ID: 948191291

View in Genome Browser
Species Human (GRCh38)
Location 2:236061327-236061349
Sequence GACCCAGCCATTCCTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1024
Summary {0: 1, 1: 0, 2: 7, 3: 112, 4: 904}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948191288_948191291 8 Left 948191288 2:236061296-236061318 CCTCGAAAAGTTAAACCTAGAGT 0: 1
1: 4
2: 113
3: 507
4: 1251
Right 948191291 2:236061327-236061349 GACCCAGCCATTCCTCCCCCAGG 0: 1
1: 0
2: 7
3: 112
4: 904
948191289_948191291 -7 Left 948191289 2:236061311-236061333 CCTAGAGTTACCGTATGACCCAG 0: 1
1: 5
2: 19
3: 56
4: 222
Right 948191291 2:236061327-236061349 GACCCAGCCATTCCTCCCCCAGG 0: 1
1: 0
2: 7
3: 112
4: 904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948191291 Original CRISPR GACCCAGCCATTCCTCCCCC AGG Intronic
900131242 1:1088225-1088247 GACCCCCGCATGCCTCCCCCAGG + Intronic
900276853 1:1835729-1835751 GATCCAGCCATTCCACCGCTAGG - Intronic
900355462 1:2260027-2260049 GATCCAGCCATTCCACACCTAGG - Intronic
900393129 1:2442493-2442515 GACTCAGCCTTTCCTCTCCCTGG + Intronic
900470199 1:2849800-2849822 GACCCAGCCATTCCACTCCCAGG + Intergenic
900470672 1:2853135-2853157 GACCCAACCATTCCACTCCTGGG - Intergenic
900553284 1:3267512-3267534 GACCCAGCCATCCCAGACCCAGG - Intronic
900912222 1:5606838-5606860 GACCCAGCAATTCCACTCCTTGG - Intergenic
901073778 1:6539277-6539299 GACCCAGCAATTCCACTCCTCGG + Intronic
901198345 1:7452873-7452895 AACCCAGCCATTCCACTCCTAGG - Intronic
901241932 1:7699531-7699553 GACCCAGCCATTCCATTCCTAGG - Intronic
901377812 1:8852221-8852243 TACCCAGCAATTCCACACCCAGG + Intergenic
901522816 1:9798214-9798236 GACCCAGATATTCCACTCCCAGG + Intronic
901640185 1:10689108-10689130 GGCTCAGCCATTTCTCCACCTGG - Intronic
901943114 1:12679028-12679050 GACCCAGCAATTCCACTCCTAGG - Intergenic
902146677 1:14407255-14407277 GACCCAGCAAGTCCTCTCCCAGG - Intergenic
902368502 1:15991882-15991904 TACCCAGCCAGACCTCCCTCTGG - Intergenic
902591415 1:17477654-17477676 GACCCATTCGTTCCTCTCCCGGG + Intergenic
902750333 1:18504343-18504365 GATCCAGCAATTCCACTCCCAGG + Intergenic
902817857 1:18926341-18926363 GCCCTGGCCATCCCTCCCCCTGG - Intronic
902885302 1:19400471-19400493 GACCCAGGAATTCCTCATCCAGG + Intronic
902952980 1:19902026-19902048 GACCCAGCAATTCCACTCCGAGG - Intronic
903103884 1:21057139-21057161 GACCCAGCCATTCCACTCCTAGG + Intronic
903164529 1:21510818-21510840 GCCCCAGCCATCCCACTCCCTGG + Intronic
903205582 1:21780042-21780064 GACCCAGTAATTCCACTCCCAGG + Intronic
903753793 1:25646930-25646952 GACCCAGCAATCCCACTCCCAGG - Intronic
903991743 1:27276239-27276261 GACCCAGCAATTCCACCCTTCGG - Intronic
904320680 1:29696017-29696039 CACCCAGCCCCTCCTCCTCCTGG - Intergenic
904852168 1:33467459-33467481 GAGCCAGCCAGCCCTCACCCAGG - Intergenic
904871639 1:33622810-33622832 GACCCAGCAATTCCACTCCTAGG + Intronic
904874401 1:33643155-33643177 GACCCAGCCCTGCCTCCCTGTGG + Intronic
905265480 1:36751609-36751631 GACCCAGCAATTCTACCTCCAGG + Intergenic
905509011 1:38503608-38503630 AACACAGCCACTCCTCCCACTGG + Intergenic
905546751 1:38806129-38806151 GACCCAGCAATTCCACTCCCAGG + Intergenic
905927159 1:41759555-41759577 GACCCAGCAATTCCACTCCTAGG - Intronic
906538536 1:46566502-46566524 GACCCAGCAATTCCACTCCTAGG - Intronic
907199339 1:52712850-52712872 GACCCAGCAATTCCACTCCTAGG + Intergenic
907324816 1:53630364-53630386 GGCCCAGGAATTCCTCCCCTTGG - Intronic
907513794 1:54980783-54980805 GACCGAGCCAGGCCTCACCCCGG - Exonic
907556439 1:55348534-55348556 TCCCCAGCCATGCCTCCCTCAGG - Intergenic
907726074 1:57021811-57021833 GACCAAGTCATTCCTCTGCCTGG + Intronic
908069222 1:60440161-60440183 GACCCAGCCATCCCTCTACTGGG + Intergenic
909352827 1:74673996-74674018 TACCCAGTCCTTCCTTCCCCAGG - Intergenic
910263046 1:85309967-85309989 GATCCAGCAATTCCACTCCCTGG - Intergenic
911073711 1:93852496-93852518 GACCCAGCAATTCCACTCCTAGG + Intergenic
911258934 1:95664111-95664133 GACCCAGCAATTCCTCTTCTGGG + Intergenic
912045582 1:105451039-105451061 GACCCAGCCATTACACTCCTGGG + Intergenic
912433477 1:109642197-109642219 GACCCAGCAATTCCCCTCCCAGG + Intergenic
912510021 1:110183098-110183120 GACCCAGCCATTCCACTCCTAGG + Intronic
913173353 1:116252063-116252085 GACCCAGCAATTCCACTCCTAGG + Intergenic
913363328 1:118006601-118006623 GACCCAGCAATTCCACTCCTAGG - Intronic
913553131 1:119936323-119936345 GACCCAGAGATTCCTGCCACTGG - Intronic
914355795 1:146883142-146883164 GACCCAGCCATTCCACAACTAGG - Intergenic
914414112 1:147462489-147462511 GACCCAGAAATTCCACCCCCAGG - Intergenic
914892072 1:151633998-151634020 GACCCAGCAATTCCACTCCTAGG - Intronic
915247602 1:154567751-154567773 GACCCAGCGTTTCCGCCTCCGGG + Intergenic
915287693 1:154863207-154863229 GACCCTGTCATTCCACCCCCAGG - Intronic
915608943 1:156975026-156975048 GACCCAGCAGTTCCACTCCCAGG - Intronic
915613144 1:157011957-157011979 GACCCAGCAATTCCACTCCTAGG + Intronic
916101650 1:161398273-161398295 GACTCAGCCATTCCACTCCTAGG - Intergenic
916300806 1:163271805-163271827 GACCCAGCAATTCTACTCCCAGG - Intronic
916407964 1:164516093-164516115 GTCCCAACCATTTCTCCTCCTGG - Intergenic
917151472 1:171949901-171949923 GACCCAGCCAATCCACTCCAAGG + Intronic
917473645 1:175349215-175349237 GACCCAGCAATTCCTCTTCTGGG + Intronic
917758480 1:178129100-178129122 GACCCAGCCATTCCAGTCCTAGG - Intronic
918550672 1:185738574-185738596 GACCCAGCAATTCCACTGCCAGG - Intronic
920283453 1:204861422-204861444 GACCCAGCAATTCCACTCCTAGG - Intronic
920311071 1:205048548-205048570 GAGCCAGCCAAGCCTCGCCCAGG - Intronic
920358429 1:205393825-205393847 GACCCAGCAATTCCACTCCTAGG + Intronic
920611779 1:207447203-207447225 AACCCAGCAATTCCTCTCCTAGG - Intergenic
920701325 1:208219844-208219866 GACACAGCCCTTCCGGCCCCAGG + Intronic
921201248 1:212808822-212808844 GACCCAGCAATTCCACCCCTAGG + Intronic
921478063 1:215633737-215633759 AACGCAGCCTTTCCTCCTCCAGG + Intronic
922630630 1:227105955-227105977 GATCCAGCCATTCCACTCCTAGG - Intronic
922717621 1:227885530-227885552 GACTCCGCCCTTCCTCCGCCAGG + Intergenic
923038742 1:230304151-230304173 GACCCAGAGATTCCACTCCCTGG + Intergenic
923270486 1:232351211-232351233 GACCCAGCCATTCCACTCCTAGG + Intergenic
923273518 1:232378101-232378123 GACTCAAGCAATCCTCCCCCCGG - Intergenic
923423771 1:233847433-233847455 GACCCAGCAATTCCTTTCCTAGG + Intergenic
923769039 1:236921326-236921348 GACCCAGCAATTCCTCCGCTAGG - Intergenic
924091022 1:240500867-240500889 GACCCAGCATTTCCACCGCCCGG - Intronic
924351757 1:243121183-243121205 AACCCAGCCATTCCACTCCTAGG - Intergenic
924707549 1:246511832-246511854 CACCCAGCCAGACCTCCCCCTGG + Intergenic
924825818 1:247537502-247537524 GACCTAGCAATTCCACTCCCAGG - Intronic
924831111 1:247596183-247596205 GACCCAGCAATTCCACTCCTGGG + Intergenic
1062822399 10:544448-544470 GACCCAGCAATTTCACTCCCAGG - Intronic
1063257898 10:4349562-4349584 GACCCAGCAATTTCACTCCCAGG - Intergenic
1063274195 10:4546583-4546605 GACCTAGCCATTCCTTTCCTAGG - Intergenic
1063349894 10:5344399-5344421 GATCCAGCCATTCCTCTCCTAGG + Intergenic
1063893094 10:10650805-10650827 GACCCAGCGATTCCACTCCTAGG + Intergenic
1064188809 10:13187492-13187514 GACCCAGCAATCCCACTCCCAGG - Intronic
1064255989 10:13743162-13743184 GACCCAGCCATCTCTCTCCTTGG + Intronic
1064284152 10:13978008-13978030 GACCCAGCAATTCCACTCCGAGG - Intronic
1065430842 10:25653860-25653882 GACACAGCAATCCCACCCCCAGG - Intergenic
1065864647 10:29903541-29903563 GATCCAGCAATTCCACTCCCAGG - Intergenic
1065889895 10:30111937-30111959 GATCCAGCAATTCCACTCCCAGG + Intronic
1067042765 10:42963888-42963910 GACCCAGCAATTGCACTCCCAGG - Intergenic
1067214910 10:44293536-44293558 GACCCTGCCCGTCCTCCCCGCGG - Intronic
1067332617 10:45335529-45335551 GACCCAGCAATTGCACTCCCAGG + Intergenic
1067553948 10:47254666-47254688 GAACAAGTCATTCCTACCCCAGG - Intergenic
1067907558 10:50309539-50309561 GAGCCAGGAATCCCTCCCCCAGG + Intronic
1068105372 10:52608274-52608296 GACCCAGCAATTCTACCCCTAGG + Intergenic
1068448677 10:57158349-57158371 GACCCAGCAATTCCCCACCTAGG + Intergenic
1068737981 10:60436330-60436352 GACCCAGCAATTCCACTCCTAGG - Intronic
1068805612 10:61191357-61191379 GACCCCTCCATCCCTTCCCCTGG - Intergenic
1069510780 10:69040870-69040892 GACCCCGCCCTTCCTACCCATGG - Intergenic
1069619237 10:69826286-69826308 GAGCTAGCCATTCTTCCCTCTGG - Intronic
1070108414 10:73459158-73459180 GACCCAGCAATTTCACTCCCAGG + Intronic
1070356996 10:75649668-75649690 GACCCAGCAATTCCTCTTCTGGG - Intronic
1070406578 10:76102992-76103014 GACCCGGCAATTCCACTCCCAGG - Intronic
1070625986 10:78051596-78051618 GGCCCAGCAATTCCACCCCGAGG - Intronic
1070699690 10:78592500-78592522 GACCCAGGCATTCCACTCTCAGG - Intergenic
1070738491 10:78884705-78884727 GACCTAGCCATTCCACTCCTAGG + Intergenic
1071106137 10:82097628-82097650 GACCCAGCAATTCCACTCCTAGG - Intronic
1071151210 10:82636759-82636781 GACCCAGCAATTCCTCTTCTGGG - Intronic
1072070694 10:91913695-91913717 GACCCAGCAATTCCTCTTCTGGG - Intergenic
1072193921 10:93098644-93098666 GACCTAGCCATTCCACTCCTAGG - Intergenic
1072195086 10:93110687-93110709 GACCCAGCAATCCCACTCCCAGG - Intergenic
1072304525 10:94094629-94094651 GACCCAGGGTTTCCTCCCTCTGG - Intronic
