic
982213611 4:153061241-153061263 CAGATTGAATAAAGAAAATATGG + Intergenic
982404849 4:155008172-155008194 CAGTGTGCCTAGAGAAAAGGAGG - Intergenic
982846607 4:160260484-160260506 CAGACTGGATAAAGAAAAGATGG - Intergenic
983059750 4:163144407-163144429 TCGTGTTACTGAAGAAAAGAGGG + Intronic
984122637 4:175765260-175765282 CAGTGATAATAAAGAAAAGTGGG - Intronic
984258143 4:177411516-177411538 TAGTGTGGCTAGAGACAAGAAGG - Intergenic
985500567 5:241849-241871 CAGTGTGACTAAGGCACAGAAGG + Intronic
986223283 5:5789548-5789570 CAGTGTGACTATATTAGAGATGG - Intergenic
986236676 5:5916935-5916957 CACTGTGTCTACAGAAAAGTAGG + Intergenic
986517818 5:8581749-8581771 AACAGTGACTACAGAAAAGATGG - Intergenic
986676035 5:10186462-10186484 CAGGCTGCATAAAGAAAAGATGG + Intergenic
987946909 5:24621649-24621671 CATTTTGACTAAAGAACTGAAGG + Intronic
987962918 5:24833337-24833359 CAGTGTGGCTAAAAATAAAATGG - Intergenic
989370848 5:40706093-40706115 CAGACTGGCTAAAGAAAATATGG + Intergenic
989412795 5:41139908-41139930 CAGTCTGACTAGGGAGAAGATGG - Intergenic
989419496 5:41219954-41219976 GAGTGTGGCCAAAGTAAAGAGGG + Intronic
990406896 5:55500713-55500735 CAGTGTGAAGACAGAATAGACGG + Intronic
990426287 5:55693065-55693087 CATTGTGACTCAAAAAAATAAGG + Intronic
990532801 5:56690331-56690353 CAGTGTGGCTAAAGATCAGCAGG + Intergenic
990800922 5:59601686-59601708 GAGTGAGACTAATGATAAGAAGG - Intronic
991361033 5:65820537-65820559 CATTTTGACCAAAGAAAGGAAGG + Intronic
991364902 5:65858372-65858394 CAGTGTGTTGAAAGAAAAGCTGG - Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
993192066 5:84695822-84695844 CAGGGTGGCTAAAGAAATGCTGG + Intergenic
993767893 5:91884970-91884992 AAATGTGATTAAAGAACAGAAGG - Intergenic
993862332 5:93151084-93151106 CAGTGTGAACAAAAAAAATAAGG + Intergenic
993920854 5:93799413-93799435 TAGTATGTCTATAGAAAAGATGG - Intronic
994171736 5:96665036-96665058 GACTGTGACTAAACAAAACAGGG - Intronic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996191660 5:120550791-120550813 CAGTGTGCCTAAAGCAGGGAAGG + Intronic
997445065 5:133934574-133934596 GAGTGTGACTGAATGAAAGACGG - Intergenic
998589527 5:143462628-143462650 CACAGTGAGTAAGGAAAAGAAGG - Intergenic
999479980 5:151939219-151939241 CAGTGAGACAAGTGAAAAGATGG + Intergenic
999636883 5:153632336-153632358 CAGATTGACTAAAGAAAATATGG - Intronic
999994383 5:157078171-157078193 CAGTGAGACTGAAAAAAAAAAGG - Intergenic
1000783465 5:165513391-165513413 CAGTCTGAGTAACAAAAAGAGGG + Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002940873 6:1714652-1714674 CAGAGTGGGTAAAGGAAAGATGG + Intronic
1003366002 6:5475651-5475673 CAGTGTGACTACAGGAGTGAGGG - Intronic
1003992989 6:11505993-11506015 AAGTGTGACAAAATAAAAAATGG + Intergenic
1004291450 6:14371042-14371064 CAGTGTGACTGGTGAAAATAGGG + Intergenic
1004472848 6:15944428-15944450 GAGTGAGACCAAAGAAAGGAAGG + Intergenic
1004960399 6:20782160-20782182 TGGTGAGACTACAGAAAAGAGGG - Intronic
1005134516 6:22552516-22552538 CCGTGTGGCTAAAGACAGGAAGG - Intergenic
1005532620 6:26722738-26722760 CAGGGTGACTAAAGAGAGGGTGG - Intergenic
1005535784 6:26754865-26754887 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1005538175 6:26778927-26778949 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1005594441 6:27365879-27365901 CAATGTGAATAGAGCAAAGAAGG + Intergenic
1006204569 6:32328855-32328877 AAGAGTGACTAAAGAAAATGAGG - Intronic
1007127533 6:39440072-39440094 CCCTCTGACTAAAGAAGAGAGGG + Intronic
1007870808 6:45035677-45035699 CAGTGTCACTAAAATAAATACGG - Intronic
1007987775 6:46224474-46224496 CAGTTTGACCAAAACAAAGAAGG - Intronic
