ID: 948193925

View in Genome Browser
Species Human (GRCh38)
Location 2:236080948-236080970
Sequence TGGCAACCTAACTGCAGATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948193925_948193930 6 Left 948193925 2:236080948-236080970 CCGTATCTGCAGTTAGGTTGCCA 0: 1
1: 0
2: 0
3: 6
4: 126
Right 948193930 2:236080977-236080999 GTCACATAGTCACAGGTCCTGGG 0: 1
1: 6
2: 22
3: 214
4: 659
948193925_948193931 7 Left 948193925 2:236080948-236080970 CCGTATCTGCAGTTAGGTTGCCA 0: 1
1: 0
2: 0
3: 6
4: 126
Right 948193931 2:236080978-236081000 TCACATAGTCACAGGTCCTGGGG 0: 1
1: 4
2: 35
3: 209
4: 575
948193925_948193929 5 Left 948193925 2:236080948-236080970 CCGTATCTGCAGTTAGGTTGCCA 0: 1
1: 0
2: 0
3: 6
4: 126
Right 948193929 2:236080976-236080998 GGTCACATAGTCACAGGTCCTGG 0: 1
1: 6
2: 21
3: 154
4: 444
948193925_948193928 -1 Left 948193925 2:236080948-236080970 CCGTATCTGCAGTTAGGTTGCCA 0: 1
1: 0
2: 0
3: 6
4: 126
Right 948193928 2:236080970-236080992 ATGTAAGGTCACATAGTCACAGG 0: 2
1: 14
2: 131
3: 460
4: 913
948193925_948193935 30 Left 948193925 2:236080948-236080970 CCGTATCTGCAGTTAGGTTGCCA 0: 1
1: 0
2: 0
3: 6
4: 126
Right 948193935 2:236081001-236081023 ATTAGGACGTTGACATCTTTGGG 0: 2
1: 82
2: 278
3: 686
4: 1259
948193925_948193932 13 Left 948193925 2:236080948-236080970 CCGTATCTGCAGTTAGGTTGCCA 0: 1
1: 0
2: 0
3: 6
4: 126
Right 948193932 2:236080984-236081006 AGTCACAGGTCCTGGGGATTAGG 0: 1
1: 30
2: 217
3: 655
4: 1615
948193925_948193934 29 Left 948193925 2:236080948-236080970 CCGTATCTGCAGTTAGGTTGCCA 0: 1
1: 0
2: 0
3: 6
4: 126
Right 948193934 2:236081000-236081022 GATTAGGACGTTGACATCTTTGG 0: 1
1: 84
2: 255
3: 649
4: 1151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948193925 Original CRISPR TGGCAACCTAACTGCAGATA CGG (reversed) Intronic
904450029 1:30605165-30605187 TTTCAACCTCACTGCAGACAAGG - Intergenic
906689057 1:47780760-47780782 TGGGAAGCTAACTGCAGAAGAGG + Intronic
916985039 1:170181949-170181971 TGGCAATATAAGTGCAGGTAAGG + Intergenic
923399780 1:233605102-233605124 TGGCAGTTTAACTGCAGAAATGG + Intergenic
923427036 1:233881276-233881298 TTGCACCCTAAATGCAGAGATGG - Intergenic
923927021 1:238642428-238642450 TGGCAACCAAACAGGAGCTAAGG - Intergenic
1065912449 10:30320668-30320690 TGGGAACCAAACTTGAGATAAGG + Intronic
1065992605 10:31027647-31027669 TGGGAAACTAACTGCAAATGTGG + Intronic
1068193602 10:53686729-53686751 TGCCAAAATAACAGCAGATAAGG - Intergenic
1068488772 10:57695477-57695499 TGGCAACCTGAGTGCACAAATGG - Intergenic
1068558891 10:58490370-58490392 TGGCACCCTTACTGAAGATTAGG - Intergenic
1068818633 10:61347073-61347095 TGGCAAGCTGACTGCAGATGGGG - Intergenic
1069153137 10:64991257-64991279 TGGCAACTGAACTGAAGATTTGG + Intergenic
1071142171 10:82522009-82522031 CGGAAAAGTAACTGCAGATATGG - Intronic