1072315351 10:94197347-94197369 GACCCAGCAATTCCACTCCTAGG - Intronic
1072403961 10:95132275-95132297 GACCCAGCCATTCCACTACTGGG + Intergenic
1072625738 10:97110304-97110326 GACCTAGCAATTCCACTCCCAGG + Intronic
1072927471 10:99629003-99629025 GACCCAGCAATTCCACTCCTAGG + Intergenic
1072941107 10:99764800-99764822 GACCCAGCAATTCCACTCCTAGG + Intergenic
1073227602 10:101936633-101936655 GACACAGCAATTCCTCCTCTGGG + Intronic
1073317528 10:102593443-102593465 GACCCAGCCATTTCCCAGCCAGG + Intronic
1073320954 10:102615997-102616019 GACCCTGCCATCCCTGCCCTGGG - Intronic
1073479200 10:103775544-103775566 GTCCCTGCCATTCCTCCCCCTGG - Intronic
1073816543 10:107213989-107214011 GACCCAGCCACACCACCACCCGG - Intergenic
1074502491 10:114039360-114039382 TATCCAGCCATTTCTGCCCCAGG - Intergenic
1075166732 10:120074914-120074936 GACCCAGCAATTCCACTCCTGGG - Intergenic
1076153275 10:128181355-128181377 AATCCAGCCATTCCACCCCTAGG - Intergenic
1076728245 10:132423805-132423827 GACCCAGCGGCTCCACCCCCAGG - Intergenic
1077076731 11:705614-705636 GACCCAGCCATGCCCACCCCAGG - Intronic
1077100578 11:820529-820551 GACCCATCCACTCCTGACCCAGG - Intronic
1077158478 11:1102003-1102025 GCCTCAGCCCTTCCGCCCCCGGG - Intergenic
1077315830 11:1919010-1919032 GAGTCTGCCATACCTCCCCCCGG - Intergenic
1077631901 11:3816710-3816732 CTGCCAGCCATTCCACCCCCAGG - Intronic
1077666742 11:4117265-4117287 GACCCAGCAGTTCCTCTCCTAGG + Intronic
1078155162 11:8793724-8793746 GACCCAGCAATTCCACTCCTAGG - Intronic
1078232476 11:9455867-9455889 GACCCAGCAATTCCACTCCTAGG + Intergenic
1078620920 11:12907014-12907036 GACCCAGCAATTCCACTCCTAGG - Intronic
1078701826 11:13692398-13692420 GACCCAGCAATTCCACTCCTAGG - Intronic
1078725640 11:13928352-13928374 GACCCAGCAATTCCACTCCTAGG - Intergenic
1079114072 11:17629387-17629409 GTCCCAGCCTTTCCTGCTCCAGG - Intronic
1079121820 11:17691049-17691071 GACCCAGCAATTCCACTCCTGGG + Intergenic
1079674017 11:23202555-23202577 GACCCACCCCTTCCCCCCCAAGG - Intergenic
1079737556 11:24015324-24015346 GACCCAGCCATTCCACTCTTAGG + Intergenic
1080412070 11:32035100-32035122 GACCCAGCAATTCCACTCCTGGG - Intronic
1080557131 11:33428130-33428152 GACCCAGCAATTCCACCCCTAGG - Intergenic
1080882264 11:36333358-36333380 GACCTGGCCATTCCACTCCCAGG + Intronic
1081188040 11:40069489-40069511 GACCCAGCAATTCCACCACTGGG + Intergenic
1081891093 11:46542960-46542982 GACCGAGCCCTTCCATCCCCCGG - Exonic
1083945949 11:65922773-65922795 GACCCAGCAATTCCACTCCTAGG + Intergenic
1084192111 11:67504032-67504054 GACCCCGCCAGCCCTGCCCCGGG - Intronic
1084196968 11:67528569-67528591 GACTCAGCAATTCCACTCCCAGG + Intergenic
1084223102 11:67696922-67696944 GAAACAGCCCTTCCTCCCACAGG - Intergenic
1084482683 11:69430846-69430868 GACTCAGCCATTCCACTCCTGGG - Intergenic
1084543617 11:69802461-69802483 GACCCAGCAATTCCACTCCTAGG - Intergenic
1084655279 11:70511544-70511566 GATCAAGCCATACCTTCCCCTGG - Intronic
1084677992 11:70647897-70647919 GACCCAGCAATTCCACTCCTAGG + Intronic
1085066291 11:73498685-73498707 GACCAAGCCATTCAGCCTCCCGG - Intronic
1085152025 11:74259922-74259944 GACCCAGTTATTCCACTCCCAGG - Intronic
1085253847 11:75161059-75161081 GACCCAGCAATTCCGCTCCTAGG + Intronic
1085300296 11:75454476-75454498 CACCCAGAAATTCCTCTCCCAGG + Intronic
1085369510 11:75987119-75987141 GACCCAGCAATTCCACTTCCAGG - Intronic
1085654479 11:78300467-78300489 GACCCATCCATTCCACTCCTAGG - Intronic
1085781830 11:79416254-79416276 GACCCAGCCATTCCACTCCTAGG - Intronic
1086276846 11:85140175-85140197 GACCCAGCAATTCCTCTTCTGGG - Intronic
1086503442 11:87477324-87477346 GACCCAGCAATTCTCCTCCCAGG - Intergenic
1087088712 11:94245999-94246021 TACCCAGCCCTTCCTTGCCCTGG - Intergenic
1087532376 11:99400593-99400615 GACCCAGCAATTCCACCACTGGG - Intronic
1087636464 11:100707264-100707286 GACCCAGCAATTCCACTCCTAGG - Intronic
1087803979 11:102535685-102535707 GACCCAGCAATTCTACTCCCAGG - Intergenic
1088677010 11:112204422-112204444 GACCCAGCAATCCCTCTCCTGGG - Intronic
1089210543 11:116797997-116798019 GACCCAGCAATTCCACCTCTGGG + Intergenic
1089224491 11:116905467-116905489 GACCCAGCAGTTCCACTCCCAGG - Intronic
1089325466 11:117653682-117653704 GACCCAGCCATTCTACTCCTAGG + Intronic
1089440528 11:118512648-118512670 GACCCAGCCATTCCACTCTGAGG - Intronic
1090182196 11:124709728-124709750 GACCCAGCTATTCCACTTCCAGG + Intergenic
1090222610 11:125042838-125042860 GACCCAGTAATTCCACTCCCAGG - Intergenic
1090241538 11:125185885-125185907 GACCCAGCAATTCCTCTACTAGG - Intronic
1090737810 11:129626188-129626210 GACCCAGTAATTCCCCCTCCAGG - Intergenic
1091067271 11:132527245-132527267 GACCCAGCAATTCCACTCCTAGG - Intronic
1091239612 11:134043720-134043742 GACCCAGCCCTCCTTCCCCCCGG - Intergenic
1091272072 11:134322929-134322951 GACCCAGCAATTCCTCTTCCAGG - Intergenic
1092102589 12:5898370-5898392 GACCCAGCAATTCCACTCCTAGG + Intronic
1092108376 12:5940731-5940753 GACCCAGCAATTCTTCTCCTAGG + Intronic
1092826842 12:12408313-12408335 GACCCAGCAATTCCACCTCTGGG - Intronic
1094026597 12:25966047-25966069 GATCCAGCCATTCCACTCCTGGG - Intronic
1094377698 12:29808881-29808903 GACCCAGCAATTCCACTCCTAGG + Intergenic
1094860848 12:34464560-34464582 GACCCGGCCATTCCATCACCGGG - Intergenic
1095239731 12:39843133-39843155 GACCCAGCAATTCCACCCTTGGG - Intronic
1095264067 12:40133045-40133067 GACCCAGACTTTCTTCCCCAAGG - Intergenic
1095361563 12:41347162-41347184 GACCCAGCAATTCCTCTCCTAGG - Intronic
1096233565 12:49910825-49910847 GACCCAGCAATTCCTGCAGCTGG - Intergenic
1096376881 12:51119803-51119825 GACCCAGCAATTCCACCCATTGG + Intronic
1096971722 12:55671835-55671857 GACCCAGCCATTTCACCCGGGGG - Intergenic
1097536909 12:60883698-60883720 GACCCAGCAATCCCACTCCCGGG - Intergenic
1097778552 12:63676136-63676158 GACCCAGCAATTCCACTCCTAGG - Intergenic
1097919861 12:65060174-65060196 GACCCAGCAATTCCACCCCCAGG + Intronic
1098001625 12:65950184-65950206 GAACCAGCGATTCCACTCCCAGG + Intronic
1100133126 12:91520925-91520947 GACCCAGCCATCCCACTCCTGGG + Intergenic
1100369047 12:93948689-93948711 CTCCCAGCCATTCCTCCCCTAGG + Intergenic
1100564333 12:95780779-95780801 GACCCAGCCATCCCTTTACCGGG + Intronic
1100621336 12:96277271-96277293 GACCCAGCAATTCCACTCCTAGG + Intergenic
1101609865 12:106281231-106281253 GACCTAGCCATTCCACTCCTAGG + Intronic
1102069549 12:110006169-110006191 GACCCAGCAATTCCTCTCCAAGG - Intronic
1102176431 12:110878753-110878775 GACCCAGCAATCCCTCTCCTGGG - Intronic
1102212173 12:111135458-111135480 GACCCAGCAATTCTGCTCCCAGG + Intronic
1102217523 12:111171740-111171762 GACCCTGCCATTCTTTCACCAGG - Intronic
1102257663 12:111425458-111425480 GAACCTGCCATTCCTCAGCCTGG - Intronic
1102305400 12:111800796-111800818 GACCCAGCAATTCCACTCCTAGG + Intronic
1102463672 12:113115553-113115575 GGCCTCCCCATTCCTCCCCCAGG + Intronic
1102901517 12:116641552-116641574 GACCCAGCAATTCCACTCCTAGG + Intergenic
1103020324 12:117528704-117528726 GTCCCAGCCAAGTCTCCCCCAGG - Intronic
1103305117 12:119958034-119958056 TACCCAGACATTCATCCCCAAGG + Intergenic
1103451994 12:121035772-121035794 GACCCAGCACCTCCACCCCCTGG + Intronic
1103513377 12:121490448-121490470 GACCCAGCCATGACTGCCTCTGG - Intronic
1103712790 12:122925391-122925413 GACCCAGCAATTCCACTCCCAGG + Intronic
1103793476 12:123487782-123487804 GACCCAGCAATCCCACTCCCAGG - Intronic
1103795102 12:123497901-123497923 GACCCAGCAATTCCACTCCTAGG - Intronic
1103857766 12:123985717-123985739 GAACCTGCCATTCCACCCCTTGG - Intronic
1103990180 12:124793787-124793809 GACCCAGCGATTCCACCCCTCGG + Intronic
1103992409 12:124808003-124808025 GATCCAGCCACTTCTCCCCACGG + Intronic
1104655867 12:130573644-130573666 GACACAGCCATCACCCCCCCAGG - Intronic
1104742363 12:131188115-131188137 GACCCAGCAATTCCACTCACAGG + Intergenic
1104947374 12:132422105-132422127 GACCCGTCCAGTCCTTCCCCTGG - Intergenic
1105373971 13:19826415-19826437 GACCCAGCAATTCCACTCCAAGG + Intronic
1105784218 13:23732416-23732438 GACCCAGCAATTTCACTCCCAGG + Intronic
1105838461 13:24231616-24231638 GACCTAGCAATTCCACCCCTAGG - Intronic
1106299191 13:28448235-28448257 GACCCAGCAATTCCACCCCTAGG + Intronic
1106518255 13:30473732-30473754 GACCCAGCAATTCCACTCCTAGG + Intronic
1106589087 13:31083786-31083808 GACCCAGCAATTTCACTCCCAGG + Intergenic
1107131501 13:36901188-36901210 GACCCAGCAATTCCACTCCTAGG - Intronic
1108282773 13:48876107-48876129 ACCCCCGCCACTCCTCCCCCAGG - Intergenic
1108385664 13:49897070-49897092 GAGCCACCCATTTCTCCCCCAGG - Intergenic
1108426572 13:50307994-50308016 GACCCAGCCATTCCACTCCTGGG + Intronic
1108484687 13:50911510-50911532 GAACCAGCCATTCCACTCCAGGG - Intronic
1108574377 13:51778752-51778774 GACCCAGCCAGCCCTCCTGCAGG - Intronic
1109351097 13:61181853-61181875 AACCCAGCCATTCCACTCCTAGG - Intergenic
1109453430 13:62549637-62549659 GACCCAGCAATTCCTCTCCTAGG + Intergenic
1110433733 13:75456769-75456791 GACCTAGCAATTCCTCTCCTAGG + Intronic
1111943324 13:94637069-94637091 GACCCAGCAATTCCACTCCTTGG + Intergenic
1112768373 13:102771180-102771202 GACACAGCGATTCCTTCCCCAGG - Intronic
1112797343 13:103070791-103070813 GACCCAGCCATTCCAGTCCTAGG + Intergenic
1113250517 13:108447323-108447345 GACCCATCCTTGCCTCCTCCTGG - Intergenic
