ID: 948193927

View in Genome Browser
Species Human (GRCh38)
Location 2:236080968-236080990
Sequence TGTGACTATGTGACCTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1631
Summary {0: 2, 1: 20, 2: 169, 3: 509, 4: 931}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948193927_948193932 -7 Left 948193927 2:236080968-236080990 CCATGTAAGGTCACATAGTCACA 0: 2
1: 20
2: 169
3: 509
4: 931
Right 948193932 2:236080984-236081006 AGTCACAGGTCCTGGGGATTAGG 0: 1
1: 30
2: 217
3: 655
4: 1615
948193927_948193935 10 Left 948193927 2:236080968-236080990 CCATGTAAGGTCACATAGTCACA 0: 2
1: 20
2: 169
3: 509
4: 931
Right 948193935 2:236081001-236081023 ATTAGGACGTTGACATCTTTGGG 0: 2
1: 82
2: 278
3: 686
4: 1259
948193927_948193934 9 Left 948193927 2:236080968-236080990 CCATGTAAGGTCACATAGTCACA 0: 2
1: 20
2: 169
3: 509
4: 931
Right 948193934 2:236081000-236081022 GATTAGGACGTTGACATCTTTGG 0: 1
1: 84
2: 255
3: 649
4: 1151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948193927 Original CRISPR TGTGACTATGTGACCTTACA TGG (reversed) Intronic
900717923 1:4157015-4157037 TGTGAATACGTGATCTTACGTGG + Intergenic
900848861 1:5126146-5126168 TGTGAATCTGTGGCCTTACATGG - Intergenic
900865994 1:5269054-5269076 TGTGAATATGCAACTTTACATGG + Intergenic
900892654 1:5460810-5460832 TGTGAACATGTGACCTTCCATGG + Intergenic
901263703 1:7892905-7892927 TGTGAATATTTTACCTTTCATGG - Intergenic
901752010 1:11416085-11416107 TGTGACTAGATGACCTTCCATGG - Intergenic
901785927 1:11624855-11624877 TGTGACTATATTAGGTTACATGG + Intergenic
901945643 1:12701504-12701526 TGTTAATATGTGACCTTACATGG + Intergenic
902108269 1:14056208-14056230 TGTGAATATGCTACTTTACATGG + Intergenic
902113687 1:14103809-14103831 TGTGCATATGATACCTTACATGG - Intergenic
902934832 1:19757518-19757540 TGTGAATATGTTACCCTACATGG - Intronic
903316982 1:22515737-22515759 TGTGTGTATGTTACCATACATGG - Intronic
903456837 1:23493388-23493410 TGTGAATATGTGATATTACATGG - Intergenic
903489834 1:23719932-23719954 TGTGAATATGTTATCTTACATGG - Intergenic
903655174 1:24944489-24944511 TGTGGCTATGTTACCTTATATGG + Intronic
903688775 1:25154137-25154159 TGTGGTTATGTTACCTTATATGG - Intergenic
905045262 1:34993585-34993607 TGTGAATATGTTACATTACATGG - Intronic
905392020 1:37642331-37642353 TGTGAATATGTTACCTCACATGG - Intergenic
905703063 1:40033433-40033455 TGTGACTATCTTACCATAAATGG - Intergenic
905737657 1:40341019-40341041 TGTGAATCTGTTACATTACATGG - Intergenic
906646236 1:47477493-47477515 TGTGAATATGTTACCTTACATGG - Intergenic
906691840 1:47797938-47797960 TTTGACTATTAGACCTGACATGG - Intronic
906770824 1:48480778-48480800 TGTGACTATGTTATCTTACATGG - Intergenic
906857789 1:49327200-49327222 TTTAAATATGTTACCTTACATGG - Intronic
907115858 1:51967891-51967913 TGTGAATATGTTACCTTACATGG + Intronic
907380059 1:54079751-54079773 TGTGACTACGTTACCTTACATGG - Intronic
907580560 1:55568518-55568540 TGTGAATATGTGACCTGACATGG + Intergenic
907707737 1:56847311-56847333 TCTGCCTATGTGACTTTGCAGGG + Intergenic
907785891 1:57612328-57612350 TGTGATTATGTTACCTTACATGG + Intronic
908082455 1:60595892-60595914 TGTGAATATGTTACATTAAATGG - Intergenic
908096807 1:60747801-60747823 TGTGAATATGTTACCTTACATGG - Intergenic
908124501 1:61016773-61016795 TGTGAGTATGTTACCTTACGTGG - Intronic
908696485 1:66848433-66848455 TGTGAATGTGTTACCTAACATGG - Intronic
908794873 1:67821170-67821192 TGTGAATATATTACATTACATGG + Intronic
908888131 1:68813514-68813536 TATGAATATGTTACCGTACATGG + Intergenic
