ID: 948190095

View in Genome Browser
Species Human (GRCh38)
Location 2:236051687-236051709
Sequence TAAAAGCGACCCTGGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948190082_948190095 23 Left 948190082 2:236051641-236051663 CCAAAGAGCAGAAGCAGGAAGGG 0: 1
1: 0
2: 3
3: 56
4: 511
Right 948190095 2:236051687-236051709 TAAAAGCGACCCTGGGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 115
948190080_948190095 24 Left 948190080 2:236051640-236051662 CCCAAAGAGCAGAAGCAGGAAGG 0: 1
1: 0
2: 8
3: 44
4: 441
Right 948190095 2:236051687-236051709 TAAAAGCGACCCTGGGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 115
948190088_948190095 -8 Left 948190088 2:236051672-236051694 CCAGGGCTGGCACCTTAAAAGCG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 948190095 2:236051687-236051709 TAAAAGCGACCCTGGGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 115
948190087_948190095 0 Left 948190087 2:236051664-236051686 CCTCTGAGCCAGGGCTGGCACCT 0: 1
1: 1
2: 3
3: 58
4: 428
Right 948190095 2:236051687-236051709 TAAAAGCGACCCTGGGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948190095 Original CRISPR TAAAAGCGACCCTGGGGGCA GGG Intronic
901069626 1:6510657-6510679 TGATAGTGACCCTGGGGGCGGGG + Intronic
901080825 1:6582963-6582985 TAAAATAGCCCCTGGGGGCTGGG - Intronic
901081008 1:6584207-6584229 TAAAATAGTCCCTGGGGGCTGGG - Intronic
901092100 1:6648749-6648771 TAAAAGCCGCCTCGGGGGCAGGG - Intronic
901795876 1:11679516-11679538 AAAAAGTTACCCTGGGGGCATGG - Intronic
905734384 1:40315729-40315751 TGCAAGCGACCCTGGGAGCGGGG + Intronic
907463049 1:54616997-54617019 TAAAAATGACCCTGTGGGCTGGG - Intronic
907642473 1:56204991-56205013 TAAAAGAGAGCCTAGTGGCATGG - Intergenic
908102899 1:60809754-60809776 TCAAAGGGGTCCTGGGGGCAAGG - Intergenic
909656624 1:78040190-78040212 TAAAAACAGCCCTGGGGGCCGGG + Intronic
913507866 1:119534683-119534705 TAAAAGCAGCCCTGGAGGCCAGG + Intergenic
914705907 1:150169683-150169705 TAACAACAACCCTGGGGGCCGGG - Intergenic
917277437 1:173345961-173345983 CAAGAGTGACCCTGAGGGCAGGG + Intergenic
918762516 1:188430042-188430064 TAAAAGCAACCCTAGGGAAAGGG + Intergenic
921153838 1:212422789-212422811 TTAAAGTGACCATGGGGGCTGGG + Intergenic
923337703 1:232984726-232984748 AAAGAGCGGCCCTGGGGGGAAGG + Intronic
1062966141 10:1609137-1609159 GAAAAGCGTCTCTGGGAGCAGGG - Intronic
1070692211 10:78535717-78535739 TAAAAGAGTGTCTGGGGGCAGGG - Intergenic
1071294751 10:84211566-84211588 TGAAAGCAACCCTCAGGGCATGG + Intronic
1071562105 10:86652673-86652695 CAGAGGCCACCCTGGGGGCAGGG - Intergenic
1078023138 11:7671920-7671942 TCTAAGTGACCTTGGGGGCAGGG + Intronic
1081331045 11:41800730-41800752 TAAAAAAGACCCTGTGGGCCGGG + Intergenic
1084525630 11:69696175-69696197 TAAAAGCTCCCCTGTGGGCCGGG - Intergenic
1086899239 11:92347598-92347620 TACCAGAGACCTTGGGGGCAGGG - Intergenic
1089183057 11:116596085-116596107 TCACAGCAACCCTGGGAGCAAGG + Intergenic
1090629150 11:128631240-128631262 TAAAAGCTACCATAGAGGCAGGG + Intergenic
1104561990 12:129854002-129854024 GAAAAGCCACCTTGGGGGGATGG + Intronic
1104801631 12:131558655-131558677 AAACAGCTACCCTGGGGCCAGGG - Intergenic
1116272466 14:42789097-42789119 TAACAGCGACTATGGGGACAGGG + Intergenic
1126749999 15:51866947-51866969 GAAAAGCTTCCCTGGGGGAATGG + Intronic
1137063500 16:35812998-35813020 TAAATTCGACCCTGGAGGCATGG + Intergenic