1071521074 10:86331749-86331771 TGGCAACTTGTCTGCAGATGAGG - Intronic
1073220763 10:101871585-101871607 TGGCAACATAACTGAATATTTGG + Intronic
1073598885 10:104827061-104827083 GGACAAAGTAACTGCAGATATGG - Intronic
1073705734 10:105981764-105981786 TGGCAACCACACTCCACATAAGG - Intergenic
1077606521 11:3616298-3616320 TGGCAGCCTAACCCCACATACGG - Intergenic
1077719411 11:4612495-4612517 TAGCAACCTATCTGCAGCCAAGG + Intergenic
1078623078 11:12926651-12926673 TGGAGACCTAGCTGCAGAGAGGG + Intronic
1080726911 11:34907101-34907123 TGTCACCCTAACTGCTGTTAGGG - Intronic
1081008777 11:37781570-37781592 AGGCAACTAAACTGCAGAGATGG - Intergenic
1081388242 11:42498802-42498824 AGGCAAGCTAACTGGAGAGAGGG - Intergenic
1081716112 11:45251770-45251792 TGGCCCCCCAACAGCAGATATGG + Intronic
1081871226 11:46383419-46383441 GGTCAGCCTAACTGCTGATATGG + Intronic
1083037090 11:59648780-59648802 TGTCAGCCTAACTCCAGACACGG + Intronic
1085472355 11:76766543-76766565 TGCCAGCCTAACTGCAGCCAAGG + Intergenic
1090939913 11:131378180-131378202 TTTCAACCTGACTGCAGATTAGG - Intronic
1092512421 12:9170884-9170906 AGTCAACCAAACTGCAGAGATGG - Intronic
1094481078 12:30881910-30881932 TAGCAAACTAACTGCACACAAGG + Intergenic
1094660528 12:32466343-32466365 TGCCAACCCCACTGCAGATTTGG - Intronic
1097889880 12:64767311-64767333 TGGCTACTTAAATGGAGATATGG - Intergenic
1099258758 12:80348988-80349010 TGGGAACCTAACTACATATCAGG - Intronic
1099677537 12:85781412-85781434 TGGAAATCAAAATGCAGATATGG + Intergenic
1102154629 12:110714855-110714877 TGGTAAACTAACAGCAGGTATGG + Intergenic
1106818397 13:33435294-33435316 TGCCAACTTAAATACAGATAGGG - Intergenic
1111698162 13:91652079-91652101 TTGGAACCTATTTGCAGATAAGG - Intronic
1112076194 13:95915936-95915958 AGTCAACCGAACTGCAGAGATGG - Intronic
1113213477 13:108010428-108010450 TGGCAAGCTGAATTCAGATATGG - Intergenic
1113791513 13:113031325-113031347 TGGCAGCATCACTGCAGACAAGG + Intronic
1125478599 15:40064305-40064327 TGGCAGCCTAACTCCAGGCAGGG + Intergenic
1125980633 15:43997414-43997436 TTGCAACCTTACTGCAGAATGGG - Intronic
1126334108 15:47567544-47567566 TGGAAACCTAAATGAAGAGAGGG - Intronic
1131749259 15:95488926-95488948 TGGCATCCCCACTGCAGAAATGG - Intergenic
1134336691 16:13306220-13306242 TGGCAACCAATCTGCAGGAAGGG + Intergenic
1135584993 16:23663258-23663280 TGACAACCTCCCTGCAGATTTGG + Intronic
1137372334 16:47919130-47919152 TGGCAACCTTACTGAAAATCCGG + Intergenic
1141436357 16:84001944-84001966 TGGCCACCTGACTGGAGAGAAGG + Intronic
1144120814 17:12150745-12150767 AGTCAACCAAACTGCAGAGATGG - Intergenic
1150489810 17:65566516-65566538 AGGCAACCTACCTACAGGTAGGG - Intronic
1155724881 18:29068714-29068736 AGGCAACCTAACTCCAGAGCAGG - Intergenic
1155842051 18:30658514-30658536 AGTCATCCTAACTGCAGAAATGG - Intergenic