908897332 1:68915026-68915048 TGTGACTATGTTAGGTTACATGG + Intergenic
908897978 1:68922810-68922832 TGTGAATATGTTACCTTACATGG + Intergenic
908992064 1:70103264-70103286 TGTGAATATGTTACATTACATGG + Intronic
908996649 1:70163645-70163667 TGTGAATGGGTTACCTTACATGG - Intronic
909026254 1:70485707-70485729 TGTGAATATGTTATCTTACATGG + Intergenic
909128165 1:71701619-71701641 TATGACCATGTTACCTTACATGG - Intronic
909363754 1:74796149-74796171 TGTGAATATGTTACCATGCATGG + Intergenic
909580616 1:77229495-77229517 TGTGAATATGTTACCTTATATGG + Intergenic
909602287 1:77473051-77473073 TGTGAATATGTTACCTTACATGG - Intronic
909679561 1:78276866-78276888 TGTGAGTCTGTTACCTTAGATGG + Intergenic
909748022 1:79123307-79123329 TGTGAATATGTTACCTTACATGG - Intergenic
909780928 1:79546078-79546100 TGTGACTATGTTATCTTACATGG + Intergenic
909862833 1:80630885-80630907 TATGACAATGTTACCTTACTTGG + Intergenic
910053123 1:82999538-82999560 TGTGAACATGTCACCCTACATGG - Intergenic
910113064 1:83702389-83702411 TGTGAATAAGTTACCTTACATGG - Intergenic
910113198 1:83703545-83703567 TGTGAATAAGTTACCTTACATGG + Intergenic
910205541 1:84745486-84745508 AGAGAATATGTTACCTTACATGG + Intergenic
910418946 1:87034834-87034856 TGTGATTATGTCACTTTATATGG + Intronic
910593354 1:88951829-88951851 TGTAAATATGTTACCTTGCATGG + Intronic
910802240 1:91158379-91158401 TGTGAATATGTTACCTTAAGTGG + Intergenic
910961588 1:92769536-92769558 TGTGACTATGTTATCTTATACGG + Intronic
911531279 1:99045816-99045838 TGTGTCCATGTGTTCTTACATGG - Intergenic
911536677 1:99108275-99108297 TGTGAATATGTTACTTTAAATGG + Intergenic
911716834 1:101142814-101142836 TGTGAATATGTCATCTTACATGG - Intergenic
911740549 1:101382474-101382496 TGTGAATGGGTTACCTTACATGG - Intergenic
912053672 1:105567495-105567517 TGTGAATTTGTTACCTTACCTGG - Intergenic
912078291 1:105906243-105906265 TATGAATATGTTACCTTACATGG + Intergenic
912170312 1:107091907-107091929 TGTGAATATGTCAGGTTACAGGG + Intergenic
912234008 1:107828805-107828827 GATGAATATGTTACCTTACATGG - Intronic
912254923 1:108048664-108048686 TGTGAATATGTTATCTTACACGG + Intergenic
912536986 1:110381619-110381641 TGTAATTATGTGACCATAGAAGG - Intronic
912560884 1:110550772-110550794 TGTGAATATGGTACCTTACATGG - Intergenic
913674856 1:121131039-121131061 TGTGAATATGTTACCTTATATGG - Intergenic
914026695 1:143918671-143918693 TGTGAATATGTTACCTTATATGG - Intergenic
914348539 1:146820281-146820303 TGTGAGTATGCTACCTTACATGG - Intergenic
914394073 1:147248033-147248055 AGTGAGTATGTGACCTTATATGG - Intronic
914665077 1:149826106-149826128 TGTGAATATGTTACCTTATATGG - Intergenic
914670688 1:149867715-149867737 TGTGAATATGTTACCTTATATGG + Intronic
914980127 1:152408048-152408070 TGTGAATATGTCACTTTATATGG - Intergenic
914998929 1:152570198-152570220 GGAGACTATGTGGACTTACAGGG - Intronic
915663308 1:157421832-157421854 TATGACAATATTACCTTACACGG + Intergenic
916238585 1:162615350-162615372 TGAGAATATGTTACCTTGCATGG - Intergenic
916408094 1:164517637-164517659 TGTGAATATGTTACTTTGCATGG - Intergenic
916704912 1:167339295-167339317 TGTGAATTTGTTACCTGACACGG - Intronic
916885710 1:169065749-169065771 TAGGAATATGTGACCTTTCATGG - Intergenic
917129838 1:171729843-171729865 TGTGAATGTGTTACCTTGCATGG + Intronic
917268021 1:173242535-173242557 TATGAGTATGTCACCTCACATGG + Intergenic
917608739 1:176664568-176664590 TGGGAATATGTCATCTTACATGG - Intronic
917644943 1:177020642-177020664 TGTGAATGTGTCACGTTACATGG - Intronic
917872399 1:179253845-179253867 TGAGAATATGTTATCTTACATGG + Intergenic