1138332899 16:56229501-56229523 TAAAAACAACAATGGGGGCAGGG - Intronic
1138445567 16:57061137-57061159 TAAAGGAGACCCTGCGGGTAAGG + Intronic
1140354998 16:74297665-74297687 TAAATACGACCCTGGGGCCGGGG - Intronic
1140355024 16:74297803-74297825 TAGATACGACCCTGGGGGCGGGG - Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1147499655 17:40950628-40950650 TAAAAGGGACCCTGTGGGGGTGG + Intergenic
1147553255 17:41460111-41460133 CAGTAGCGGCCCTGGGGGCAGGG + Exonic
1152650606 17:81490850-81490872 GAAGAGAGACCCAGGGGGCAAGG - Intergenic
1152684475 17:81687340-81687362 TGACAGCGACCCTGGGGCCTGGG + Intronic
1154035751 18:10800303-10800325 GAAATGCGACCCTGAGTGCAGGG + Intronic
1156837854 18:41576773-41576795 TCAAAGTGACCCTGGGCTCATGG - Intergenic
1157236553 18:45970056-45970078 TAAAAGGGACAATGGGAGCAGGG + Intergenic
1160411408 18:78677756-78677778 TACTATAGACCCTGGGGGCAGGG - Intergenic
1160923140 19:1529836-1529858 TAAAGGTGATCCTGGGGGCTGGG - Intronic
1161295819 19:3519747-3519769 AAAACCCCACCCTGGGGGCAGGG - Intronic
1162141213 19:8586534-8586556 TAACAGGGAGACTGGGGGCAAGG - Intronic
1165015296 19:32876086-32876108 TAAAAGCAGCCCTGGGGAAATGG - Intergenic
1165879401 19:39031914-39031936 CAGAAGCGGCCCAGGGGGCAAGG + Exonic
1166536847 19:43580083-43580105 TAAAGGCGACTTTGGGTGCAGGG + Intronic
1166825642 19:45607328-45607350 TGAGAGTGACCCTGGGGGCGCGG + Intronic
1167564272 19:50246439-50246461 TAAAAGCTACACTGGAGGCGGGG - Intronic
925430870 2:3791792-3791814 TCTAAGCCACCCTGTGGGCAGGG + Intronic
925992939 2:9268667-9268689 GCAAAGCCACCCTGGGGGCACGG + Intronic
928074354 2:28249382-28249404 TAAAAGCTACCCTTAGGGCAGGG - Intronic
929049763 2:37826170-37826192 TCACAGTGACCCTGGGGGGAGGG + Intergenic
929916403 2:46139849-46139871 TAAAAGCTGCCCTTGGAGCAGGG - Intronic
930965088 2:57313334-57313356 TAAAAGCTACCCTGCAGTCAGGG - Intergenic
933598985 2:84310625-84310647 TATAAGTGATCCTGAGGGCAGGG - Intergenic
936980202 2:118256730-118256752 CAAGACTGACCCTGGGGGCAGGG + Intergenic
937032989 2:118756375-118756397 TTAAAGGGACCTTAGGGGCAAGG - Intergenic
939264866 2:139858457-139858479 TAAAAGGAGCCCTGGGGCCATGG - Intergenic
942378625 2:175363429-175363451 TGCAAGCGATCTTGGGGGCAGGG + Intergenic
943547067 2:189293788-189293810 TAAAAGCAACCCAGAGGGCCAGG + Intergenic
946824068 2:223658082-223658104 TAAAAGCTTCCCTGGTGGCCAGG - Intergenic
947707753 2:232290365-232290387 TAAAGGAGACCCTGGGATCAGGG + Intronic
947725938 2:232400659-232400681 TAAAAGTGACCCTGTGGGGTTGG + Intergenic
948190095 2:236051687-236051709 TAAAAGCGACCCTGGGGGCAGGG + Intronic
948385839 2:237580163-237580185 TAACAGCCACCCTGGGTGAAGGG - Intronic
1169151551 20:3293387-3293409 TAAAATCCACTCTGGGGGCCGGG + Intronic
1170032810 20:11959980-11960002 CAAAAGGGACCCTGGGGGTCTGG + Intergenic
1170327385 20:15171472-15171494 TAAAAGTGACTATGGGGTCAGGG - Intronic
1170971777 20:21123786-21123808 AAAAACTAACCCTGGGGGCATGG + Intergenic
1172806612 20:37616436-37616458 TGAAAGGGACCCAGGGGGAATGG + Intergenic
1173221555 20:41136795-41136817 TGAAAGCCACCCTGGCAGCAGGG + Intergenic
1174669407 20:52292486-52292508 TAAAAGAGTCCCTGGGGCTATGG + Intergenic
1180008276 21:45033235-45033257 TGAAAGCTGCCCCGGGGGCAGGG - Intergenic
1181406460 22:22688377-22688399 AAAAAGCGCCCATGGTGGCAGGG - Intergenic
1181883143 22:25997457-25997479 TAAGAACCACCCTGGGGTCAGGG - Intronic