1158936166 18:62366739-62366761 TGGCCGCCTAAGTGGAGATAAGG + Exonic
1165004215 19:32791316-32791338 TGGAAACCTGACTGCAGAAGGGG - Intronic
1165982217 19:39734464-39734486 TGGAAATCCACCTGCAGATATGG + Exonic
928883038 2:36118937-36118959 TGGCAAGCTATTTGAAGATAAGG - Intergenic
930324491 2:49898022-49898044 TGTCAACCTGACTGGCGATAGGG - Intergenic
932674697 2:73769254-73769276 TGGCAACTTACCTGCAAATGAGG + Exonic
933873700 2:86596699-86596721 TGGGAAAGTAACTGCAGATGTGG + Intronic
934687651 2:96333622-96333644 TAGAAACCTAACTGGAGCTACGG + Intergenic
935024223 2:99261099-99261121 CGGCAACCTAAGTACAGACAAGG + Intronic
937958502 2:127437557-127437579 TGGCAGCCTGGCTGCAGAGAAGG + Intronic
938000426 2:127730739-127730761 TGGTTACCAAAATGCAGATACGG + Intronic
943219194 2:185082896-185082918 TTGTAACCTAATTACAGATATGG - Intergenic
948193925 2:236080948-236080970 TGGCAACCTAACTGCAGATACGG - Intronic
948602321 2:239114404-239114426 GGGCACTCTAGCTGCAGATACGG + Intronic
1169665377 20:8028812-8028834 TGGAAACATATCTGCAGAAATGG + Intergenic
1174393968 20:50234578-50234600 TGGCAACCTCAGCGGAGATAAGG - Intergenic
1175153364 20:56952991-56953013 TGGGAAACTAACAGCAGATCTGG - Intergenic
1176277956 20:64285042-64285064 TGGCACCATAAGTGCAGATTAGG + Intronic
1177158904 21:17527033-17527055 TGGCAAAATAAATGCAAATAGGG - Intronic
1177341569 21:19809393-19809415 TGGCAAACGAACTGCATATCAGG + Intergenic
952016008 3:28958670-28958692 AGACAACCAAACTGCAGTTATGG + Intergenic
952977303 3:38707373-38707395 TGGCCCCCTAAGTGCAGAGAGGG + Exonic
957511638 3:81196021-81196043 TGACAACTTAACTTGAGATACGG - Intergenic
958697618 3:97547364-97547386 TGGCTACCGAACAGCAGATGTGG + Intronic
961398927 3:126620390-126620412 TGGCAACAGAACTGCAGTTACGG + Intronic
963714964 3:148792666-148792688 TGGCAACATAAATGCAGTTAAGG - Intronic
964261447 3:154842727-154842749 TGGCAGCATAACAGCACATATGG + Intergenic
965341755 3:167499907-167499929 TGGCATTCTAACTTCAGAAAAGG + Intronic
968053047 3:195669241-195669263 TGACAACCTCACTGCAAAGAGGG - Intergenic
968437184 4:599832-599854 AGTCAACCAAACTGCAGAGATGG + Intergenic
976395480 4:84550562-84550584 AGTCAACCAAACTGCAGAGATGG - Intergenic
976551294 4:86398432-86398454 TAGCAGCCTGACTGCAGAAAAGG - Intronic
976835412 4:89367150-89367172 TGGGGAAGTAACTGCAGATATGG + Intergenic
978132515 4:105215713-105215735 TGGTAAAATCACTGCAGATAAGG - Intronic
981681106 4:147399001-147399023 TGTTATCCTGACTGCAGATATGG - Intergenic
981777541 4:148387036-148387058 TCTCAACCTCACTGCAGTTATGG + Intronic
982072565 4:151708213-151708235 TAGCAGCCTAACTTCAGAGAAGG + Intronic
983057958 4:163121388-163121410 TGGCAATTTATCTGCAGAAAAGG + Intronic
984500317 4:180550406-180550428 TAGCTACCTAAATGCTGATAAGG - Intergenic
985123963 4:186672561-186672583 TGGCAACATAACAGCATACATGG + Intronic