918191393 1:182178292-182178314 TGTAAATATGTCACCTTACATGG + Intergenic
918275297 1:182948294-182948316 TGTGAATATGTTACCTTACATGG + Intronic
918317404 1:183333349-183333371 TGAGAGTATGTTATCTTACATGG + Intronic
918733066 1:188022768-188022790 TGTGAATATGTCACCTTATATGG + Intergenic
918896622 1:190356730-190356752 TGGGAATATGTTACCTTACATGG - Intronic
919294567 1:195679594-195679616 TATGAATATGTGACCTTAAGTGG + Intergenic
919327798 1:196131288-196131310 AGTGATTATGTTACCTTCCATGG + Intergenic
919351129 1:196455259-196455281 TGTGAATATGTTACATTAGATGG - Intronic
919456564 1:197827367-197827389 TGTGAAAATGTTACCTTGCATGG - Intergenic
919813646 1:201424388-201424410 TGTGAATCTGTTACCTTATATGG + Intronic
919950255 1:202356486-202356508 TGTAAATATGTTACCTTACAGGG + Intronic
920083023 1:203390289-203390311 TGTGAATATATTACCTTTCATGG + Intergenic
920137631 1:203782699-203782721 TGTGACTGTGTTACCTTGCATGG - Intergenic
920447882 1:206033673-206033695 TGTTAATATGTGACTTTACATGG - Intergenic
920535784 1:206735803-206735825 TGTGGCTATGTTCCCTTACATGG - Intergenic
920794350 1:209124192-209124214 TGTGAATATGTTACATTACACGG + Intergenic
920979519 1:210820316-210820338 TATGACTATGTTACTTTACAGGG + Intronic
921493428 1:215807037-215807059 TGTGACTATGTTATGTTACATGG + Intronic
921927743 1:220726489-220726511 TGTGAATATGTTACCTTACATGG - Intergenic
921971247 1:221151499-221151521 TGTGAATATATGATCTTATATGG - Intergenic
922370703 1:224907812-224907834 TATGACTATGTTACATTATATGG - Intronic
922390033 1:225131626-225131648 TGTGAATATGTCACCTTAAATGG - Intronic
922597173 1:226823025-226823047 TGTGACCATGTTACCATATAGGG - Intergenic
922871426 1:228905041-228905063 TGTGACTATGTTATGTTACATGG + Intergenic
923073238 1:230585143-230585165 TGTGAATATGTCACCTTACATGG + Intergenic
923773928 1:236961477-236961499 TGTGAATATGTTACCTTATATGG - Intergenic
923788392 1:237090287-237090309 TGTAAATATGTTACTTTACATGG + Intronic
924327687 1:242912062-242912084 TGTGAGTATGTTATCTTACATGG - Intergenic
924587760 1:245375002-245375024 TGTGGATGTGTTACCTTACATGG + Intronic
924846115 1:247773967-247773989 TGTGGATATATTACCTTACATGG + Intergenic
1063163529 10:3438745-3438767 TGTGAATATGTGACATCACATGG - Intergenic
1063311210 10:4954085-4954107 TGTGACTATGTTACCTGACCTGG - Intronic
1063316581 10:5012334-5012356 TGTGACTATGTTACCTTACCTGG + Intronic
1063600065 10:7473093-7473115 TGTGAATCTGTTACCTTAGATGG - Intergenic
1063774488 10:9245806-9245828 TGTGAATATGTTACTTTACATGG + Intergenic
1063835340 10:10005700-10005722 TGTGAATATGTGACCTCAAATGG + Intergenic
1064209960 10:13353205-13353227 TGTGACTATGTCATGTTACAAGG + Intergenic
1064540202 10:16397438-16397460 TGGGAATATGTGACTTTACATGG - Intergenic
1064618260 10:17186270-17186292 TGTGAAAATGTTACCTTACATGG + Intronic
1064766745 10:18683019-18683041 TGTGAATGTGTTACCTTACCTGG - Intergenic
1064897107 10:20249697-20249719 GGTGTCAATGTTACCTTACACGG - Intronic
1065037385 10:21653635-21653657 TGTGAATATGTTATATTACATGG - Intronic
1065255377 10:23861435-23861457 TGTGAATATGTTACATTACACGG + Intronic
1065316979 10:24473089-24473111 TGTGAATATGTTTCCTTACATGG - Intronic
1065353619 10:24817796-24817818 TGTGACTATGTTGCCTTACCTGG - Intergenic
1065404597 10:25349768-25349790 TGTGAATATGTTCCCTTACATGG - Intronic
1065414925 10:25473920-25473942 TTTGAATATGTTACCTTACATGG + Intronic
1065659253 10:27988817-27988839 TATGAACATGTCACCTTACATGG + Intronic
1065675049 10:28165181-28165203 TGTGACTATGTTACCTCACATGG + Intronic