1113568050 13:111331062-111331084 GATCCAGCAATTCCACCCCTAGG - Intronic
1113792002 13:113033923-113033945 GGCCCTGCCATTCCTTCCTCCGG + Intronic
1113825484 13:113249618-113249640 GACCCAGCAGTTCCACTCCCAGG - Intronic
1113829358 13:113282980-113283002 GCCCCAGCCATTCCACTCCCAGG + Intergenic
1113897126 13:113771866-113771888 GACCCAGCAATTCCACTCCTAGG - Intronic
1114279412 14:21177578-21177600 GACCCAGCAATTCCACTCCTAGG - Intergenic
1115419417 14:33176732-33176754 GACCCAGTAATTCCACTCCCAGG - Intronic
1115498885 14:34032117-34032139 GCTCTAGCCAGTCCTCCCCCTGG + Intronic
1115634810 14:35281050-35281072 GACCTATCCCTTCCTCACCCAGG + Intronic
1116074770 14:40097148-40097170 GACTCAGCAATTCTTCCCCTAGG - Intergenic
1116839692 14:49807397-49807419 GACCCAGCAATTCCTCTCTTAGG - Intronic
1117047065 14:51823945-51823967 GACCCAGCAATTCCACTCCCAGG - Intergenic
1117377399 14:55129150-55129172 TGCCCAGCCAGTCCTCTCCCCGG - Exonic
1117387437 14:55230077-55230099 GACCCAGCAATTCCACTCCTCGG + Intergenic
1117490515 14:56242068-56242090 CACACAGCCATTCCTTCCACAGG - Intronic
1118182403 14:63506771-63506793 GACCCAGCAATCCCACTCCCAGG + Intronic
1118424228 14:65641525-65641547 GACCCAGCCATTCCACTCCTAGG - Intronic
1118454916 14:65936683-65936705 GCCCCAGAAATTCCGCCCCCAGG + Intergenic
1119211369 14:72834673-72834695 GACCCAGAAACTCCTCCCCTAGG + Intronic
1119220536 14:72903002-72903024 GACCCAGCTATTCCACTCCTAGG + Intergenic
1119488344 14:75007669-75007691 GACCCAGCAATTCCACTCCTAGG - Intronic
1119760911 14:77151309-77151331 GACCCAGCCATTCCACTTCTTGG - Intronic
1120064336 14:80022381-80022403 GACCCAGCAATTCCATCACCGGG - Intergenic
1120707300 14:87758171-87758193 GACCCAGCAATTCCACTCCTTGG - Intergenic
1120952894 14:90059294-90059316 GACCCAGCAATTCCGCTCCTAGG + Intergenic
1121050545 14:90816587-90816609 CACCCCGCCTTTCCTCCCTCGGG - Intergenic
1121100965 14:91249975-91249997 GACCCAGCTCCTCCTTCCCCAGG - Intronic
1121306058 14:92907854-92907876 GACTCAGCCATTCCACTCCTAGG - Intergenic
1121460765 14:94076082-94076104 GACCTAGCCATTCCACACCTAGG + Intronic
1121468400 14:94130524-94130546 GACCCAGCAGTTCCACCTCCAGG - Intergenic
1121517406 14:94561725-94561747 GACCCAGAAAAGCCTCCCCCAGG + Intronic
1121641621 14:95488491-95488513 GATCCAGCCATTCCACTCCTAGG - Intergenic
1122480508 14:102044252-102044274 AACCCTGCTTTTCCTCCCCCAGG + Exonic
1122833861 14:104421492-104421514 GGCCAAGCCCTGCCTCCCCCAGG - Intergenic
1122838739 14:104444069-104444091 GCCACAGCCCCTCCTCCCCCAGG - Intergenic
1122852194 14:104541890-104541912 GACCCAGCCATTCCACTCATAGG + Intronic
1122978675 14:105181467-105181489 GACCCGGCCAGTCCTTCCCCCGG - Intergenic
1123674695 15:22698719-22698741 GACCCAGCAATTCCACTCCTGGG + Intergenic
1123784241 15:23653147-23653169 GACCCAGACATTCAACTCCCAGG - Intergenic
1124326707 15:28771701-28771723 GACCCAGCAATTCCACTCCTGGG + Intergenic
1124378879 15:29147770-29147792 GACCCAGCAATTCCCCTCCAAGG + Intronic
1124618479 15:31260154-31260176 GACCCAGCAATTCCACCCCTAGG + Intergenic
1124850848 15:33337741-33337763 GACCCAGCAATTCCTCCCAGTGG + Intronic
1125495547 15:40189725-40189747 GATCCAGCAATTCCTCTCCTAGG - Intronic
1125512556 15:40300405-40300427 GACCCAACAATTCCACCCCTGGG + Intronic
1125768501 15:42150360-42150382 GACAGAGCCTTACCTCCCCCAGG + Exonic
1126303907 15:47232358-47232380 GACCCAGCAATTCCACTCCCAGG - Intronic
1126409969 15:48363126-48363148 GACCCAGCAATTCCACCTCTAGG - Intergenic
1126461274 15:48917605-48917627 CACCCAGGCATTCATCCCCTTGG - Intronic
1126934470 15:53690817-53690839 GACCCAGCAATTCCACTCCTAGG - Intronic
1127100924 15:55564045-55564067 GATCCAGCAATTCCTCTCCTAGG + Intronic
1127223462 15:56905147-56905169 GACCCAGCCATCCCACCACTGGG + Intronic
1127302432 15:57668299-57668321 GACCCAGCTATTCCACTACCAGG - Intronic
1127305483 15:57701560-57701582 GACCCAGCCATTCTTCTGCTAGG - Intronic
1127502016 15:59562454-59562476 GACCCAGCAATTCCACTCCTAGG - Intergenic
1127881288 15:63160509-63160531 GACTCAGCAATTCCTCCTCCAGG - Intergenic
1127952938 15:63827617-63827639 GACCCAGCAATTCCACTCCTAGG + Intronic
1128313373 15:66645364-66645386 GACCCAGCCCCACCTCCTCCAGG + Intronic
1128397671 15:67245135-67245157 GACCCAGCAATTCCACTCCCAGG + Intronic
1128422327 15:67505454-67505476 AACCCAGCCATTCCACTCCTAGG + Intergenic
1128472336 15:67965362-67965384 GATCCAGCCATTCCTCTCCTGGG - Intergenic
1128752094 15:70156950-70156972 GTCTCAGCCATTCCTCTTCCCGG + Intergenic
1128781330 15:70360587-70360609 GATGCAGCAATTCCTCCCCTGGG + Intergenic
1129121811 15:73402141-73402163 GACCCAGCAATTCCACGCCTAGG - Intergenic
1129194706 15:73956859-73956881 TCCCCAGCCATTCCTCACCACGG + Intergenic
1129360298 15:75020133-75020155 GAGCCAGCCAGACCTTCCCCAGG - Exonic
1129370041 15:75087134-75087156 GACCCAACCATTCCACTCCTAGG + Intronic
1129666200 15:77580814-77580836 GACCCTGACATTCCTGACCCAGG + Intergenic
1129873061 15:78953744-78953766 GACCCAGCAATTCCACTCCTAGG - Intergenic
1129925324 15:79358783-79358805 GGCCCAGCCATTTCACCCCAGGG - Intronic
1130401452 15:83558652-83558674 GTCCTATCCATTCCTGCCCCTGG + Intronic
1130448458 15:84027350-84027372 GACCCAGAAATTCCACCCCTAGG + Intronic
1130546906 15:84863413-84863435 GAGTAAGCCCTTCCTCCCCCAGG + Intronic
1130816347 15:87439209-87439231 GACTCAGCAATTCCACCCCCAGG + Intergenic
1131114765 15:89788111-89788133 GACCCAGCAATTCCGCTCCTAGG + Intronic
1131133912 15:89918588-89918610 GAGCCAGCTATTCCACTCCCAGG + Intergenic
1131245253 15:90786384-90786406 GACCCAGCAAGTCCACTCCCAGG - Intronic
1131464185 15:92642288-92642310 GACCCAGCAATTCCACTCCTAGG + Intronic
1131578850 15:93620318-93620340 GACCCAGCAATTCCACTCCTAGG - Intergenic
1131671552 15:94625175-94625197 GACCCAGCCATTCCACATCTAGG + Intergenic
1132033938 15:98464087-98464109 GACCCAGCAATTCTACCCCTAGG + Intronic
1132158588 15:99515191-99515213 GACCCAGCAATTCCACTCCTAGG - Intergenic
1132567686 16:630857-630879 GAGCCAGCCCTTCCCCGCCCCGG + Intronic
1132594570 16:742556-742578 GTCCCAGCCATCCCGCCACCTGG + Intronic
1132840896 16:1978074-1978096 GACCCAGCCCCTCGCCCCCCGGG - Intronic
1132871019 16:2115811-2115833 GCCCCACCCAATCCACCCCCAGG + Intronic
1132882295 16:2167798-2167820 GCCCCAGCCCTGCCTACCCCAGG - Intronic
1132937155 16:2486969-2486991 GTCCCAACCCTTCCTCCTCCAGG + Intronic
1133016817 16:2946972-2946994 GACCCAGCAATTCCACTCCTAGG + Intronic
1133034278 16:3026343-3026365 GACCTTGCCTTTCCTTCCCCAGG + Exonic
1133184170 16:4083483-4083505 GACCCAGCAATTCCACTCCTAGG + Intronic
1133747593 16:8699046-8699068 GACCCAGCAATTCCACCCCTAGG - Intronic
1134056009 16:11170300-11170322 GCACCAGGCCTTCCTCCCCCAGG - Intronic
1134437275 16:14272324-14272346 AACCCAGCAATTCCGCTCCCAGG + Intergenic
1134453453 16:14377467-14377489 GACCCAGCAATTCCACTCCCAGG + Intergenic
1134489397 16:14684852-14684874 GACCCAGCAATTCCACTCCTAGG + Intronic
1134684248 16:16147546-16147568 GACACTGCCATTAATCCCCCAGG - Intergenic
1135713444 16:24738802-24738824 AACCCAGCAATTCCACCCCTAGG - Intronic
1136082524 16:27861488-27861510 GACCCAGCAATTCCACCTCTAGG + Intronic
1136245379 16:28972824-28972846 GACCCAGCAATTCCACTCCTAGG - Intergenic
1136381235 16:29896910-29896932 CACCCAGCCCTGCCTCCCCAGGG - Exonic
1136570667 16:31094697-31094719 CACCCAGCCAGGGCTCCCCCAGG + Exonic
1137520640 16:49192408-49192430 GACCCAGCAATTCCACTCCTAGG + Intergenic
1137642587 16:50045859-50045881 GACCCAGCAATTCCACTCCATGG - Intergenic
1138047290 16:53738607-53738629 GACCCAGCAATTCCACTTCCAGG - Intronic
1138121856 16:54406598-54406620 GACCCAGCAATTCCACCTCCAGG + Intergenic
1138214934 16:55195944-55195966 GACCCAGCAATTCCACCCCTAGG + Intergenic
1138279089 16:55759426-55759448 GACCCAGCAATTCCCCTCCTAGG - Intergenic
1138289449 16:55834254-55834276 GACCCAGCAATTCCCCTCCTAGG + Intergenic
1138636559 16:58343691-58343713 GACCCAGCAATTCCACTTCCGGG - Intronic
1138717794 16:59044156-59044178 GACCCAGCAATTCCACCTTCTGG + Intergenic
1139300780 16:65943574-65943596 GACCCAGCCATGCCCTCTCCTGG + Intergenic
1139386519 16:66576008-66576030 AACCCAGCCACTGCTCACCCAGG + Intronic
1139589471 16:67925627-67925649 GACCCTGACTTTCCTCCTCCTGG + Intronic
1139729554 16:68931380-68931402 GGCCCAGCAATTCCACTCCCAGG + Intronic
1139978222 16:70832302-70832324 GACCCAGCCATTCCACAACTAGG + Intronic
1140627928 16:76817053-76817075 GACCCAGCAATTCAACCCCCAGG - Intergenic
1140913221 16:79472245-79472267 GACCCAGCAATTCCACTCCTGGG + Intergenic
1140932692 16:79642342-79642364 GACCCAGCAATTCCTCTTCTAGG - Intergenic
1141114672 16:81298183-81298205 GACCCAGCAATTCCACTCCTAGG - Intergenic
1141125697 16:81399253-81399275 GATCCAGCAATTCCACCCCTGGG - Intergenic
1141186018 16:81788081-81788103 GACCCAGCAATTCCACTCCTAGG - Intronic
1141465400 16:84202518-84202540 GACCCAGCCATTCCGCTCTTAGG + Intergenic
1141694244 16:85612275-85612297 GCCCCAGCCTTCCCACCCCCCGG - Intronic
1141786108 16:86201879-86201901 CACCCAGCCTCTCCTCACCCGGG - Intergenic
1141944752 16:87302130-87302152 GATCCAGCAATTCCACTCCCAGG + Intronic
1142007186 16:87695066-87695088 GACCCAGCAGTTCCACTCCCAGG - Intronic
1142491209 17:280998-281020 GTCCCAGCCCTGCCTCCCCAGGG + Intronic
1142543093 17:677077-677099 GACCCAGCAATTCCACTCCTAGG + Intronic