1008096671 6:47346104-47346126 CTGTGAGACTAAAGAAGAGAAGG - Intergenic
1008682534 6:53888829-53888851 CTGTGTAACAAAAGAAAAAATGG + Intronic
1009971916 6:70633800-70633822 AAGTGTGACAAAAGATAAAATGG + Intergenic
1010065018 6:71672500-71672522 CAGTGTGGCAAAAGAAAAAAAGG - Intergenic
1010439412 6:75875996-75876018 CAGGGTGACTGAAGGAGAGAAGG - Intronic
1011224207 6:85089030-85089052 AAGTGTGACTCAACTAAAGAAGG + Intergenic
1011665568 6:89629721-89629743 CACTGTGGCTAATGTAAAGATGG - Intronic
1012766890 6:103378095-103378117 GAGTGTGAATAAAGGAAGGACGG + Intergenic
1013364794 6:109428804-109428826 TAGTGTAACTAAAGAATAGGAGG + Intronic
1013472183 6:110475822-110475844 CAATTTGACAAATGAAAAGAGGG + Intronic
1014510704 6:122318174-122318196 CAGAGTTAGTAAAGCAAAGAAGG + Intergenic
1014529329 6:122540734-122540756 CAGTGAGACAAAAGTAAACAAGG - Intronic
1015138209 6:129898417-129898439 CAGTATGAGAAAAGAAAAGATGG + Intergenic
1016077676 6:139816645-139816667 CACTGTGACTATAGCAAGGAGGG - Intergenic
1016184920 6:141186436-141186458 CAGGGTGACTACAGATAAAAAGG + Intergenic
1016499110 6:144698947-144698969 CAGTGTGAATAGAGAACAGTTGG - Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017319225 6:153069217-153069239 CAGAATGAATAAAGAAAATATGG + Intronic
1017387714 6:153905566-153905588 CAGATTGAATAAAGAAAATATGG + Intergenic
1017841983 6:158229875-158229897 CTGTCAGACTAAAGAGAAGAAGG - Intergenic
1018038644 6:159902995-159903017 GAGTGTGACTGTGGAAAAGAAGG - Intergenic
1019763205 7:2829717-2829739 CACCGTCCCTAAAGAAAAGAGGG - Intronic
1021217041 7:17929183-17929205 CAGTGACAAGAAAGAAAAGATGG + Intronic
1021487770 7:21185888-21185910 CAGATTGACTAAAGAAAAAAGGG + Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022756464 7:33297381-33297403 CTGTATGACTAAAGAATATAAGG + Intronic
1022863962 7:34398176-34398198 CAGTGTGACTACTGCAAAGCAGG + Intergenic
1023096533 7:36666430-36666452 CAGCCTAACTAAGGAAAAGAGGG - Intronic
1023307915 7:38850276-38850298 CTGTGTTACTAAAGAAATCAAGG + Intronic
1023550172 7:41361641-41361663 CACTATGAGAAAAGAAAAGAGGG - Intergenic
1024387554 7:48770341-48770363 CAATTTGGCTAAAGCAAAGATGG - Intergenic
1024693156 7:51825031-51825053 CAATGTGACAAAAGGAAAAAAGG - Intergenic
1024991179 7:55235500-55235522 CATGGTGAGTCAAGAAAAGAGGG - Intronic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1027750907 7:82144452-82144474 GAATGTGATTAAATAAAAGATGG - Intronic
1027792295 7:82649905-82649927 CAGCGTGAGTGAGGAAAAGACGG + Intergenic
1027922883 7:84418552-84418574 CAGTTTGACTAAAACAAAGGAGG + Intronic
1028113843 7:86975041-86975063 CAGAGTGGATAAAGAAAAGTGGG + Intronic
1028659177 7:93248818-93248840 CAGTGGGACTAAAAAGAACACGG + Intronic
1030216319 7:107046297-107046319 CAGTGTAAATAAATAAAAGCTGG - Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030450244 7:109700080-109700102 CAGTGTGGCTAAAATAAAGCAGG + Intergenic
1030537577 7:110788511-110788533 GAGTATAAGTAAAGAAAAGAAGG - Intronic
1030799232 7:113828835-113828857 CAGTGTGACTACAGCAGCGAGGG + Intergenic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1031429903 7:121654772-121654794 ATGTGTGACTAAAGAAAATTTGG + Intergenic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1035851023 8:2919362-2919384 CATTTTGACTGAAGGAAAGAAGG - Intergenic
1037153888 8:15675813-15675835 CAGTGTGGATAAAGAAAATGTGG - Intronic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037288290 8:17324018-17324040 CAAAGGGACAAAAGAAAAGAAGG - Intronic
1038164834 8:25075478-25075500 CAGTGTCAGAAAAGAAAACATGG - Intergenic
1038622601 8:29158009-29158031 CAGTGTGCTCAAAGAACAGATGG - Intronic