1065794712 10:29295578-29295600 TCTCACTCTGTTACCTTACAAGG + Intronic
1066011698 10:31200446-31200468 TGTGAAAATGTTACATTACATGG + Intergenic
1066035976 10:31484230-31484252 TGTGACTATATTACTTTAAATGG - Intronic
1066191564 10:33060852-33060874 TGTGAATATGTTACCTTATGTGG + Intergenic
1066349867 10:34627400-34627422 TGTCAGAATGTGACCTTACTTGG + Intronic
1067694721 10:48526527-48526549 TGTGACTAAGTGATCTTGCCTGG - Intronic
1067698738 10:48553681-48553703 TGTGACTATGTTACCTTATATGG + Intronic
1067926579 10:50514556-50514578 TGTGAATATATTACCTTACATGG - Intronic
1068043429 10:51856246-51856268 TGTAAATATGTTACCTTATATGG - Intronic
1068112332 10:52694680-52694702 TGTGAATATGTTACCTTTCAAGG - Intergenic
1068162300 10:53280549-53280571 TGCGAATATGTTATCTTACATGG - Intergenic
1068169793 10:53378542-53378564 TGTGAATATATGACTTTATATGG + Intergenic
1068375184 10:56168933-56168955 TGTGAATATGTTACCTCACATGG - Intergenic
1068391403 10:56401920-56401942 TGTGAATATGTTTCCTTACATGG + Intergenic
1068839430 10:61593455-61593477 TGTGAATATGTCATCTCACATGG + Intergenic
1069155758 10:65029041-65029063 TGTGAACATATTACCTTACATGG - Intergenic
1069178554 10:65326346-65326368 TGTCACTTAGTGTCCTTACATGG + Intergenic
1069202875 10:65645045-65645067 TGTGAATATGCAACCTTATATGG + Intergenic
1069265628 10:66453905-66453927 TGTGAATATGTTACCTTACATGG + Intronic
1069321441 10:67176611-67176633 TATGAATATGTTACCTGACATGG + Intronic
1069381045 10:67843432-67843454 TGTGACTCTGTGACTTTTCCAGG - Intergenic
1069492185 10:68870510-68870532 TGTGAATATGTTACCTTACATGG + Intronic
1069869506 10:71524609-71524631 TGTGACTGTGTGACCCCACATGG + Intronic
1069945416 10:71982089-71982111 TGTGGATATGTGAGCTTGCATGG + Intronic
1070039634 10:72763220-72763242 AGTGAATATGTTACCTTACGTGG - Intronic
1070072496 10:73103128-73103150 TGTGAATATGTTACCGTACACGG + Intergenic
1070342889 10:75513865-75513887 TGTGATTATGTGACCTTACATGG - Intronic
1070525940 10:77296078-77296100 CATGAATATGTGACCTTACATGG + Intronic
1070629425 10:78074359-78074381 TGTGAATATGTTAACTTACGTGG + Intergenic
1070633276 10:78103814-78103836 TGTGGATATGTTACCCTACATGG + Intergenic
1070686648 10:78489720-78489742 TGTGAATATGTTATCTTACATGG - Intergenic
1070942712 10:80360534-80360556 TATGAATATGTCACCTTAAATGG - Intronic
1071776032 10:88789115-88789137 TGTGAATATGTTACCTTATATGG + Intergenic
1072200044 10:93150117-93150139 TGTGAATATGGTACCTTATATGG - Intergenic
1072863583 10:99033014-99033036 TGTGAATATGTTAACTTACATGG - Intronic
1073179772 10:101576757-101576779 TGTGAATATGTCACCTTAGTTGG - Intronic
1073427432 10:103464213-103464235 TGTGAATATGTTACCTTCCATGG - Intergenic
1073651754 10:105367788-105367810 TGTGAATATGTTAGATTACATGG - Intergenic
1073707501 10:106001678-106001700 TGAGAATATGTTGCCTTACATGG + Intergenic
1073742704 10:106426841-106426863 TGTGAATATGTTGCCTTATATGG - Intergenic
1073814662 10:107193469-107193491 TGTGAATATATTACCCTACATGG + Intergenic
1073961477 10:108935061-108935083 TGTGACTGTGCTACCATACATGG - Intergenic
1074118628 10:110476758-110476780 TGTGAATATATGACCTCACATGG - Intergenic
1074153192 10:110776734-110776756 TGTGAATATGTTATCTTACATGG - Intronic
1074249998 10:111735529-111735551 TGTGACTATGTTACCTTACATGG - Intergenic
1074425085 10:113343557-113343579 TGTGAATATGTTACCTTATATGG + Intergenic
1074494067 10:113963646-113963668 TGTGAATATGTTACCTCACATGG - Intergenic
1074726405 10:116314681-116314703 TGTGAATATGTCACCTTACTTGG + Intergenic
1074851836 10:117445314-117445336 TGTGAATATATTACCTTACATGG - Intergenic