1142717590 17:1755453-1755475 GACCTCGCCAGCCCTCCCCCGGG + Intergenic
1143223069 17:5278753-5278775 GACCCAGCAGTTCCACCCCTAGG - Intergenic
1143302450 17:5920974-5920996 GACCCAGCAATTCCACTCCTAGG + Intronic
1143507535 17:7376320-7376342 GACCCAGACATTCCACTCCTAGG + Intergenic
1143729770 17:8874444-8874466 ATCCCAGTCATGCCTCCCCCCGG - Intergenic
1143754859 17:9059281-9059303 GACCCAGCAATGCCTCTCCTAGG + Intronic
1143995178 17:11000258-11000280 GACCCAGCCATTCCATTCCTAGG - Intergenic
1144097195 17:11910570-11910592 GACCCAGCAATTCTACTCCCAGG - Intronic
1144434266 17:15225125-15225147 GACCCAGCAATTCCTCTCCTAGG - Intergenic
1144543950 17:16174869-16174891 GACCCAGCAATTCCACTCCTAGG + Intronic
1144572879 17:16411186-16411208 GACCCAGCAATTCCACTCCTAGG - Intergenic
1144641911 17:16942113-16942135 GACCCAGCCATTCTTCTCCTAGG - Intronic
1144730682 17:17524296-17524318 GACCCAGCAATTCCACTCCTAGG - Intronic
1144817150 17:18042673-18042695 GACCCAGCAATTGCACTCCCAGG - Intronic
1146118095 17:30161244-30161266 GACCCAGCCATTCCATGCACAGG - Intronic
1146366900 17:32235991-32236013 GACCCAGCCATTCCATTCCCAGG - Intronic
1146463443 17:33066282-33066304 GAGACAGCCATTCTTCTCCCAGG - Intronic
1146640198 17:34534839-34534861 GACCCAGCAATTCCACTCCCAGG - Intergenic
1146677237 17:34781935-34781957 TACCCTGCCAGTCCTCCTCCGGG - Intergenic
1147334584 17:39719689-39719711 GACCCAGCCACACCCCTCCCAGG + Intronic
1147544996 17:41394239-41394261 GACCCAGGCATTCTTACCCTTGG - Intronic
1147563127 17:41521087-41521109 GGTCCAGCCCTTCCTCACCCTGG - Exonic
1147759398 17:42787831-42787853 GACCCTGCCCTTCAGCCCCCTGG + Exonic
1148164211 17:45471423-45471445 GACCCAGCAATTCCACCCCTAGG + Intronic
1148188138 17:45659480-45659502 GATCCAGCCATTCCACTCCTAGG - Intergenic
1148241271 17:46000819-46000841 GACCCAGCCAGGCCAGCCCCTGG + Intronic
1148563454 17:48619489-48619511 GGCCCACCCATTCCCCCGCCAGG + Intronic
1148741777 17:49897236-49897258 GGCTAAGCCATTCCTCCCCCTGG - Intergenic
1148912228 17:50949215-50949237 AACCCAGCCCCTCCTCCCCCCGG - Intergenic
1149130939 17:53301672-53301694 GACCCAGCAATACCTCCACTGGG + Intergenic
1149712032 17:58752212-58752234 GACCCAGCAATTCCTCTCCCAGG - Intergenic
1150236673 17:63598807-63598829 GACCCAGCAATTCCACTCCTAGG + Intergenic
1150243389 17:63654578-63654600 GACCCAGCAATTCCACGCCTAGG - Intronic
1150395444 17:64818077-64818099 GACCCAGCAATTCCACCCCTAGG + Intergenic
1150696126 17:67407026-67407048 GACCCAGCAATCCCACCCCTAGG - Intronic
1150825092 17:68467275-68467297 GACCCAGCAATTCCACTCCTAGG - Intergenic
1151201779 17:72473200-72473222 GACCCAGCAATTCCACTCCTGGG + Intergenic
1151263388 17:72934991-72935013 GACCCAGCCATCTCACTCCCGGG + Intronic
1151490473 17:74430061-74430083 GCCCCAGCCTTTCCCCCGCCTGG + Intronic
1151990438 17:77570836-77570858 GAACCAGCCAGGCCTCCCCTGGG - Intergenic
1152010757 17:77712534-77712556 GACCCAGCAATCCCACCCCTAGG - Intergenic
1152153864 17:78620279-78620301 GACCCAGCAATTCCGCTCCTAGG + Intergenic
1152547137 17:81006126-81006148 AACCCAGCAATTCCACTCCCAGG - Intronic
1152612092 17:81320552-81320574 GACCCAGCCACTCCACTCCTGGG - Intronic
1152702939 17:81828482-81828504 GACCCAGCCATTCTGCTCCTAGG + Intronic
1152790963 17:82279349-82279371 TACCCAGCAATTCCACGCCCAGG + Intergenic
1153073133 18:1129990-1130012 GACCCAGCAATTCCACTCCTAGG - Intergenic
1153905546 18:9658381-9658403 GACTCAGTCACTCCTCACCCTGG - Intergenic
1154225556 18:12500589-12500611 GATCCAGCCACTCCACTCCCAGG + Intronic
1154299674 18:13182226-13182248 GACCCCGCCACTCCACCCCCAGG - Intergenic
1154970949 18:21409000-21409022 AACCCAGCAATTCCACTCCCAGG + Intronic
1154972570 18:21425414-21425436 GACCCAGCAATTCCACTCCTAGG - Intronic
1155026771 18:21947745-21947767 GACCCAGTAATTCCACTCCCAGG + Intergenic
1155102628 18:22627790-22627812 GACCCAGAAATTCCACTCCCAGG + Intergenic
1155445363 18:25906144-25906166 AACCCAGCAATTCCACCCCTAGG - Intergenic
1156365492 18:36422498-36422520 GACCCAGCAATCCCACCTCCAGG - Intronic
1157492256 18:48132015-48132037 GACCCAGCAATTCCACTCCTAGG + Intronic
1158176364 18:54661353-54661375 CACCCAGCCATTCCACTCCTAGG + Intergenic
1158230897 18:55253893-55253915 GACCCAGCAATTCATCCTCAAGG + Intronic
1158646394 18:59251786-59251808 GACCCAGCAACTCCACTCCCAGG - Intergenic
1159068826 18:63599770-63599792 GACCCAGCAATTCCACTCCTAGG - Intronic
1160433421 18:78827976-78827998 GACCCAGCGATTCCACACCTAGG - Intergenic
1160608132 18:80067390-80067412 GCCCCAGCCCTTCCACTCCCGGG - Intronic
1160675698 19:390130-390152 GACCCATCCATTTCTCTCCTGGG + Intergenic
1160718372 19:586690-586712 GGCCCTGCCATTCCCTCCCCAGG - Intergenic
1160718937 19:589318-589340 GACTCAGGCACTCCTCTCCCTGG - Intergenic
1160811252 19:1013892-1013914 GCCCCAGCCAATCCCCTCCCCGG + Intronic
1161041773 19:2114302-2114324 GGCCCGGTCATTCCTCCTCCAGG - Exonic
1161121993 19:2532922-2532944 GACCCAGCAATTCCACTCCTAGG + Intronic
1161219460 19:3111681-3111703 GACCCAGCAATTCTGCTCCCAGG - Intronic
1161648655 19:5470445-5470467 GACCCAGCCACGCCTCTCCTAGG + Intergenic
1161717748 19:5886395-5886417 GAGCCAGCCAAGCCTCCCCTCGG - Intronic
1161918943 19:7251944-7251966 GACCCAGCGATTCCACTCCTAGG + Intronic
1162001380 19:7746857-7746879 GACCCAGCCTCCCCTTCCCCAGG + Intronic
1162578407 19:11512990-11513012 GCTCCCGCCATTCCTCCCCTGGG - Intronic
1162669300 19:12241365-12241387 GACCCAGCAATTCCACTCCTAGG + Intronic
1162898535 19:13779986-13780008 GACCCAGCAATTCCGCTCCTAGG + Intergenic
1163263037 19:16202844-16202866 GATCCAGTCATTCCTCTCTCTGG - Intronic
1163264444 19:16210368-16210390 GACCCAGCCATCCCACTCCTGGG - Exonic
1164032486 19:21419971-21419993 GACACGGCCACTCCTCTCCCAGG + Intronic
1164555086 19:29245168-29245190 AACCCACCCTTTCCTCCTCCTGG - Intergenic
1164619862 19:29688438-29688460 GACTCAGCAATTCCACCCCTAGG - Intergenic
1165153582 19:33774529-33774551 GATCCAGCAGTTCCTCCACCTGG - Intergenic
1165355352 19:35300473-35300495 GACCCAGCCCATGCTCGCCCTGG - Intronic
1165407773 19:35641621-35641643 GGCCCACCCAATCCTCCACCAGG - Intergenic
1166311184 19:41963511-41963533 GAACCAGCAATTCCACTCCCAGG + Intergenic
1166373651 19:42315541-42315563 CCCCCAGCCCCTCCTCCCCCAGG - Intronic
1166373692 19:42315646-42315668 TCCCCAGCCCATCCTCCCCCAGG - Intronic
1166373710 19:42315684-42315706 GTCCCACCCCCTCCTCCCCCAGG - Intronic
1166378777 19:42343807-42343829 TGCCCATCCATTCCTCCCCCAGG - Intronic
1166663795 19:44664900-44664922 GGCCCAGCAATTCCACCTCCAGG - Intronic
1166765813 19:45251657-45251679 GACCCAGCCAGGGCTCCCCAAGG - Intronic
1166982837 19:46641435-46641457 GACCCAGCAATTCCACTCCTAGG + Intergenic
1167012933 19:46820908-46820930 AGCCCGGCCTTTCCTCCCCCGGG - Intergenic
1167313740 19:48752346-48752368 TCCCCAGCCATTACTCCTCCAGG - Intronic
1167394719 19:49220703-49220725 GACCCAGTCATTCCACCCCTAGG - Intergenic
1167537859 19:50066366-50066388 GACCCAGGCAGCCCTGCCCCTGG + Intergenic
1167597649 19:50435873-50435895 GCCGCAGCCCCTCCTCCCCCGGG - Intronic
1168069130 19:53939790-53939812 GACCCAGCAATTCCACTCCTAGG - Intronic
1168238173 19:55076300-55076322 GCCCCAGCCCCTCCTCCCTCAGG - Intronic
1168275434 19:55275325-55275347 GACCCAGCAATTCCGCACCAAGG + Intronic
1168450152 19:56460048-56460070 GACCCAGCAATTCTACCCCTAGG + Intronic
924985920 2:269797-269819 GCCACAGCATTTCCTCCCCCAGG - Intronic
926075157 2:9936780-9936802 GACCCAGCCATTCCACTACTAGG + Intergenic
926225347 2:10963142-10963164 GACCCAGCAATTCCACTCCTCGG - Intergenic
926322408 2:11758281-11758303 GATCCAGCCATTCCAGTCCCGGG - Intronic
926346467 2:11951109-11951131 GACTCAGCAATTCCTCTTCCAGG + Intergenic
926680957 2:15663821-15663843 GACCCAGCAATTCCACTCCCAGG + Intergenic
926903523 2:17784438-17784460 GATCCAGCAATTCCTCTCCCAGG + Exonic
927364585 2:22279206-22279228 GACCCAGCAATCCCACCACCAGG - Intergenic
927953427 2:27190179-27190201 GACCCAGCAATTCCGCTCCTAGG + Intergenic
928397501 2:30954156-30954178 GACCAAGCCCTTCCTGTCCCTGG - Intronic
928606328 2:32947536-32947558 CCCCCAGCCGTGCCTCCCCCGGG + Exonic
929017211 2:37510295-37510317 GACCCAGCAATTCCTCTTCTGGG + Intergenic
929583749 2:43101031-43101053 CACCCCGCCGCTCCTCCCCCCGG + Intergenic
929696819 2:44124395-44124417 GATCCAGCCATTCCTTACCCAGG + Intergenic
929722034 2:44379425-44379447 GACCCAGCAATTCCACTCCTGGG - Intronic
929801411 2:45107314-45107336 GACCCAGCAATTCCACTCCTAGG + Intergenic
930101005 2:47602910-47602932 GACCCAGCAATTCCACGCCTGGG - Intergenic
930509910 2:52331281-52331303 AACCTAGCAATTCCACCCCCAGG - Intergenic
931260972 2:60618966-60618988 GACCCAGCAATTCCACTCCTAGG - Intergenic
931702583 2:64920883-64920905 AACCCAGCCATTCCACTCCTAGG + Intergenic
932022355 2:68100024-68100046 GACCCAGCGATTCCACTCCTAGG + Intronic
932120786 2:69097710-69097732 GGCCCAGCCATTCCACTCCGAGG + Intronic
932572067 2:72943359-72943381 GCCCCAGGCCTCCCTCCCCCGGG - Exonic
932882975 2:75521312-75521334 GACCCAGCCATTCCACCTCTGGG + Intronic
932941843 2:76175920-76175942 GACCCAGCAATTCCACTCCTAGG + Intergenic
933338978 2:80997764-80997786 GACCCAGCAATTCCACTCCTAGG - Intergenic
933555230 2:83823397-83823419 GAGCCAGCCAACCCTGCCCCTGG - Intergenic
933621421 2:84546757-84546779 GACCCAGCAATTCCACTCCTAGG - Intronic
