ID: 948190876

View in Genome Browser
Species Human (GRCh38)
Location 2:236057600-236057622
Sequence CCTGACCCAACACTGCGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948190865_948190876 21 Left 948190865 2:236057556-236057578 CCCCTCAACCCCCGTGTTTCACG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190867_948190876 19 Left 948190867 2:236057558-236057580 CCTCAACCCCCGTGTTTCACGTA 0: 1
1: 0
2: 0
3: 7
4: 63
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190872_948190876 -5 Left 948190872 2:236057582-236057604 CCACATCCTGCTCATGTCCCTGA 0: 1
1: 0
2: 3
3: 36
4: 368
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190863_948190876 23 Left 948190863 2:236057554-236057576 CCCCCCTCAACCCCCGTGTTTCA 0: 1
1: 0
2: 0
3: 15
4: 194
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190869_948190876 12 Left 948190869 2:236057565-236057587 CCCCGTGTTTCACGTAACCACAT 0: 1
1: 0
2: 1
3: 2
4: 41
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190864_948190876 22 Left 948190864 2:236057555-236057577 CCCCCTCAACCCCCGTGTTTCAC 0: 1
1: 0
2: 0
3: 19
4: 142
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190861_948190876 25 Left 948190861 2:236057552-236057574 CCCCCCCCTCAACCCCCGTGTTT 0: 1
1: 0
2: 2
3: 30
4: 308
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190870_948190876 11 Left 948190870 2:236057566-236057588 CCCGTGTTTCACGTAACCACATC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190868_948190876 13 Left 948190868 2:236057564-236057586 CCCCCGTGTTTCACGTAACCACA 0: 1
1: 0
2: 0
3: 3
4: 36
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190866_948190876 20 Left 948190866 2:236057557-236057579 CCCTCAACCCCCGTGTTTCACGT 0: 1
1: 0
2: 0
3: 1
4: 43
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190871_948190876 10 Left 948190871 2:236057567-236057589 CCGTGTTTCACGTAACCACATCC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
948190862_948190876 24 Left 948190862 2:236057553-236057575 CCCCCCCTCAACCCCCGTGTTTC 0: 1
1: 0
2: 1
3: 30
4: 242
Right 948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948190876 Original CRISPR CCTGACCCAACACTGCGTTT TGG Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
918340987 1:183567790-183567812 CCTGGCCCAACACTGGTTCTAGG - Intronic
920654340 1:207864511-207864533 CCTCACTCAACACTGGGCTTGGG + Intergenic
922014735 1:221633861-221633883 CCTGAGTCAACACTGCTCTTGGG + Intergenic
922788516 1:228296026-228296048 CCTGCACCACCACTGCATTTTGG - Intronic
923743237 1:236675072-236675094 ACTGAGACAACACTGCATTTAGG + Intergenic
1063917481 10:10898148-10898170 CCTGACCCACCATTGTATTTTGG + Intergenic
1068025310 10:51635505-51635527 CCTGACCCACAAGTGAGTTTTGG - Intronic
1070376240 10:75833788-75833810 CCTGTCCCATCACTGTATTTTGG - Intronic
1071422122 10:85511217-85511239 CCTGACTGAACACTTAGTTTAGG + Intergenic
1071884071 10:89930565-89930587 CCTGTCCCACCACTGTATTTTGG + Intergenic
1072332491 10:94367624-94367646 CCTGGCCTACCACTGCTTTTGGG - Intergenic
1081587429 11:44397012-44397034 CCTAACCTAATACTGCATTTAGG - Intergenic