1075024608 10:118975397-118975419 TGTGAATATGTTACCTTATGTGG - Intergenic
1075029087 10:119009124-119009146 TGTGAGTACGTTACCTTACATGG + Intergenic
1075245457 10:120818302-120818324 TGTGAATATGTTACCTTACATGG + Intergenic
1075448584 10:122531034-122531056 TGTGAATATATGACCTTATATGG + Intergenic
1075607242 10:123820930-123820952 TGTGAATATGTCACCTTACATGG - Intronic
1075667791 10:124243431-124243453 TGTGAAGATGTTCCCTTACATGG + Intergenic
1075772557 10:124952186-124952208 TGTGAGTATGCCACCTTACGTGG + Intronic
1075930368 10:126289931-126289953 TGTGCATATGTTACCTTACTTGG + Intronic
1076155263 10:128200012-128200034 TTTGAGTATGTGAACTAACATGG + Intergenic
1076268772 10:129132403-129132425 TGTGCATATGTCACATTACAGGG - Intergenic
1076637773 10:131893560-131893582 TGTGGCTATGTTACGTTGCATGG - Intergenic
1076926403 10:133490570-133490592 TGTGATTATGTTACATTACATGG - Intergenic
1077812330 11:5650749-5650771 AGTTACTATGTGACCCTACCTGG - Intergenic
1078122998 11:8529547-8529569 TGGGAATATGTTTCCTTACATGG + Intronic
1078267929 11:9768858-9768880 TGTGAATATGTCATCTTACATGG - Intergenic
1078415350 11:11160391-11160413 TGTGAATATGTTACCTTATATGG - Intergenic
1078453883 11:11460191-11460213 TGTGAATATGTTACCTTACATGG - Intronic
1078485637 11:11720867-11720889 TGTGACTATGTCACCCTACATGG - Intergenic
1078837055 11:15041025-15041047 TGTGACTATGTGACCTTACCTGG - Intronic
1079022127 11:16917712-16917734 TGTGAATATGTTACCTTATATGG - Intronic
1079132591 11:17756276-17756298 TGTACCTATGTGAGCTGACAGGG - Intronic
1079222750 11:18578052-18578074 TGTGAATATGTCACCTTACTTGG + Intronic
1079246693 11:18757475-18757497 TTTGAATATGTGGCCTTACAGGG - Intronic
1079685639 11:23355738-23355760 TGTGAATATGTCAGGTTACATGG - Intergenic
1079701349 11:23552574-23552596 TGTGAATATGTTACAATACATGG - Intergenic
1080050087 11:27850869-27850891 TGTGAATATATGACTTTACAGGG - Intergenic
1080109075 11:28545315-28545337 GGTGAATTTGTTACCTTACATGG + Intergenic
1080131758 11:28803686-28803708 TATGAATATGTTACCTTAAATGG - Intergenic
1080156194 11:29114146-29114168 TGTGAATATGTTATATTACATGG - Intergenic
1080357820 11:31472177-31472199 TTTGAATATGTTGCCTTACATGG - Intronic
1080490472 11:32757898-32757920 TGTGAATATGTTACCTTATATGG - Intronic
1080708802 11:34725588-34725610 TGTGACTATGTTACCTTACATGG + Intergenic
1080709674 11:34734714-34734736 TGTGAATATGGTACCTTACATGG + Intergenic
1080940547 11:36913235-36913257 TGTGAATATGTTAATTTACATGG - Intergenic
1080993707 11:37575095-37575117 TGTGAATATTTTACCTTAAATGG + Intergenic
1081257951 11:40920818-40920840 TGTGACTATATTACCTCACATGG + Intronic
1081375361 11:42351965-42351987 TGTTAATATGTGACCTTACATGG + Intergenic
1081597992 11:44472512-44472534 TGTGAATATGTTACCTTATATGG + Intergenic
1081601264 11:44496514-44496536 TGAGAATATGTTGCCTTACATGG - Intergenic
1081677942 11:44981851-44981873 TGTGAATATGTTACCTAACATGG - Intergenic
1081884132 11:46480227-46480249 TGTGAATATGTTACTTTACATGG - Intronic
1082274083 11:50202575-50202597 TGTGAATATGTTATCTTACATGG + Intergenic
1082274130 11:50203056-50203078 TGTGAATATGTTATCTTACATGG - Intergenic
1083606417 11:63981531-63981553 AGTGAATATGTTATCTTACATGG + Intronic
1083645301 11:64168777-64168799 TGTAAATATGTTACATTACACGG - Intergenic
1084402630 11:68953901-68953923 TGTGAATTTGTTACCTTAAATGG + Intergenic
1084453933 11:69256624-69256646 TGTGAATACATGACCTTACATGG + Intergenic
1084582152 11:70030747-70030769 TGTGACTGTGTGGCCTTACGTGG - Intergenic
1084781436 11:71412221-71412243 TGTGTATATGTGAGCTTCCATGG + Intergenic