933676795 2:85064221-85064243 GACCCAGCAATTCCACTCCCAGG + Intergenic
933677635 2:85071024-85071046 GACCCAGCCATTCCGTTCCTGGG - Intergenic
933879402 2:86654303-86654325 GACCCAGCCATTCCCTTCCTGGG + Intronic
933886674 2:86724297-86724319 GGCCAAGACATTCCTCTCCCTGG + Intronic
933923506 2:87072410-87072432 GGCCAAGACATTCCTCTCCCTGG - Intergenic
933929562 2:87134959-87134981 GACCCAACAATTCCACCACCAGG - Intergenic
933946475 2:87290305-87290327 GACCCAGCAATTCCACTCCTAGG + Intergenic
934000894 2:87710751-87710773 GACCCAACAATTCCACCACCAGG - Intergenic
934050143 2:88203205-88203227 GACCCAGCAATTCCACTTCCAGG + Intergenic
934522553 2:95028545-95028567 GACCCAGCAATTCCACTCCTGGG + Intronic
934872161 2:97876521-97876543 GAACCAGCCTTTCCACCCCAGGG - Intronic
934965884 2:98722126-98722148 GACCCAGCAATTCCACTCCTTGG + Intronic
935035933 2:99373393-99373415 GACACAGCCATCCTTCCCTCTGG - Intronic
935052440 2:99535373-99535395 GACCCAGCAATTCCACTCCTAGG - Intergenic
935052834 2:99538284-99538306 GACCCAGCCATTCCACACCTAGG + Intergenic
935439847 2:103079923-103079945 GACCCAGCAATTCCCCCTACTGG + Intergenic
935609821 2:105010555-105010577 GACCCAGCCATTCCACTCTTAGG + Intergenic
935720212 2:105973151-105973173 GCCCCAGCCACCCCTCCACCAGG + Intergenic
936268030 2:111025344-111025366 AACCCAGCCATTCCACCCCTCGG - Intronic
936333720 2:111571236-111571258 GACCCAGCAATTCCACTCCTAGG - Intergenic
936363373 2:111828418-111828440 GACCCAACAATTCCACCACCAGG + Intronic
936411036 2:112258396-112258418 GACCCAGCAATTCCACTCCTAGG + Intergenic
936485158 2:112919163-112919185 GACTCAGCCACTTCTGCCCCAGG - Intergenic
937279389 2:120706958-120706980 GACCCAGCAATTCGACCCTCAGG + Intergenic
937686227 2:124700373-124700395 GATCCAGCCATTCCACTCCTAGG - Intronic
937957798 2:127431666-127431688 GCCCCACCTATTCCTCCCCCAGG - Intergenic
937993894 2:127679193-127679215 GCCCCTGCAATGCCTCCCCCAGG + Intronic
938184749 2:129220416-129220438 GACCCAGCAATTCCACTCCTAGG + Intergenic
938554250 2:132409652-132409674 GACCCAGCAATTCCTCTCCTAGG - Intergenic
938612276 2:132960024-132960046 TACCCAGCCACTGCTTCCCCTGG - Intronic
938962811 2:136358339-136358361 GACCCAGAAATTCCACCCCTAGG - Intergenic
939416702 2:141908694-141908716 GACCTAGCCATTCCATCACCAGG - Intronic
939553972 2:143651586-143651608 GACCCAGTCATTCCACTCCTAGG - Intronic
940058631 2:149540184-149540206 GACCCAGCAATTCCACTCTCAGG - Intergenic
940364428 2:152831953-152831975 GACCCAGCAATTCCACTCCTAGG - Intergenic
940832369 2:158481404-158481426 GACCCAGCAACTCCTCTCCTAGG - Intronic
940882702 2:158962422-158962444 GACCCAGCAATTGCACCCCTGGG - Intergenic
941732869 2:168937366-168937388 GACCCAGCAATTCCACTCCTAGG - Intronic
941880300 2:170474328-170474350 GACCCTGCCAATCATACCCCTGG - Intronic
941944265 2:171077294-171077316 CACCCATTCATTCCTCCTCCAGG + Intronic
943771357 2:191721279-191721301 CACCCACCCCTACCTCCCCCAGG + Intergenic
944340148 2:198586496-198586518 GACCCAGCCATTCTACTCCCAGG + Intergenic
944534070 2:200692716-200692738 GACCCAGCAATTTCACCACCAGG + Intergenic
944697675 2:202217607-202217629 GACCCAGCAATTCCACTCCTAGG + Intronic
944750448 2:202703831-202703853 GACCCAGCAATTCCACTCTCAGG - Intronic
944973329 2:205019498-205019520 GCCCCAGCCATTCCACTCCTAGG - Intronic
945232287 2:207605084-207605106 GACCCAGCAACTCCACTCCCAGG - Intronic
945931759 2:215862285-215862307 GACCCAACAATTCCTCTCCTAGG + Intergenic
946175211 2:217918399-217918421 GACACAGCCATTTCACCACCAGG + Intronic
946530245 2:220562936-220562958 GACTCAGCAATTCCTCTCCTTGG + Intergenic
946660625 2:221995289-221995311 GACCCAGCAATTCCACTCCTGGG - Intergenic
946664260 2:222032752-222032774 CACCTAGCCCCTCCTCCCCCTGG + Intergenic
946851459 2:223910888-223910910 GACCCAGCAATTCCACTCCTAGG + Intronic
946952157 2:224888040-224888062 GACCCAGCAATTCCTCCTCTGGG + Intronic
947222696 2:227808834-227808856 GACCCAGCAATTCTACTCCCAGG - Intergenic
947349011 2:229223085-229223107 GACCCAGCCATCCCACTCCTGGG - Intronic
947436603 2:230078335-230078357 GATCCACCCAGTCCTGCCCCGGG - Intergenic
947499324 2:230660546-230660568 GCCCCAGCAATTCCAGCCCCAGG + Intergenic
947754390 2:232550970-232550992 GGCACAGCCACCCCTCCCCCGGG - Intronic
947814473 2:233026895-233026917 GACCCAGCAATTCCACTCCTAGG + Intergenic
947999834 2:234558681-234558703 GACCCAGCCATTCCTCTTTTAGG - Intergenic
948181469 2:235984406-235984428 GACCCAGCAATTCCACTCCTAGG - Intronic
948191291 2:236061327-236061349 GACCCAGCCATTCCTCCCCCAGG + Intronic
948283507 2:236767036-236767058 GACCCAGCAATTCCGCTCCTAGG - Intergenic
948368243 2:237472519-237472541 GACTCAGCCATTTCTTCCCCAGG + Intergenic
948510736 2:238462817-238462839 GACCCAGCAATTCCATTCCCAGG - Intergenic
948623666 2:239252892-239252914 GACCCAGCCTGTTCTCCGCCAGG + Intronic
948814916 2:240505502-240505524 GACCCAGCCATCCCACTTCCAGG + Intronic
1168746379 20:246075-246097 GACCCAGCAATTCCTCCTCTGGG - Intergenic
1168922035 20:1546602-1546624 GACCCAGCTATTCCACTCCTAGG - Intronic
1169224243 20:3846521-3846543 GAAGCAGCCCCTCCTCCCCCTGG - Intergenic
1169251622 20:4065308-4065330 AACCCAGCCATCCCTTCCCATGG + Intergenic
1170237618 20:14124777-14124799 GACCCAGCCATTCCACTCCTAGG + Intronic
1170447531 20:16444244-16444266 GACCCAGCAGTTCCACCCCTAGG + Intronic
1170601330 20:17843620-17843642 GGCCCAGTCATTCCACTCCCAGG + Intergenic
1170773385 20:19353930-19353952 GAACCAGCCATTCCACCCTTAGG + Intronic
1171360540 20:24583660-24583682 GGCCCAGCCATTCAGCCTCCTGG + Intronic
1172022855 20:31926522-31926544 GACCCAGCAATTCCTCTTCTGGG + Intronic
1172040774 20:32043618-32043640 GACCCAGCAATCCCACGCCCAGG - Intergenic
1172201579 20:33130710-33130732 GATCCAGCCATTCCACTCCTGGG + Intergenic
1173130656 20:40390057-40390079 GACCCAGCAATTCCACTCCTAGG + Intergenic
1173216477 20:41089652-41089674 GACCCAGCAATTCCATTCCCAGG - Intronic
1173224510 20:41154394-41154416 GAGCCAGCCAATCCTGCCCTAGG - Intronic
1173860859 20:46282748-46282770 CACCCACCCTTCCCTCCCCCGGG - Intronic
1174489460 20:50882223-50882245 GACCCAGTAATTCCACCCCTAGG + Intronic
1174583900 20:51592745-51592767 TGCCCAGCCTTTCCTACCCCGGG + Intergenic
1174621276 20:51876492-51876514 GACCCAGCCTTGACTTCCCCAGG + Intergenic
1174897036 20:54460627-54460649 GACCCAGCGATTCTTTCCCTAGG + Intergenic
1174898582 20:54475613-54475635 GATCCAGCCCTGCCTCCTCCCGG - Exonic
1175155301 20:56967349-56967371 GACTCAGCCTCTCCTCCCCTAGG + Intergenic
1175207183 20:57320144-57320166 GACCCAGCAATTCCACGCCTAGG + Intergenic
1175356012 20:58368818-58368840 GACCCAGTAATTCCACTCCCGGG - Intergenic
1177856061 21:26401376-26401398 GACCCAGCAATCCCTTTCCCAGG - Intergenic
1178426515 21:32483159-32483181 CTCCCTGCCATTCCTACCCCTGG + Intronic
1178481708 21:32985001-32985023 GACCCAGCAATTCCACTCCTAGG + Intergenic
1178599369 21:33982881-33982903 GACCCAGCAATTCCACTCCTAGG - Intergenic
1178674207 21:34616927-34616949 GACCCAGCAATTCCTCTCCTAGG + Intergenic
1178787788 21:35669880-35669902 GATCCAGCAATTCCTCTCCTGGG - Intronic
1178911187 21:36674855-36674877 GAATCAGCCAGTCCTGCCCCAGG + Intergenic
1178941706 21:36912111-36912133 GATCCAGCAATTCCACTCCCAGG + Intronic
1179166008 21:38935659-38935681 GACCCAGCAATTCCACTCCTAGG - Intergenic
1179378570 21:40877205-40877227 GACCCAGCAATTCAACTCCCAGG + Intergenic
1179466005 21:41573443-41573465 GATCCAGCCATGCCACTCCCGGG - Intergenic
1179487590 21:41720611-41720633 GACCCAGCCATTCCATTCCTGGG - Intergenic
1179601245 21:42478673-42478695 GACCCAGCAATTCCACTCCTCGG + Intronic
1179707456 21:43190300-43190322 GACACAGCGATTCCACCCCTAGG - Intergenic
1179914449 21:44467321-44467343 GACACAGCGAGACCTCCCCCTGG - Intergenic
1180244643 21:46538986-46539008 GACCCAACCATTCTCCCTCCTGG + Intronic
1180754469 22:18151104-18151126 GACCCAGCCATTCCACTTCTAGG - Intronic
1180899667 22:19361203-19361225 GACCCTGCCAGTTCTCCCTCAGG - Intronic
1180922376 22:19527546-19527568 GATCCTGCCATTCTTCCCCTGGG - Intergenic
1180940058 22:19655017-19655039 GACCCAGCAATTCCACTCCTGGG + Intergenic
1181384604 22:22534868-22534890 GAACTAGACATTCCTCTCCCTGG - Intergenic
1181836943 22:25618244-25618266 GATCCAGCAATTCCTCTTCCAGG - Intronic
1181959981 22:26616110-26616132 CACCCAGCCACTGCACCCCCAGG + Intronic
1182275577 22:29186318-29186340 GACCCAGCAATTCCACTTCCAGG + Intergenic
1182398204 22:30052692-30052714 GACCCAGCAATTCCACATCCAGG - Intergenic
1182585854 22:31344043-31344065 GACCTCACCATTCTTCCCCCAGG - Intronic
1182587089 22:31350140-31350162 GACCCAGCAATTCCACTCCTAGG - Intergenic
1182817688 22:33180549-33180571 AACCCAGCCATTCCACTCCTAGG + Intronic
1183141119 22:35940563-35940585 GACCCAGCAATTCCACACCTGGG + Intronic
1183142174 22:35952816-35952838 GACCCAGCAATTCCACTCCTAGG + Intronic
1183175183 22:36218576-36218598 GACCCAGCAATTCCTCTGCTGGG - Intergenic
1183699010 22:39439260-39439282 GAGCCAGCAATTCCACTCCCAGG + Intergenic
1183808143 22:40229973-40229995 GACCCAGCCATTCATTGCCTAGG - Intronic
1183950124 22:41348040-41348062 GTCCCAGCCCTTCCCCTCCCTGG + Intronic
1184856389 22:47148860-47148882 GACCCAGCCTTGCCACCTCCTGG + Intronic
1185006452 22:48279449-48279471 GTCCCAGCGATTCCTCCGCCTGG - Intergenic
1185413190 22:50696756-50696778 GGCCCAGCCTCGCCTCCCCCAGG - Intergenic