1088210258 11:107446933-107446955 CCTGACCTAACACAGCCTTCAGG + Intronic
1089942309 11:122431280-122431302 CCTGTCCCACCATTGTGTTTTGG + Intergenic
1098505458 12:71244869-71244891 ACTGACCTAACACTGTGCTTGGG + Intronic
1100237553 12:92675624-92675646 CCTGACTCACCACTGCGTCAGGG - Intergenic
1100903657 12:99272980-99273002 CCTGTCCCACCACTGCATGTTGG - Intronic
1101300654 12:103476608-103476630 CCTTACACAACACTTCTTTTAGG - Intronic
1101969547 12:109303358-109303380 CTTGAACCCACACTGCGTGTGGG - Intronic
1105729585 13:23199809-23199831 ACTGACCACACACTGCTTTTCGG - Intronic
1112112064 13:96312109-96312131 TCTGAACCAACACTGCCTTTTGG + Intronic
1113258806 13:108537145-108537167 CCTCACCCACCTCTGCATTTTGG + Intergenic
1113931005 13:113968893-113968915 CCTGACCCAGCACAGAGTTCTGG + Intergenic
1115618916 14:35121891-35121913 CCTGTCCAAACAGTGAGTTTTGG - Exonic
1117989964 14:61423689-61423711 CCTGAACCAGCACTCCCTTTAGG - Intronic
1118103361 14:62630180-62630202 CCTGTTCCAACTCTGCATTTAGG + Intergenic
1120415864 14:84217153-84217175 CCTGTTCCATCATTGCGTTTTGG + Intergenic
1122200355 14:100118824-100118846 TCTGACTCACCACTGTGTTTGGG + Intronic
1125136140 15:36345467-36345489 CCTGTCCCAACATTGTATTTTGG + Intergenic
1128230883 15:66034158-66034180 CCTGTCCCACCATTGCATTTTGG + Intronic
1129811393 15:78513461-78513483 CCAGACACATCACTGCATTTTGG + Intronic
1131546411 15:93319502-93319524 ACTGACAAAACACTGCATTTTGG - Intergenic
1132743157 16:1426014-1426036 CCTGGCCCCAGACTGTGTTTGGG + Intergenic
1136109853 16:28057881-28057903 CATGACCCATCACAGGGTTTGGG - Intronic
1139030532 16:62875654-62875676 CCTGTCCCACCACTGTATTTTGG - Intergenic
1139208767 16:65055504-65055526 CCTGTCCCACCACTGTATTTTGG + Intronic
1143357669 17:6342591-6342613 CCTGACCCAGCCCTCTGTTTAGG - Intergenic
1147338846 17:39742198-39742220 CCTGACCTCACACGGCGGTTAGG - Intronic
1147479276 17:40743853-40743875 CCTGACCAAACACTACGTGAAGG - Intergenic
1155455286 18:26005298-26005320 CCTGTCCCACCACTGTATTTTGG + Intergenic
1159585146 18:70276976-70276998 ACTGACCCCACCCTGCTTTTTGG + Intergenic
1162708973 19:12577700-12577722 CCTGACCCATCCCTGCTGTTGGG + Exonic
927909599 2:26887482-26887504 CCAAGCCCAACACTGTGTTTTGG - Intronic
937122377 2:119449777-119449799 CCTGGCCCAGCACTGCTTTTCGG + Intronic
943278912 2:185905294-185905316 CCTGACACATCACTGAGTTAAGG + Intergenic
943407285 2:187505774-187505796 CCTGACCCCAGACTGGTTTTGGG - Intronic
948190876 2:236057600-236057622 CCTGACCCAACACTGCGTTTTGG + Intronic
1178152648 21:29813328-29813350 ACTGAACCAACACTTAGTTTGGG - Intronic
1180090646 21:45532242-45532264 CCTGCCCCAACACTGCCTGGTGG + Intronic
1181805219 22:25370484-25370506 ACAGACGCAACACAGCGTTTAGG + Intronic
1181929024 22:26384431-26384453 CCTGTCCCACCATTGTGTTTTGG - Intergenic
1182537881 22:31019519-31019541 CCTGTCCAACCACTGCATTTTGG - Intergenic
956401732 3:68887122-68887144 CCTGTTCCATCACTGTGTTTTGG - Intronic
956781186 3:72604781-72604803 CCTGACCCATGCCTTCGTTTTGG - Intergenic
957790708 3:84937352-84937374 CCTGTCCCACCATTGCATTTTGG + Intergenic