1084793638 11:71490381-71490403 TGTGACTCTGTCACCTCTCAGGG - Intronic
1085145032 11:74187800-74187822 TGTGAATATGTTATTTTACATGG + Intronic
1085158045 11:74314012-74314034 CATGACTGTGTTACCTTACATGG + Intergenic
1085331770 11:75657943-75657965 TGTGAATATGTTATCTTACATGG - Intronic
1085772939 11:79340880-79340902 TATAAGTATGTTACCTTACATGG + Intronic
1085898943 11:80674015-80674037 TGTGAATATGTTACTTTCCATGG - Intergenic
1086121081 11:83304969-83304991 TATGAATATGTTACCTTACATGG + Intergenic
1086191740 11:84087535-84087557 TGTGAATATGTTACTTTATATGG + Intronic
1086514574 11:87596888-87596910 TATGAATATGTTAACTTACATGG + Intergenic
1086538833 11:87883559-87883581 TGTGAATATGTTGCCTTACATGG + Intergenic
1086594461 11:88554383-88554405 TGTGACTATGTTATCTTACATGG - Intronic
1086784256 11:90946630-90946652 TGTGAATATGTTACATTGCATGG + Intergenic
1086885432 11:92200180-92200202 TGTAAATGTGTGACCTTACATGG + Intergenic
1086939379 11:92779682-92779704 TGTGAATATGTTATGTTACATGG + Intronic
1087271751 11:96119192-96119214 TGTGAATATGTGAACTTACATGG + Intronic
1087586504 11:100128446-100128468 TGTAAGTATGTCACTTTACATGG + Intronic
1087662401 11:101002740-101002762 TGTGACTATATTACCTTACATGG - Intergenic
1087710084 11:101538527-101538549 TGTAAGTATGTTACGTTACATGG + Intronic
1087995488 11:104802104-104802126 TGTAAATATGTGACCTTAAATGG + Intergenic
1088023555 11:105150432-105150454 TGTGAATACATTACCTTACATGG - Intergenic
1088090407 11:106032088-106032110 TGTAAATATGTTACCTTATATGG + Intergenic
1088124354 11:106405444-106405466 GGTGAGTATGTTACATTACATGG - Intergenic
1088247831 11:107836444-107836466 TGTGAATAGGTTACCTTACAAGG + Intronic
1088264285 11:107974816-107974838 AGTGACTGTGTTAGCTTACACGG + Intergenic
1088963485 11:114694263-114694285 TGTGAATATGTTAAGTTACATGG - Intronic
1088968664 11:114751710-114751732 TGCAAATATGTGACCTTACTTGG + Intergenic
1088981906 11:114871660-114871682 TGTGAATATGTTACCTTTCTTGG + Intergenic
1089154886 11:116394091-116394113 TGTGTCCATGTTACCTTACATGG + Intergenic
1089162720 11:116451949-116451971 TGTGACTATGTTACTCTCCATGG - Intergenic
1089226246 11:116924938-116924960 TGTGAATGTGTTACCATACATGG + Intronic
1089967976 11:122669483-122669505 TGTGAATATGTGACCTTACATGG - Intronic
1090000848 11:122956411-122956433 TGTGGCTATGACACCTTACAGGG + Intronic
1090176231 11:124652231-124652253 TGTGGCTGTGTTACCTTGCATGG + Intronic
1090563356 11:127958291-127958313 TGTGAATATGTAACCTTCCATGG - Intergenic
1090731318 11:129575399-129575421 TGTGAATATGCTACCTTCCATGG - Intergenic
1090819266 11:130326387-130326409 TGTGACTGTGTTACCTTACATGG - Intergenic
1091075232 11:132609333-132609355 TGTGAATACTTGACCTCACAGGG + Intronic
1091946916 12:4554408-4554430 TGTGAATATGTTACCTTACATGG - Intronic
1092928966 12:13297275-13297297 TGTAAATATGTTACCTTACATGG - Intergenic
1093105905 12:15086785-15086807 GGTGACTATGTCACCTTACTTGG - Intergenic
1093386887 12:18568149-18568171 ACTGAATATGTTACCTTACATGG - Intronic
1093404903 12:18792390-18792412 TGTGGATCTGTTACCTTACATGG - Intergenic
1093442060 12:19210680-19210702 TCTGACAATGTGACCTCAAAGGG - Intronic
1093684256 12:22038458-22038480 TGTGAGTGTGTTACCTTACATGG - Intergenic
1093751285 12:22803372-22803394 TGTAAATATGTTACTTTACATGG - Intergenic
1093786602 12:23199018-23199040 TTTGAATATGTAACCTTACATGG + Intergenic
1094110622 12:26858519-26858541 TGTGAATATGTTGACTTACATGG + Intergenic
1094718682 12:33038949-33038971 TGTGAATCTGTTACCTTACATGG - Intergenic