949277759 3:2306143-2306165 GACCCAGCAATTCCACTCCTAGG - Intronic
949374110 3:3367872-3367894 GACTCTGCCATTCCTCTCCTGGG - Intergenic
949883707 3:8679241-8679263 GAGCCAGCCAATTTTCCCCCTGG + Intronic
949921360 3:9005403-9005425 GACCCAGCAATTCCACTCCTGGG + Intronic
949923040 3:9019220-9019242 GACCCAGCCATCCCTCTTCTGGG - Intronic
949933293 3:9097540-9097562 GACCCAGACTTTCCTCCCACTGG + Intronic
950488687 3:13288948-13288970 GACCCAGCAATTCCACTCCTAGG + Intergenic
950564097 3:13754970-13754992 GACCCAGCAATTCCACTCCTAGG - Intergenic
950590283 3:13932090-13932112 GCCCCAGCAATTCCTCCTACTGG + Intergenic
950710361 3:14809660-14809682 GCCCCAGCAATTCCTCCTACTGG + Intergenic
950907096 3:16548950-16548972 GACCCAGCAATTCCACTCCTAGG + Intergenic
951433324 3:22633533-22633555 GACCCAGCAATTCCACTCTCAGG - Intergenic
951708537 3:25567660-25567682 GACGCAGCAATTCCTCTCCTAGG - Intronic
952430840 3:33221116-33221138 GACCCAGAAATTCCTCTCCTAGG + Intergenic
952694623 3:36250507-36250529 GACTTAGCCATTCCCCCTCCTGG + Intergenic
952921289 3:38285795-38285817 GACCCAGCAATGCTACCCCCAGG - Intronic
952962065 3:38598512-38598534 TTCCCAGCCATTCCTGCCCTAGG - Intronic
952992032 3:38838692-38838714 AACTCAGCCATTCCACTCCCAGG - Intergenic
953053422 3:39367155-39367177 GACCCAGCCATTCCATTACCGGG - Intergenic
953387467 3:42514725-42514747 GCCCCAGCCACTCCTCCTCAGGG + Intronic
953555911 3:43946666-43946688 GACCCAACAATTCCACTCCCAGG - Intergenic
953701367 3:45198419-45198441 GCCCCAGCCACCCCTCCTCCTGG - Intergenic
953753617 3:45628636-45628658 GACCCAGCCATTTCACTCCTAGG + Intronic
953883612 3:46703822-46703844 CATCCAGCCCTTCTTCCCCCAGG - Intronic
954084089 3:48230415-48230437 GAACCAGCCATTCTGCCCCTTGG + Intergenic
954775661 3:53015409-53015431 GACCCAGCAATTCCACTCCTAGG + Intronic
954786932 3:53100410-53100432 GACCCAGCAATTGCACCCCTAGG + Intronic
954842030 3:53520160-53520182 GACCTAGCAATTCCACTCCCAGG - Intronic
955942035 3:64155515-64155537 GACCCAGCAATTCCACTCCTGGG + Intronic
955983905 3:64553559-64553581 GACCCAGCAATTCCACTCCCAGG - Intronic
956130652 3:66050649-66050671 GACCTAGCCATTCCACTCCTAGG + Intergenic
956210890 3:66800002-66800024 GACCTAGCTATTCCTCTCCTAGG - Intergenic
956493585 3:69800450-69800472 GACCCAGCCATTCCGCTCTTAGG - Intronic
956589768 3:70902348-70902370 GACCCAGCAATTGCACTCCCAGG + Intergenic
958587678 3:96111393-96111415 GACCCAGCAATTCCACTCCTAGG - Intergenic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
959170210 3:102835355-102835377 GACCCAGCCATTGCTTCACTAGG + Intergenic
959327224 3:104952681-104952703 GAAGCAGCCACTCCTTCCCCTGG + Intergenic
960590197 3:119358472-119358494 GACCTAGCCATTTCACCCCTTGG + Intronic
961129227 3:124450058-124450080 AACCCAACCATTCCACTCCCAGG - Intronic
961265762 3:125641179-125641201 GACCCAGCAATTCCACTCCTAGG + Intergenic
961472467 3:127124682-127124704 AACCAAGACATTCCTGCCCCTGG - Intergenic
961605562 3:128092821-128092843 GACCCAGCAATTCCACTCCTAGG + Intronic
961667369 3:128501655-128501677 GGCCCAGCCATTCCTTTTCCAGG + Intergenic
961725841 3:128929401-128929423 GACCCAGCAATTCCACTCCTAGG + Intronic
961740916 3:129032754-129032776 GAACCAGGCATCCCTCCCCAGGG - Intronic
961768100 3:129227999-129228021 CCCCCACCCATTTCTCCCCCTGG - Intergenic
962450477 3:135512000-135512022 GATCCAGCCATTCCTCTCCTAGG + Intergenic
962659997 3:137592139-137592161 GACCCAGCAATTCCACTCCTTGG + Intergenic
962698045 3:137970423-137970445 TACCCAGCCCTTCCTCTGCCAGG + Intergenic
962852396 3:139317863-139317885 GACTCAGCCACACCTCCACCAGG - Intronic
963053846 3:141166589-141166611 GATCCAGCCATTCCACTCCTAGG - Intergenic
963189822 3:142456931-142456953 GACCCAGCAATTCCACTCCCAGG + Intronic
963309106 3:143688649-143688671 GACCAGGCCATTCCTAACCCTGG + Intronic
963588404 3:147225068-147225090 GACCCAGCAATTCCACTCCTCGG - Intergenic
963915272 3:150853940-150853962 GACCCAGCAATTCCACTCCTAGG - Intergenic
964883471 3:161451249-161451271 GACCCAGTAATTCCACCCCTAGG - Intergenic
965674248 3:171178195-171178217 GATCCAGCCATTCCACTCTCAGG - Intronic
965884820 3:173432241-173432263 GATCCAGCCATCACACCCCCTGG - Intronic
966542368 3:181106429-181106451 TACTCAGCCCTTCCTCTCCCTGG + Intergenic
966675861 3:182589166-182589188 AACCCAGCCCTTCCACTCCCAGG + Intergenic
966793325 3:183692618-183692640 GACCCAGGCAGTCTGCCCCCAGG - Intergenic
967309694 3:188094338-188094360 GACCCAGCAATTCCACTCCTAGG - Intergenic
967704953 3:192639429-192639451 GACCCAGCAATCCCTCCTCTGGG + Intronic
967829534 3:193907013-193907035 GTCCCAGCAATTCCACCCCTAGG - Intergenic
967977688 3:195044606-195044628 GGCCCAGCCAGGCCTCCCCCTGG + Intergenic
968092199 3:195906299-195906321 GACCCAGCCATTCCGGTCCTAGG + Intronic
968167870 3:196482461-196482483 GACCCAGCAATTCCACTCCTAGG - Intronic
968203565 3:196778402-196778424 GACCCCGCAATTCCACTCCCAGG - Intronic
968290394 3:197534591-197534613 GACCCAGCAATTACACCCCTGGG - Intronic
968510612 4:993914-993936 GACCCCGGCAGTCCTCGCCCTGG - Intronic
968784648 4:2611085-2611107 GACTCAGCAATTCCACTCCCAGG - Intronic
969100865 4:4767235-4767257 GACCCAGCAATTCCACTCCTAGG + Intergenic
969119157 4:4894637-4894659 CACCCAGCCTTTCCTCCATCAGG + Intergenic
969130177 4:4985278-4985300 GTCCCAGCCATTCCCAACCCTGG - Intergenic
969233001 4:5844825-5844847 GACCCAGCCATTCCTCTCTTAGG + Intronic
969720345 4:8890084-8890106 GCCTCAGCCCTTCCTTCCCCCGG - Intergenic
970390910 4:15612830-15612852 GATCCAGCAATTCCTGTCCCAGG + Intronic
970407518 4:15778176-15778198 GACCCACCCACTCCACCTCCAGG - Intergenic
970610647 4:17722057-17722079 GGCCCTGCCACTCCTCCTCCTGG - Intronic
971107396 4:23541962-23541984 GACTTAGCCATTCCACCTCCAGG + Intergenic
971628029 4:28949447-28949469 GACCCAGCAATTCTTCTCCTGGG + Intergenic
973596531 4:52496645-52496667 GGCCCAGGCATTCCTCTCCTAGG + Intergenic
974459410 4:62167588-62167610 GACCCAGCCATCCCACCACTGGG - Intergenic
974529614 4:63090825-63090847 GACTCAGCAATTCCACCCCTAGG - Intergenic
975553179 4:75633751-75633773 GACCCAGCAATTCCACTTCCAGG + Intergenic
976400352 4:84599896-84599918 GACCCAGCCATTTCACTCCTAGG - Intronic
976763494 4:88574927-88574949 GACCCAGCCATTCTACTCCTGGG - Intronic
976828268 4:89284196-89284218 CACCCACCCATTCCTTCACCTGG - Intronic
977356167 4:95949974-95949996 GACCCAGCAATCCCTCTCCTGGG + Intergenic
978155703 4:105487411-105487433 GACCCAGCAATTCCTCTTCCAGG + Intergenic
978787346 4:112624825-112624847 GACCCAGCAATTCCACTCCTAGG + Intronic
979250182 4:118559339-118559361 AACCCAGCCATTCCACTCCTAGG + Intergenic
981763955 4:148226570-148226592 GACCCAGGAATTCCACTCCCAGG - Intronic
981901730 4:149873320-149873342 GACCCAGTCATTCCACCCATAGG - Intergenic
982139118 4:152300830-152300852 GACCCAGCAATTCCACTCCTAGG + Intergenic
982223544 4:153145101-153145123 TACCCAGCCATTCCACTCCTAGG - Intergenic
982454455 4:155592039-155592061 GATCCAGCCTTTCCTCCGCCTGG - Intergenic
983251790 4:165354052-165354074 GACCCAGCAATTCCACTCCTAGG + Intergenic
983400742 4:167262712-167262734 GACCCAGCCATTCCATCACTGGG + Intergenic
983900132 4:173124886-173124908 GACCCATCAATTCCACCCCTAGG - Intergenic
984007033 4:174324404-174324426 GACCCAGCCATCCCACTCCTAGG - Intronic
984815905 4:183835879-183835901 GACCCAGCAATTCCACTCCTAGG - Intergenic
984941275 4:184934427-184934449 GACTCAGCCATTCCTCTCCTAGG + Intergenic
984991112 4:185382380-185382402 GACCCAGCAATTCCACTCCTAGG - Intronic
985577343 5:679441-679463 GACCTGGCCCTTCCACCCCCAGG - Intronic
985592275 5:771541-771563 GACCCAGCCTTTCCACCCCCAGG - Intergenic
985724132 5:1506784-1506806 GGCACAGCCATTCCTCCCCACGG + Intronic
986369735 5:7068228-7068250 GACACTGCCAAGCCTCCCCCTGG - Intergenic
986826332 5:11526731-11526753 GATCCAGCCATTCCACTCCTAGG + Intronic
988655127 5:33202598-33202620 GACCCAGTAATTCCACTCCCAGG - Intergenic
988710960 5:33774235-33774257 GAACCAGACATTCCTGCCCATGG + Intronic
990209533 5:53467720-53467742 GACCCAGCAATTCCACACCCAGG + Intergenic
991365538 5:65864150-65864172 GACCCAGCAATTCCACCCCTTGG - Intronic
991495131 5:67219124-67219146 GAACCAACAATTCCTCCCCATGG + Intergenic
991705177 5:69350689-69350711 GACCCAGCAATTCCCCTCCCAGG + Intergenic
991722944 5:69510768-69510790 GACCCAGCAATTCCACCCCTAGG - Intronic
992485896 5:77194954-77194976 GACTCAGCAATTCCACTCCCAGG - Intergenic
992493050 5:77264281-77264303 GACCCAGCAATTTCACCCCTAGG - Intronic
992911131 5:81397200-81397222 GCCCCAGCCATCCCTCCCACTGG + Intergenic
996033161 5:118729446-118729468 GACCCAGCAATTCCACACCTAGG + Intergenic
996583893 5:125063383-125063405 GACCCAGCAATTCCTCTCCTAGG + Intergenic
997313068 5:132906235-132906257 GACCCAGCCATTCCACTCTTAGG + Intronic
997396365 5:133563137-133563159 GACAGAGCCATTCCTCCTTCAGG - Intronic
997515708 5:134488058-134488080 GACCCAGCCATTCCATTCCTAGG - Intergenic
997566685 5:134893383-134893405 TACCCACCCGTTCCTCTCCCTGG + Intronic
997759988 5:136436198-136436220 GACCAAGCCATTCTTCTCCAAGG - Intergenic
997954272 5:138266186-138266208 GACCCAGCAATTCCATCCCTAGG - Intronic
998128293 5:139638428-139638450 GGCCCAGCCTGTCCTCCCCGCGG - Intergenic
998241391 5:140448395-140448417 GACCCAGCAATTCCACTTCCAGG - Intronic
998255863 5:140587358-140587380 GACCCAGCTATTCCACTCCTAGG + Intronic