955117343 3:56018586-56018608 GAGAAGGGACCCTGGGGGCCAGG + Intronic
956462667 3:69486938-69486960 AACAAGAGACCTTGGGGGCAGGG - Intronic
961656203 3:128443386-128443408 TAAAACAGACCCAGTGGGCAGGG + Intergenic
964359333 3:155878067-155878089 TAAAAGAGGCCCTAGGGGCTGGG - Intronic
965750640 3:171971549-171971571 TAAAAGAGACCCCAGGGGCTGGG + Intergenic
969600627 4:8173996-8174018 CAGAAGGGACTCTGGGGGCAGGG + Intergenic
976627936 4:87207133-87207155 TAAAAGCAACCCTGGTGACCAGG - Intronic
982711424 4:158761986-158762008 TAACAGAAACACTGGGGGCAAGG + Intergenic
985638962 5:1054297-1054319 TCAAAGCGTCCCTGGCGGCCTGG + Intronic
989908945 5:49599503-49599525 TGAAAACGCCCCTGGAGGCAGGG + Intergenic
990186422 5:53214768-53214790 TAAAAGCTACTCTGGAGGCTGGG - Intergenic
991640504 5:68747044-68747066 TTAGAGCGAAGCTGGGGGCAGGG - Intergenic
992811241 5:80390706-80390728 TAAAAGGCACCCTGCTGGCATGG + Intergenic
996800975 5:127402564-127402586 CCAAAGCGACCCTCGGGGCAAGG - Exonic
1001276085 5:170352777-170352799 TGGAAGGGACCCTGGTGGCAGGG - Intergenic
1002861091 6:1080276-1080298 TAAAAGCTACCCAGGGGTCCTGG - Intergenic
1003038448 6:2665398-2665420 TAAAAGGCACCCTGCTGGCATGG + Exonic
1003570412 6:7252862-7252884 AAAAAGCAACACTGGGGGCTGGG + Intergenic
1004026868 6:11827464-11827486 GACAAGGGACCCTGGGGGCAGGG - Intergenic
1006782753 6:36643320-36643342 TAGAAGCCACCCTGGGCCCACGG + Intergenic
1006918875 6:37614708-37614730 TAAAAGCCAGGCTGGGGGCAGGG + Intergenic
1009862416 6:69351385-69351407 TAAAAACGTATCTGGGGGCAGGG - Intronic
1021021183 7:15600154-15600176 TTAAAGGGACCATGGTGGCAAGG + Intergenic
1026313228 7:69206468-69206490 TAAATGCAAGCCTGGGGGTAGGG + Intergenic
1027382373 7:77624732-77624754 TAAAAGAGACTCTGTGGGCCAGG - Intronic
1029189306 7:98760561-98760583 GAAAAGCGGTCCTGGAGGCAAGG + Intergenic
1029196732 7:98810656-98810678 GAAAAGCCACCCAGGAGGCAAGG - Intergenic
1030595054 7:111527900-111527922 TAAAAGCTACCCTGGAAACAAGG + Intronic
1033247677 7:139731716-139731738 TTAAAGAGAGCCTGGGGGAAAGG - Intronic
1036645937 8:10611495-10611517 GAAGAGCGCCTCTGGGGGCAGGG + Exonic
1037139923 8:15507279-15507301 TAAAAAGGACCCTGAGGCCAAGG - Intronic
1042397737 8:68311304-68311326 AAAAAGCTAACCTGGGGGCCAGG - Intronic
1044817594 8:96129214-96129236 TTAAAGCCACCCTGGGGGTGCGG - Intergenic
1047655755 8:126975121-126975143 TAAAAGAGACCCTTGGGTCATGG - Intergenic
1049430643 8:142562466-142562488 TAGAGGAGACTCTGGGGGCAGGG - Intergenic
1050900454 9:10941409-10941431 TAAAAGTGAAGCTGGGGACATGG + Intergenic
1051543955 9:18253295-18253317 TGAAAGGGACCCTGGGTGGATGG + Intergenic
1059030466 9:110688059-110688081 TAAAAGCAACACTGAGGGCTGGG - Intronic
1061659368 9:132118451-132118473 GAAGAGCAACCCTGGGAGCAGGG + Intergenic
1062492508 9:136813207-136813229 TAAAAGGGAAACTGGGGGCAGGG - Intronic
1062738643 9:138153298-138153320 TAAAAAGGACCCCAGGGGCAGGG - Intergenic
1187107585 X:16260225-16260247 TAAAAGAGATCCTGAGGGCATGG - Intergenic
1190246118 X:48691466-48691488 TAAAAGGGACTTTGGGGGAAAGG - Intergenic
1196750220 X:119109226-119109248 TAAAAGCAACCCAAGGGCCATGG + Intronic
1197775116 X:130113842-130113864 GAAAAGTGAGGCTGGGGGCAGGG - Intergenic
1198625276 X:138565408-138565430 TAAAAGCCTCAGTGGGGGCAGGG + Intergenic
1199144346 X:144348152-144348174 ACAAAGCGACCATGGTGGCAAGG - Intergenic