1095242292 12:39875480-39875502 TGTGAATATGTTGCATTACATGG - Intronic
1095301745 12:40592417-40592439 TGTGAATATGTTAAGTTACATGG + Intergenic
1095482179 12:42648172-42648194 TGTGACTGTGTTGCCTTACTTGG - Intergenic
1095685173 12:45025082-45025104 TGTGAATATGTTATGTTACATGG + Intronic
1095735141 12:45548052-45548074 TGTGAATATGTTTACTTACATGG + Intergenic
1095741189 12:45608760-45608782 TGTGACTTTGTTTCCTTAGATGG + Intergenic
1095948990 12:47771470-47771492 TATGAATATGTCACCTTCCACGG + Intronic
1096883243 12:54689991-54690013 TATGAATATGGTACCTTACAGGG + Intergenic
1097788180 12:63784111-63784133 TATGAATATGTTACCTTACATGG - Intronic
1098034400 12:66287565-66287587 TGTGACTATATTGTCTTACATGG + Intergenic
1098084732 12:66830237-66830259 TGTGAATATGTTACCTTACATGG + Intergenic
1098205572 12:68105824-68105846 TGTGAATATGCTACCTTACATGG + Intergenic
1098569692 12:71974626-71974648 TGTGAGTATGTGACCTTACATGG - Intronic
1098998931 12:77154159-77154181 TATGAATATGTTACATTACATGG + Intergenic
1099015193 12:77336147-77336169 TGTGAATATGTCACTTTTCATGG + Intergenic
1099257475 12:80331726-80331748 TATGAATATATGACCTTATATGG + Intronic
1099714623 12:86275500-86275522 TGGGAATATGTTACCTTACTTGG + Intronic
1099904087 12:88751285-88751307 TGTGATTATGTTACCTTACATGG - Intergenic
1099923023 12:88982711-88982733 TGTGAATGTGTTACCTGACATGG - Intergenic
1099957066 12:89361175-89361197 TGTGAATATGTTACCTTACATGG - Intergenic
1100003161 12:89861642-89861664 TGTGAACATGTCACCTTACATGG + Intergenic
1100026282 12:90132357-90132379 TGTGTATATATGACATTACAAGG - Intergenic
1100125000 12:91413821-91413843 TGTGACTTTGAGAGCTTCCATGG + Intergenic
1100143907 12:91653634-91653656 TGTCACTATGTTACTGTACATGG - Intergenic
1100175043 12:92020616-92020638 TATGAATATGTTTCCTTACAGGG + Intronic
1100212298 12:92410087-92410109 TGTGAATATGTTACATTGCATGG - Intergenic
1100397486 12:94197649-94197671 TGTGACTGTGTCACCTTACATGG - Intronic
1100431328 12:94534181-94534203 TGCAAATATGTGACCTTGCATGG + Intergenic
1100580175 12:95931412-95931434 TGTAAATACGTTACCTTACATGG - Intronic
1100660087 12:96687272-96687294 TATGAATATGTGACCTTACAGGG - Intronic
1100667768 12:96772936-96772958 TGTGAATATGTTAGATTACAGGG - Intronic
1100822459 12:98444196-98444218 TGTGAATATGTTACCTTACCTGG - Intergenic
1101053191 12:100885211-100885233 TGTGAATATGTCACCTTACATGG - Intronic
1101062185 12:100983845-100983867 TGTGAATATGTTATGTTACATGG - Intronic
1101191259 12:102335865-102335887 TGTGACTATATTACCTTACATGG - Intergenic
1101315287 12:103623327-103623349 TGGGAATATGGTACCTTACATGG + Intronic
1101339171 12:103826280-103826302 TGTGAATATGTTATCTTACATGG + Intronic
1101407663 12:104442951-104442973 TGTGATTATGTTACCTTGAATGG + Intergenic
1101601436 12:106213508-106213530 TGTGAATATGTTGCCTTACATGG + Intergenic
1101733559 12:107446050-107446072 TGTGAATGTGTGACCTTACAGGG - Intronic
1102386777 12:112516672-112516694 TGTGAATATGTTACTTTACATGG - Intergenic
1102391187 12:112550087-112550109 TGTGAATATGTTACTTTACATGG - Intergenic
1102447840 12:113017232-113017254 TGTGAATATGTTACCTTATATGG - Intergenic
1102525266 12:113508079-113508101 TGTGAATATGTAACTTTACATGG + Intergenic
1102560113 12:113755879-113755901 TTTGACTATGTGACCTTCCATGG + Intergenic
1102591930 12:113962847-113962869 TGTGGATATGTTACCTTACAAGG + Intronic
1102975048 12:117200815-117200837 TGTGAATATGTTACCTTATGTGG + Intergenic
1103061777 12:117864009-117864031 TGTGATTGTGTGACCATACATGG - Intronic
1103137829 12:118523050-118523072 TGTGAATATGTTACCTTTCATGG + Intergenic