987537519 5:19207566-19207588 TGGTGACCTTAATGCAGATATGG + Intergenic
988550022 5:32192080-32192102 TGTCAATCTAATTGCAGAAATGG - Intergenic
988632901 5:32950262-32950284 TGCCAAACTAACTTCAGAAAAGG + Intergenic
989815917 5:45737392-45737414 TAGCAGCCTAACTGGAAATAAGG - Intergenic
990711378 5:58583715-58583737 TGGGAGCCTAACTGAAGAAAGGG - Intronic
995714955 5:115073167-115073189 TGTCAGCCTAACTGCTGTTAGGG + Intergenic
1000031521 5:157406170-157406192 AGGCAACCAAACTGCAAATTTGG - Intronic
1002754941 6:149500-149522 TGGCACCCTAAGTGCAGATTAGG - Intergenic
1004244774 6:13963879-13963901 TGGCAACTTGTCTGCAAATATGG - Intronic
1004409431 6:15366776-15366798 TGGCAACCTAGGTGCACTTACGG - Intronic
1009912258 6:69945186-69945208 TGGCAAATTAACTGGAGATATGG - Intronic
1009947004 6:70351665-70351687 TGGCATCTTAACAGCAGACAAGG + Intergenic
1010395196 6:75383870-75383892 AGGCAACCTAACTTCAGAGCTGG + Intronic
1010404470 6:75487362-75487384 TGGCAGCCTAAGTGCACATGAGG - Intronic
1014199084 6:118588923-118588945 TGTCACCCTAACTGCTGTTAGGG - Intronic
1014337394 6:120154445-120154467 TGACAAAGTAACTGCAGATGTGG - Intergenic
1014482678 6:121956953-121956975 TGGCAACACAACTGCTGATTTGG + Intergenic
1015137066 6:129884600-129884622 TTTCAACATAAATGCAGATATGG + Intergenic
1021379997 7:19955241-19955263 TAACAACCTAACTTCAGATGAGG + Intergenic
1022629259 7:32070390-32070412 TGGTCACCTACCTGCAGCTATGG - Intronic
1024441296 7:49421483-49421505 TGGCACCCTAGGTGCAGATGAGG - Intergenic
1027651132 7:80870192-80870214 GGGCAAGGTAATTGCAGATAGGG - Intronic
1032811837 7:135427187-135427209 TGGAAACATAACTACACATATGG - Intronic
1034005798 7:147470769-147470791 TAGATACCTAACTGCAGATGAGG + Intronic
1044117239 8:88350381-88350403 AGTCAACCAAACTGCAGAAATGG + Intergenic
1045515628 8:102858038-102858060 TGGGAACCTAGCTGATGATAGGG - Exonic
1052036728 9:23690479-23690501 TGGCAATCTAAATGCACCTAAGG + Exonic
1052051585 9:23854756-23854778 TGGCAAACTAAATGTAAATACGG + Intergenic
1058892648 9:109374291-109374313 TGGCAGTCTTAGTGCAGATAAGG + Intergenic
1059160818 9:112033699-112033721 TGGCAACCTAGTTGCAGGCAGGG + Intergenic
1186462545 X:9759872-9759894 TGGCTTCCTAACTGCATCTATGG - Intronic
1188898978 X:35705768-35705790 AGGCAATCTAAGTCCAGATATGG - Intergenic
1189240505 X:39521009-39521031 TGGCATCCTAATTTCAGAAATGG + Intergenic
1191701532 X:64047695-64047717 AGTCAACCTAACTGCAGAAATGG - Intergenic
1191713583 X:64178203-64178225 TTGCAACCTGTATGCAGATATGG + Intergenic
1193353016 X:80483777-80483799 TGTCACCCTAACTGCTGTTAGGG - Intergenic
1193514339 X:82445579-82445601 TTGCAATCTATCTGCAGATCAGG + Intergenic
1194104981 X:89757619-89757641 AGTAAACCTAACTGCTGATAGGG + Intergenic
1195069532 X:101265968-101265990 TGGCAACCTCCCTCAAGATAGGG + Intergenic
1202107009 Y:21382676-21382698 AGGCAATATAACTGCAAATAAGG - Intergenic