998394716 5:141811431-141811453 AACTCATCCCTTCCTCCCCCTGG + Intergenic
998416004 5:141946492-141946514 GAGCTGGCCCTTCCTCCCCCTGG + Intronic
998525557 5:142840032-142840054 GACACAGGCACTCCTCCACCAGG - Intronic
999273855 5:150315198-150315220 GACCCAGCAATTCCACTCCTAGG + Intronic
1000287038 5:159835740-159835762 GACCAGGCCCTTCCTGCCCCAGG - Intergenic
1000305681 5:159992369-159992391 GACCCAGCAATTCCACTCCTAGG + Intergenic
1000341790 5:160282943-160282965 GACCCAGCCATTCCAGTCCTTGG + Intronic
1000905090 5:166956442-166956464 GACCCAGCCATTTCTCTCCTAGG + Intergenic
1001106031 5:168855346-168855368 GACCCAGCAATTCCATCCCTAGG + Intronic
1001317011 5:170650679-170650701 GATCCAGCAATTCCACCCCTAGG - Intronic
1001554647 5:172628024-172628046 GATCCAGCAATTCCTCTCCTGGG - Intergenic
1001573206 5:172744365-172744387 GCCCCAGCCTGTCCTTCCCCTGG + Intergenic
1001683034 5:173572703-173572725 GAGCCAGCCATTGCTCCCCCTGG - Intergenic
1002072563 5:176688963-176688985 GACCCAGCAATTCCACTCCTGGG + Intergenic
1002095351 5:176827664-176827686 GACCCAGCAATTCCACTCCTAGG - Intronic
1002348951 5:178568938-178568960 GACCCAGCAATTCCACTCCCAGG - Intronic
1002400198 5:178987288-178987310 GACCCAGCAGTTCCACTCCCGGG + Intronic
1002517541 5:179770696-179770718 GATCCAGCAATTCCACTCCCAGG - Intronic
1002544246 5:179928207-179928229 GACCCAGCAATCCCACTCCCAGG - Intronic
1002693877 5:181071061-181071083 GACCCAACAATTCCACTCCCAGG + Intergenic
1002962919 6:1933388-1933410 GACCCAGCAATTCCACCCCTAGG - Intronic
1003189238 6:3858758-3858780 GACCCAGCAATTCCACTCCTAGG - Intergenic
1003758054 6:9144579-9144601 GACCCAGCAATTCCACTCCTAGG - Intergenic
1003819169 6:9876890-9876912 GGCCGCGCCACTCCTCCCCCAGG + Intronic
1004513633 6:16303286-16303308 GACACTGCGGTTCCTCCCCCGGG + Exonic
1004968879 6:20886365-20886387 GACCCAGCAATTTCTCTCCTAGG + Intronic
1005335101 6:24788319-24788341 GACTCAGCCATTCCACCCCTGGG + Intergenic
1005455188 6:26012984-26013006 GACCCAACAATTCCTCTCCTAGG + Intergenic
1005907345 6:30275498-30275520 GACCCAGCAATTCCATTCCCAGG + Intergenic
1006463444 6:34177256-34177278 GACCCAGGCCTTCCCCCCTCTGG + Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007222593 6:40290883-40290905 GACCCAGGGATTCCTGACCCTGG - Intergenic
1007713696 6:43841046-43841068 GACCCAGCAATTCTACTCCCTGG - Intergenic
1007741521 6:44012728-44012750 GAGTGAGCCATTCCTCCCCAGGG + Intergenic
1008064639 6:47034499-47034521 GGCTCAGTCACTCCTCCCCCAGG + Intronic
1008580381 6:52901642-52901664 GACCCAGCAATTCCTCTACTAGG - Intronic
1008625478 6:53311459-53311481 GACCCAGCAATTCCACTCCTAGG + Intronic
1009927391 6:70135907-70135929 GAACCAACAATTCCACCCCCTGG - Intronic
1010841319 6:80651268-80651290 CACCCAGGCCTGCCTCCCCCAGG - Intergenic
1011135735 6:84098483-84098505 GACCCAGACATTCCTCTTCTAGG - Intergenic
1011658084 6:89569608-89569630 GACCCAGCAATTCCACTCCTAGG - Intronic
1011730437 6:90257239-90257261 GACCCAGCCATTCCTTTTCTGGG - Intronic
1012457099 6:99419242-99419264 GACCCAGCAATTCCACCGCAGGG + Intronic
1012917358 6:105184812-105184834 GACCCAGCAATTCTTCCCCTAGG - Intergenic
1013026628 6:106280220-106280242 GACCCAGCCATTCCACAACTAGG + Intronic
1013282791 6:108654459-108654481 TACCCAGCCCTTTCTCCCCTTGG + Intronic
1013347938 6:109280231-109280253 GATCCAGCCATTCCTCTCCTAGG + Intergenic
1013821554 6:114159218-114159240 GGCCCAGCCATTCCACTCCTTGG + Intronic
1014116030 6:117669867-117669889 GTCCCAGCCATTCCAGCCCATGG + Intergenic
1014489080 6:122039509-122039531 GACCCAGCAATTCCACTCCATGG + Intergenic
1017048123 6:150366056-150366078 AACTCAGCCATTCCTTCCTCTGG + Intergenic
1017128044 6:151084311-151084333 GCCCCAGCCATTTCTCTCCACGG - Intronic
1017500103 6:155016142-155016164 GACCCAGCAGTTCCTCCCCTGGG + Intronic
1018255916 6:161919010-161919032 GAGCCAGCAATTCCTCTCCTAGG + Intronic
1018457203 6:163963050-163963072 ACCCCAGCCGTTCCTCCCACGGG - Intergenic
1018654616 6:166023726-166023748 GACCCAGCAATTCCACTCCTTGG + Intergenic
1018725228 6:166607261-166607283 GATCCAGCAATTCCACTCCCAGG + Intronic
1018733950 6:166673432-166673454 GACTCAGTCATTTCTCCTCCAGG - Intronic
1018813958 6:167317256-167317278 GGCCCTGCCATTCCTCCCCCAGG + Intergenic
1018942876 6:168320873-168320895 GATCCAGCCATTCCTCTCTTAGG - Intergenic
1019367368 7:641283-641305 GACCCAGCAATTCCACTCCTAGG + Intronic
1019551489 7:1605046-1605068 GACCCAGTCATTCCACCCCTGGG + Intergenic
1019687903 7:2391922-2391944 GACCAAGCCAGTCCTCAGCCTGG + Intergenic
1019881336 7:3863945-3863967 AACCCAGCAATTCCACTCCCAGG - Intronic
1021095492 7:16530735-16530757 GATCCAGCCATTCTACCTCCAGG - Intronic
1021119156 7:16778429-16778451 GACCCAGCCAAGCCTGACCCAGG - Intronic
1021437639 7:20638873-20638895 GACCCAGCAATTCCACTCCTAGG - Intronic
1021441278 7:20679891-20679913 GACTCAGCAATTCCTCTCCTAGG + Intronic
1021470473 7:20996654-20996676 GACCCAGCAATTCCACTCCTAGG - Intergenic
1021527341 7:21603418-21603440 GACCCAGCAATTCCACTCCTAGG - Intronic
1021862455 7:24920120-24920142 GACCCAGCAATTCCACTCCCAGG + Intronic
1022131693 7:27410654-27410676 GGCCCAGCAATTCCACTCCCAGG + Intergenic
1022138663 7:27473226-27473248 GACCCAGCAATTCCTCTTCTAGG - Intergenic
1022236141 7:28462436-28462458 GACCCAGCCATTCCACTCCTGGG - Intronic
1022657441 7:32332512-32332534 GACCCAGCCATTCCACTCCTAGG + Intergenic
1022937483 7:35193801-35193823 GACCCAGCAATTCCACTCCTAGG - Intergenic
1022994115 7:35736940-35736962 GACCCAGCAATTCCTCTCCTAGG + Intergenic
1023787971 7:43727345-43727367 GACCCAGCCATTTCACTCCTAGG + Intronic
1023893444 7:44411769-44411791 GACCCAGCAATTCCACCCATAGG + Intronic
1023986131 7:45097440-45097462 GACCCAGCAATTCCACTCCTAGG + Intergenic
1024039512 7:45540939-45540961 GACCCAGCCATTCCACTCCTGGG + Intergenic
1024636301 7:51293234-51293256 GACTCAGCCATTCCACTCCTTGG + Intronic
1025829569 7:65038052-65038074 GCCCCACCCCTTTCTCCCCCGGG + Intergenic
1025916806 7:65873001-65873023 GCCCCACCCCTTTCTCCCCCGGG + Intergenic
1026016914 7:66678736-66678758 GCCCCAGGCAGTCCTCCCACAGG + Intronic
1026471389 7:70695623-70695645 GACCCAGCGATTCCTGCTTCAGG - Intronic
1026890923 7:73981821-73981843 GACCCAGCCACTCCACCCGTAGG + Intergenic
1029135661 7:98368980-98369002 GACGCAGCCATTGAACCCCCAGG - Intronic
1029379997 7:100207232-100207254 GAACCAGCAATTCCACTCCCAGG - Intronic
1029833644 7:103286444-103286466 GACCCAGCAATTCCACTCCTAGG - Intergenic
1030813112 7:114000943-114000965 GAACCAGCAATTCCACTCCCAGG + Intronic
1030971495 7:116062921-116062943 GACCCAGCCATTCCACTCTTAGG + Intronic
1031495624 7:122444323-122444345 GACCCAGCCATTCCATTCCTAGG - Intronic
1031935174 7:127728645-127728667 GACCCTGCCATTCCTGGCCTTGG - Intronic
1032124321 7:129181495-129181517 GATCCAGCAATTCCACCCCTAGG - Intergenic
1033562840 7:142549180-142549202 GACTCAGCAATTCCACCCCTAGG - Intergenic
1033569440 7:142613355-142613377 AACCCAGCCATCCCTCTCCTAGG + Intergenic
1033891090 7:146014074-146014096 GACCCAGCCATTCCTTTACTGGG - Intergenic
1034416561 7:150968229-150968251 GATCCAGCAATTCCACTCCCGGG + Intronic
1034508337 7:151514645-151514667 GACCCAGCAATTCCACTCCTAGG + Intronic
1036591383 8:10172098-10172120 CACCCTGCCATTCCTGACCCCGG - Intronic
1036823189 8:11955836-11955858 GACCCAGGCTTTCCTCCCTGCGG - Intergenic
1037578124 8:20226985-20227007 GACCCAGCCATTCCACTCCTAGG - Intergenic
1037761334 8:21743693-21743715 AACCCAGCCAGTCCTCCCTGGGG - Intronic
1038038545 8:23705806-23705828 GACCCCCCCATTCCTCCTCATGG - Intronic
1038056903 8:23867332-23867354 GACCTAGCCATTCCACTCCTAGG - Intergenic
1038183451 8:25250082-25250104 GACCCAGCAATTCCACTCCTAGG - Intronic
1038283468 8:26186411-26186433 AACCCAGCCATTGCTTCCTCTGG - Intergenic
1038334598 8:26636041-26636063 GACCCAGCGACTCCTGGCCCTGG + Intronic
1038370032 8:26979655-26979677 GACCCAGCAATTCCACTCCTAGG - Intergenic
1038388816 8:27175669-27175691 AAGCCAGCCATGCCTCCCGCAGG + Intergenic
1038433472 8:27518552-27518574 GACCCAGTCTCTCCTCCCCTTGG - Intronic
1038447743 8:27615586-27615608 GTCGCAGCCACCCCTCCCCCTGG + Intergenic
1038517201 8:28197246-28197268 ACCCCAGCCCTTCCTCCTCCAGG + Intergenic
1038809364 8:30824307-30824329 GATCCAGCAATTCCTCTCCTGGG - Intergenic
1039152471 8:34522035-34522057 GACTCTACCATTCCTGCCCCAGG - Intergenic
1040040651 8:42913637-42913659 GATCCAGCCACTCCTCTCCTAGG - Intronic
1040053442 8:43037121-43037143 GACCTAGCCATTCCACTCCTAGG - Intronic
1041047638 8:53902397-53902419 GACCCAGCCATTCCAGGCCTTGG - Intronic
1041074650 8:54158311-54158333 GACCCAGCAATTCCACTCCTAGG - Intergenic
1041092810 8:54318522-54318544 TGCCCAGCCAGTCCTTCCCCAGG - Intergenic
1041099798 8:54384487-54384509 GACCCAGCAATTCCTCTCCTAGG - Intergenic
1041370561 8:57155432-57155454 GACCCAGCAATTCCACTACCAGG - Intergenic
1041592381 8:59603243-59603265 GACCCAGCAATTCCACTCTCAGG - Intergenic
1042263611 8:66886118-66886140 GACCCAGCAATTCTTCTCCTAGG - Intronic
1042398610 8:68319417-68319439 GATCCAGCAATTCCACCCCTAGG - Intronic
1042434724 8:68749985-68750007 GACCCAGCAATTCCACTCCTAGG - Intronic
1042881301 8:73493720-73493742 GACCCAGCAATTCCACCTCTAGG + Intronic
1042901031 8:73727729-73727751 GACCCAGCAATTCCACTCCTAGG - Intronic
1043231728 8:77810929-77810951 GATCCAGCAATTCCTCCACTGGG + Intergenic