1038795790 8:30708122-30708144 CAGTGTTATTAAGGAAAAGCGGG - Exonic
1039101327 8:33945144-33945166 CAGAGTGAATAAAGAAAATGTGG - Intergenic
1039820405 8:41129563-41129585 CAGTGAGAATGAAGAAAAGCAGG + Intergenic
1041410194 8:57545166-57545188 AACTGTGACCAAATAAAAGATGG + Intergenic
1042366872 8:67947246-67947268 CAGAGAGACTAAGAAAAAGAAGG + Intergenic
1042497860 8:69475447-69475469 CAGTGGGAATAAGGAAAGGATGG + Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1042860940 8:73313464-73313486 CTGTGTGATTAAAAAAAAAAAGG - Intronic
1043378163 8:79673077-79673099 AAGTGTGGATACAGAAAAGAAGG - Intergenic
1045135663 8:99214705-99214727 TAGTGTGACAGAAGTAAAGATGG - Intronic
1045206047 8:100042029-100042051 CAATGTGACTCAGGAAAAAAAGG + Intronic
1046675056 8:117098728-117098750 CAGTATTACCAAAGAACAGAGGG - Intronic
1047160232 8:122369925-122369947 CAGTGTGACTAGAACAAAGCAGG - Intergenic
1048434917 8:134407232-134407254 CAGGATGAGTCAAGAAAAGAAGG - Intergenic
1050307222 9:4317073-4317095 CACTTAGAGTAAAGAAAAGATGG + Intronic
1051061277 9:13047624-13047646 CAATGTGATTCGAGAAAAGAGGG - Intergenic
1051139936 9:13967542-13967564 CACTGTGACTGAAGACAAGCAGG + Intergenic
1051189432 9:14495641-14495663 CAGTGTAATTAAAAATAAGAAGG + Intergenic
1051593671 9:18801742-18801764 CAGACTGGCTAAAGAAAACATGG - Intronic
1052984071 9:34472952-34472974 CAGTGTGACTACAGAATTGTGGG - Intronic
1057950875 9:99368277-99368299 CAATCTGATTAAAGAAAGGAAGG + Intergenic
1186378964 X:9036664-9036686 CAGTGTGAGTAAAGCATGGAAGG + Intronic
1186590559 X:10925681-10925703 CACTGTGGCTACAGAAAACAGGG - Intergenic
1187920911 X:24200435-24200457 CTGTGTGATGAAACAAAAGAAGG + Intronic
1187986649 X:24820451-24820473 CAGTATGCATAAAGAAAAGGAGG - Intronic
1188052102 X:25500237-25500259 CAGTATAAATAATGAAAAGATGG + Intergenic
1188634751 X:32415289-32415311 CAGTGTGGCTTAAGAAATGATGG + Intronic
1188793032 X:34427083-34427105 CAGTGGGATTAAAGAAACAATGG + Intergenic
1190553951 X:51615053-51615075 CAGTGTGACTAGGAAAAAGTGGG - Intergenic
1192247154 X:69383140-69383162 AAGAGTGACTAAAGAAAGAAAGG + Intergenic
1193407290 X:81117658-81117680 AATGGTGACAAAAGAAAAGAAGG - Intronic
1193790443 X:85809560-85809582 CAATGTGTCTAAATAAAAAATGG + Intergenic
1194082376 X:89485227-89485249 CACTGACACTAAAGAAAAGGAGG - Intergenic
1194351526 X:92828379-92828401 GAGTATGACTAGACAAAAGATGG - Intergenic
1194792854 X:98172571-98172593 CTTTATGAGTAAAGAAAAGAAGG - Intergenic
1194855812 X:98927245-98927267 CAGAGTGAATAAAGAAAATGTGG + Intergenic
1195568802 X:106376543-106376565 CAGACTGAATAAAGAAAATATGG + Intergenic
1197089313 X:122518270-122518292 CTGATTGAATAAAGAAAAGATGG + Intergenic
1198024789 X:132694461-132694483 CAGTGTGATTAGAGAAAAATGGG + Intronic
1198132770 X:133715116-133715138 CAGTGTGACTAGAATAAAGCAGG + Intronic
1198332158 X:135631893-135631915 CAGTGTTACAAAAGAAGATAAGG + Intergenic
1198334088 X:135650446-135650468 CAGTGTGACAAAAGAAGATGAGG - Intergenic
1198414885 X:136409908-136409930 CAGTCTGACTATAGAACACAAGG - Intronic
1198427297 X:136532919-136532941 CAGTGAGGCTAAAGAAAGGGTGG - Intronic
1198514201 X:137388073-137388095 CAGTGTAGCTAAATAGAAGAAGG + Intergenic
1198977666 X:142355077-142355099 TAGTGTCATGAAAGAAAAGAAGG - Intergenic
1199897192 X:152136897-152136919 CACTGTGTCTGTAGAAAAGAGGG + Exonic
1200330085 X:155286354-155286376 CAGACTGAATAAAGAAAAGGTGG - Intronic
1200435025 Y:3141108-3141130 CACTGACACTAAAGAAAAGGAGG - Intergenic
1200521828 Y:4218556-4218578 CAGTCTCACTAAAGATCAGATGG - Intergenic
1200659847 Y:5945071-5945093 GAGTATGACTAGACAAAAGATGG - Intergenic