959509019 3:107189081-107189103 CCTGTCCCACCACTGCATTTTGG - Intergenic
960709713 3:120515646-120515668 TCTTACTCAACACTGCTTTTGGG - Intergenic
962687963 3:137865710-137865732 CCTGTCCCATCATTGCATTTTGG - Intergenic
963146532 3:142000717-142000739 CCTGTCCCATCATTGCATTTTGG - Intronic
966393369 3:179476158-179476180 CCTGTCCCAACATTGCATTTTGG - Intergenic
968975353 4:3819537-3819559 CCTGTCCCACCATGGCGTTTTGG - Intergenic
970580560 4:17470862-17470884 CCTGACCCAGCCCAGCCTTTGGG + Intronic
973255264 4:48105260-48105282 CTTGAACAAACACTGAGTTTTGG + Intronic
973659524 4:53088589-53088611 CCTGTCCCACCACTGTATTTTGG + Intronic
975981109 4:80160345-80160367 CCTGTCCCACCATTGTGTTTTGG - Intergenic
979977120 4:127210561-127210583 GCTAACCCAACACTGCCTTCGGG + Intergenic
984104776 4:175531860-175531882 ACTCACCTAACACTGAGTTTCGG - Intergenic
987667679 5:20965818-20965840 CCTCACCCACCATTGCATTTTGG - Intergenic
988068133 5:26250118-26250140 CCTGTCCCAACATTGCAGTTTGG - Intergenic
989315393 5:40072006-40072028 CCTGTCTCAACATTGTGTTTTGG + Intergenic
990637632 5:57747117-57747139 CATGACCCTACTCTGCATTTGGG + Intergenic
991321883 5:65383370-65383392 CCTGACCCACCATTGTATTTTGG - Intronic
991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG + Intergenic
993358761 5:86947063-86947085 CCTGTCCCACCATTGCATTTTGG - Intergenic
994541703 5:101108018-101108040 CCTGACCAACTACTGCATTTTGG - Intergenic
994592621 5:101791339-101791361 CCTGTCCCATCATTGCATTTTGG - Intergenic
1006174549 6:32114144-32114166 CCTCACCCATTACTGTGTTTGGG - Intronic
1006381806 6:33702934-33702956 CCTGACCCATTCCTGCGTTCAGG + Intronic
1013212841 6:108001997-108002019 CCTGACCTAACACCCCGCTTGGG - Intergenic
1017045363 6:150342243-150342265 CCTGACCCAACTGTGCCTTCTGG - Intergenic
1017309595 6:152959827-152959849 CCTGTCCCACCACTGTATTTTGG + Intergenic
1018009222 6:159654664-159654686 CCTGAACCCACTCTGCTTTTAGG + Intergenic
1019622731 7:2000496-2000518 CCGGACCCAACAGTGAGGTTAGG - Intronic
1020188434 7:5975943-5975965 CCTGGCCTAAAACAGCGTTTTGG - Intronic
1020294481 7:6748826-6748848 CCTGGCCTAAAACAGCGTTTTGG + Intergenic
1029215431 7:98945140-98945162 TCTGCCCCATCACTGTGTTTAGG + Intronic
1032475028 7:132205711-132205733 CCTGCCCCAGCACTGCCTCTAGG - Intronic
1048181721 8:132201489-132201511 CCTGTCCCACCATTGCATTTTGG - Intronic
1050057556 9:1671791-1671813 CCTGTCCCATCATTGCATTTTGG - Intergenic
1052730193 9:32276355-32276377 CCTGTCCCACCACTGCATTTTGG - Intergenic
1053064213 9:35056248-35056270 CCTGACCAAAGACTGTGTTGGGG - Exonic
1059693237 9:116706610-116706632 CCTTACCCAAAACTTGGTTTAGG - Intronic
1061160552 9:128891608-128891630 CCAGACCCAACACTGCCTTCTGG + Intronic
1194505957 X:94733611-94733633 TCTGTCCCAACATTGCATTTTGG + Intergenic
1196314602 X:114208636-114208658 CCTGCCCCACCATTGTGTTTTGG - Intergenic
1197266435 X:124378843-124378865 AATGACCCCACACTGCATTTAGG + Exonic
1197931356 X:131699413-131699435 CCTGTCCCACCACTGTATTTTGG + Intergenic
1198125507 X:133639867-133639889 CCTGAACAAACACTCCTTTTTGG + Intronic