1043519798 8:81032698-81032720 GACCCAGCAATTCCACTCCCAGG + Intronic
1044994316 8:97824205-97824227 GACCCAGCAATTCCACTCCTAGG - Intronic
1045322756 8:101094500-101094522 GACCCAGCAATTCCACTCCTAGG - Intergenic
1045501814 8:102749247-102749269 GAACATGCCATTCCTCCCGCTGG - Intergenic
1045588677 8:103567677-103567699 GACCCAGCAATTCCACTCCTAGG - Intronic
1046371820 8:113319061-113319083 GACCCAGCAACTCCTCTTCCAGG - Intronic
1046558027 8:115800709-115800731 GACCCAGCAATCCATCCCCAAGG + Intronic
1047755409 8:127914439-127914461 GACCCAGCAATTCCACTCCTAGG + Intergenic
1047774867 8:128061518-128061540 GACCCAGCAATTCCACTCCTAGG - Intergenic
1048476606 8:134748139-134748161 GACCCAAGCAATCATCCCCCAGG + Intergenic
1049169811 8:141152761-141152783 GACCCAGCAATTCCACTCCTAGG - Intronic
1049242638 8:141546060-141546082 GACCCAGCAATTCCACTCCCAGG - Intergenic
1049527015 8:143132151-143132173 GACCCAGGCATTCCTTGCCTAGG + Intergenic
1049609987 8:143550402-143550424 GACCCAGCCACACCCACCCCGGG + Intergenic
1049723678 8:144134937-144134959 AACCCAGCAATTCCACTCCCAGG - Intergenic
1049822414 8:144644041-144644063 GACCCAGCAATTCCACTCCCAGG + Intergenic
1049873945 8:145003165-145003187 GACCCGGCCCTTCCTCACCTAGG + Intergenic
1052077500 9:24161098-24161120 GACCCAGCAATTCCACTCCTAGG - Intergenic
1053448770 9:38174953-38174975 GATCCAGCAATTCCTCTCCTAGG + Intergenic
1053474659 9:38373364-38373386 GACCCAGCAATTCCACTCCTAGG + Intergenic
1053518372 9:38752108-38752130 GGCACTGCCATTCCTCCCCTTGG + Intergenic
1053736733 9:41107214-41107236 GAGCCAGCCGCTCTTCCCCCCGG + Intergenic
1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG + Intergenic
1054156347 9:61643448-61643470 GACCCAGGCATTATTTCCCCAGG - Intergenic
1054177074 9:61882659-61882681 GACCCAGGCATTATTTCCCCAGG + Intergenic
1054476119 9:65574458-65574480 GACCCAGGCATTATTTCCCCAGG - Intergenic
1054660460 9:67698147-67698169 GACCCAGGCATTATTTCCCCAGG - Intergenic
1054785638 9:69207568-69207590 GACCCAGTGATTCCTCTACCTGG - Intronic
1055021977 9:71679863-71679885 GACCCAGGCGCTCCTCCCTCAGG + Intergenic
1055884582 9:81045851-81045873 GACCCAGCAATTCCACCCCTAGG + Intergenic
1056095524 9:83249928-83249950 GACCCAGCAATACCACTCCCAGG + Intronic
1056421119 9:86427405-86427427 GACCCAGCAATTCCACTCTCAGG - Intergenic
1056729259 9:89150722-89150744 GACCCAGCAATTCCACTCACAGG - Intronic
1056830973 9:89917159-89917181 GACCAAGCCAATCCTCTACCTGG - Intergenic
1056871484 9:90285454-90285476 GACCCAGCAATTCCACTCCTAGG + Intergenic
1057310183 9:93938065-93938087 GACCCAGCAGTTCCACCCCTGGG + Intergenic
1057350791 9:94295890-94295912 AACCCAGCCATTCCAGTCCCAGG - Intronic
1057500342 9:95592701-95592723 GACCCAGCAATTCCACACCTAGG + Intergenic
1057573359 9:96220187-96220209 GACCCAGCCATTCTACTCCTAGG + Intergenic
1057597418 9:96426770-96426792 GACCCAGCAATTCCACACCTAGG - Intergenic
1057738948 9:97694731-97694753 GACCCAGCAATTCCATCTCCAGG + Intronic
1057793271 9:98138085-98138107 GACCCAGCAATTCCACTCCTAGG + Intronic
1057949035 9:99355272-99355294 GACCCAGCCATTCAACTACCAGG + Intergenic
1058268254 9:102934503-102934525 GACCCAGCCATTGCACTCCTGGG - Intergenic
1059217335 9:112576857-112576879 GACCCAGCAATTCCACTCCTAGG - Intronic
1060045254 9:120335304-120335326 GACCCAGCAATTCCACTCCTGGG + Intergenic
1060082717 9:120666623-120666645 GACCCAGCAATTCCACTCCTAGG + Intronic
1060146350 9:121255838-121255860 GATCCAGCAGTTCCACCCCCAGG - Intronic
1060171340 9:121463827-121463849 GGCCCAGACATCCTTCCCCCAGG + Intergenic
1060205154 9:121678479-121678501 GACCCAGCAATTCCACTCCTGGG - Intronic
1060327896 9:122635006-122635028 GACCCAGCAATCCCTCTCCTGGG + Intergenic
1060486951 9:124053913-124053935 GACCCAGCAATTCCACTCCTGGG - Intergenic
1061011632 9:127959130-127959152 GACCCAGCAATTTCACCCCTAGG + Intronic
1061380962 9:130257252-130257274 GACCCAGCAATTCCACCACTAGG - Intergenic
1061549145 9:131323038-131323060 GAACCAGCGATTCCGCTCCCAGG - Intergenic
1061804253 9:133129253-133129275 CACAGAGCCCTTCCTCCCCCTGG + Intronic
1061819642 9:133219751-133219773 GACCCAGCAGTTCCACTCCCAGG + Intergenic
1061827691 9:133271752-133271774 GACCCAGCAATTCCTCTGCTGGG + Intronic
1061871244 9:133521921-133521943 GACAGAGCCATTCCTGCTCCTGG - Intronic
1061925564 9:133804558-133804580 CAGCCAGCCATTCCTCCTCCAGG + Intronic
1062020457 9:134316922-134316944 TTCCCAGCCACCCCTCCCCCAGG - Intergenic
1062140218 9:134952354-134952376 GACCCAGCAATTGCACCCCTAGG - Intergenic
1062284703 9:135767839-135767861 GTGCCTGCCCTTCCTCCCCCAGG - Intronic
1062335813 9:136066612-136066634 GACCCAGCAATTCCAACCCTAGG + Intronic
1062450167 9:136611883-136611905 GACCCAGCAACTCCACCCCTAGG + Intergenic
1185753476 X:2633103-2633125 GACCCAGCCATTCCCCTCCTGGG - Intergenic
1186208994 X:7230330-7230352 GACCCAGCCATTCCACTCCTAGG + Intronic
1186209077 X:7230993-7231015 GACCCAGCCATTCCACTCTTAGG + Intronic
1186416867 X:9391422-9391444 GACCCAGCAATTCCACTCCTGGG + Intergenic
1186493796 X:9995986-9996008 GGCTCAGCCATTCCTCCGCTAGG - Intergenic
1186747839 X:12587819-12587841 GACCCAGCAATTCCACTCCTAGG - Intronic
1187069740 X:15876475-15876497 GACCCAGCAATTCCACTCCTAGG - Intergenic
1187305185 X:18088793-18088815 GACCCAGCAATTCCTCTCCTAGG + Intergenic
1187525425 X:20049696-20049718 GACCCAGCAATTCCACTCCTAGG - Intronic
1187564665 X:20436783-20436805 GACCCAGCTATTACACCTCCAGG - Intergenic
1187740175 X:22347125-22347147 GACCCAGCAATTCCACCCCTAGG - Intergenic
1187824688 X:23323156-23323178 GACCCAGCAATTCCACTCCTAGG + Intergenic
1187930352 X:24287902-24287924 GACCCAGCAATTCCACTCCTAGG - Intergenic
1188065399 X:25653087-25653109 GACCCAGCAATTCCTCTTCTGGG - Intergenic
1188164687 X:26847369-26847391 GACCCAGCAATTCCACTCCTAGG - Intergenic
1189167793 X:38878546-38878568 GACCCAGCAATTTCTCTCCTAGG - Intergenic
1189277905 X:39800143-39800165 AACCCAGGAATTCCTCTCCCAGG + Intergenic
1189304530 X:39976829-39976851 GACCTAGCCATTCCACTCCTAGG + Intergenic
1189390702 X:40574122-40574144 GACCCAGCAATTCCACTCCTGGG + Intergenic
1189407105 X:40735312-40735334 GCCCCAGCCCCTCCTCCCCCGGG - Exonic
1189432299 X:40958480-40958502 GACCCAGCAATTCCACTCCTAGG + Intergenic
1189445981 X:41082052-41082074 GACCCAGCAATTCCACTCCTAGG - Intergenic
1189566250 X:42244321-42244343 GACCTTGCCACTCCTCCACCTGG - Intergenic
1190360127 X:49640989-49641011 AACCCAGCCATTCCACTCCTAGG - Intergenic
1190689771 X:52903767-52903789 GACCCAGCCATCCCACTCCTGGG - Intronic
1190696212 X:52952025-52952047 GACCCAGCCATCCCACTCCTGGG + Intronic
1190726939 X:53195888-53195910 GACCCTGCCACTCCCACCCCAGG - Intronic
1190895662 X:54615430-54615452 GACCCAGCAATTCCACTCCTAGG - Intergenic
1191803697 X:65109711-65109733 GACCCGGCAATTCCACTCCCTGG - Intergenic
1191854312 X:65610618-65610640 GACCCAGCAATTCCACTCCTTGG - Intronic
1192148979 X:68700167-68700189 AACGTAGCCATTCCTTCCCCTGG + Intronic
1192276228 X:69633876-69633898 GACCCAGCAATTCCACCACTAGG - Intronic
1192375689 X:70559044-70559066 GACCCAGCAATTCCACTCCTAGG + Intronic
1192418589 X:71008106-71008128 GACCCAGCAATTCCACTCCTAGG + Intergenic
1192849300 X:74937391-74937413 GACCCAGAAATTCCACTCCCAGG - Intergenic
1192906213 X:75553950-75553972 GACCCAGCAATTCCTCTTCTGGG - Intergenic
1192912711 X:75622004-75622026 GACCCAGCCATTCCTTTACTGGG + Intergenic
1192980842 X:76339427-76339449 GATCCAGCAATCCCACCCCCTGG + Intergenic
1193001268 X:76565174-76565196 GACCCAGCCATTCCTTTACTGGG + Intergenic
1194439671 X:93916464-93916486 CACCCATCCCTCCCTCCCCCAGG - Intergenic
1194445840 X:93986524-93986546 GTGCTGGCCATTCCTCCCCCTGG - Intergenic
1194750567 X:97679742-97679764 GACCCAGCAATTCCACTCCTAGG + Intergenic
1195297666 X:103495826-103495848 GACACAGCAATTCCACCCCTAGG - Intergenic
1195927686 X:110042539-110042561 GACCCAGCAATTCCACTCCTAGG - Intronic
1196284708 X:113865498-113865520 GACCCAGCAATTCTACTCCCAGG + Intergenic
1196749622 X:119103574-119103596 GACCCAGCAATTCCACTCCTAGG + Intronic
1196888935 X:120273887-120273909 GACCCAGCAATTCCACCCATAGG + Intronic
1197418944 X:126212977-126212999 AACCCAGCCATTCCACTCCTAGG - Intergenic
1197621165 X:128750984-128751006 GACCCAGCAATTCCACTCCTAGG + Intergenic
1197731974 X:129818372-129818394 GACCCAGCAATTCCACTCCTGGG - Intronic
1198033003 X:132773452-132773474 GACCCAGCAATTCCACTCCTAGG + Intronic
1198154212 X:133942263-133942285 GACCCAGCAATTCCACTTCCAGG + Intronic
1198238492 X:134760442-134760464 GACCCAGTAATTCCACCCCTAGG + Intronic
1198935595 X:141900084-141900106 GACTCATCCATCTCTCCCCCAGG + Intergenic
1198937223 X:141911050-141911072 GACCGATCCATCCCTCCCGCTGG + Intergenic
1198961830 X:142191815-142191837 GACCGATCCATCCCTCCCGCTGG - Intergenic
1199267281 X:145843391-145843413 GTCACAGCCACCCCTCCCCCAGG - Intergenic
1199794961 X:151185245-151185267 GACCCAGCAATTCCACTCCTAGG - Intergenic
1201552520 Y:15233557-15233579 GACCCAGCAATTCCACTCCTAGG + Intergenic
1202273417 Y:23092228-23092250 GACCCTGCAATTCCACTCCCAGG + Intergenic
1202292609 Y:23328454-23328476 GACCCTGCAATTCCACTCCCAGG - Intergenic
1202426414 Y:24725972-24725994 GACCCTGCAATTCCACTCCCAGG + Intergenic
1202444375 Y:24944114-24944136 GACCCTGCAATTCCACTCCCAGG - Intergenic