1103531965 12:121608690-121608712 TGTGAATATGTGACCGTATATGG + Intergenic
1103578378 12:121895816-121895838 TGGGAATATGCCACCTTACATGG - Intronic
1103799311 12:123526986-123527008 TGAGAATATGTTACCTTACATGG + Intronic
1103895286 12:124269157-124269179 TGAGTCTATGTTACCTTCCATGG + Intronic
1103956381 12:124579191-124579213 TGTGAATCTGCTACCTTACATGG - Intergenic
1103981583 12:124740260-124740282 TGTGAATATGTTAGCTGACATGG - Intergenic
1104063506 12:125287334-125287356 TGTGAAGATGTTACCTTACATGG - Intronic
1104074757 12:125379181-125379203 TGTGAATATGTTATGTTACATGG + Intronic
1104111641 12:125710184-125710206 CGTGAATATGTGACCTTACATGG + Intergenic
1104166865 12:126240092-126240114 TGTGAGTATGTTAGGTTACATGG - Intergenic
1104228512 12:126860622-126860644 TGTGAATGTGTTACATTACATGG + Intergenic
1104280304 12:127370808-127370830 AGTGATTATGTTAACTTACATGG - Intergenic
1104409551 12:128546846-128546868 TGTGAATATGTTACCTTACAAGG - Intronic
1104433612 12:128737841-128737863 TGTGACTATGTTACTTTATCAGG - Intergenic
1104485467 12:129148305-129148327 GGTAAATATGTCACCTTACATGG + Intronic
1104549528 12:129743657-129743679 TGTGAACATGTTAGCTTACATGG + Intronic
1104557192 12:129811588-129811610 TGTGAGTGTGCGACCTTACCTGG + Intronic
1104597015 12:130126821-130126843 CGTGAATATGTCACCTTACATGG + Intergenic
1104597968 12:130132864-130132886 TGCGACTGTGTCACCTTACAGGG + Intergenic
1105660743 13:22491740-22491762 CGTGACTATTTTAACTTACATGG + Intergenic
1106139854 13:27003078-27003100 TGTGAATATGTCACCTTACATGG + Intergenic
1106244418 13:27936214-27936236 TGTGTCTATGTTCCCTTACAGGG + Intergenic
1106548426 13:30750689-30750711 TGTGAATATGTTATGTTACATGG + Intronic
1106724895 13:32473904-32473926 TCTGACTATCTTATCTTACATGG - Intronic
1106844227 13:33720378-33720400 TGTGAATATGTTACCTTACATGG - Intergenic
1106891027 13:34245667-34245689 TATGAATATGTTACGTTACAGGG - Intergenic
1107102228 13:36606135-36606157 TGTGACTATGTGATTTTATAAGG - Intergenic
1107257329 13:38444014-38444036 TGTGACTACGTTACGTTACATGG - Intergenic
1107323647 13:39216218-39216240 TGTGAATATGTTATGTTACATGG - Intergenic
1107366274 13:39680950-39680972 TGTGAATATGTTACCTTACATGG - Intronic
1107539117 13:41369534-41369556 TGTGAATATGTAACCTTACATGG + Intronic
1107556235 13:41518795-41518817 TGTGAATATGCTGCCTTACACGG - Intergenic
1107653559 13:42569127-42569149 CGTGACTATGTTACCTCACATGG + Intronic
1108033048 13:46256922-46256944 TGTGAATATGTTATATTACATGG + Intronic
1108036614 13:46296791-46296813 TGTGACTATGTTATGTCACATGG - Intergenic
1108317859 13:49255360-49255382 TGTGACTATGTTTTGTTACATGG - Intronic
1108404543 13:50086811-50086833 TGTGAATATGTTATGTTACACGG + Intronic
1108697371 13:52914240-52914262 TGTGAATATATTACCTTACATGG + Intergenic
1109281973 13:60367225-60367247 TGTGAATATGCAACCTTACATGG - Intergenic
1109495975 13:63172259-63172281 TGTGAATATGTAACCTTACATGG - Intergenic
1109819066 13:67627877-67627899 TGTGAATATGTTACCTTATATGG - Intergenic
1110574476 13:77039986-77040008 TGTGAAGATGTTGCCTTACATGG - Intergenic
1110827584 13:79990607-79990629 TGTGAATATGTTACATTACATGG + Intergenic
1110838280 13:80110203-80110225 TGTGAATATGTTACCTTATGTGG + Intergenic
1111306904 13:86426470-86426492 TATTAATATGTTACCTTACATGG + Intergenic
1111729562 13:92056412-92056434 TGTGAGTATGTTACCTCACATGG - Intronic
1111820633 13:93209463-93209485 TGTGAATATGTTGCCTTGCATGG - Intergenic
1112149187 13:96738044-96738066 TGTGACTATATTACCTTACAGGG - Intronic
1112191786 13:97185422-97185444 TGAGAATATGTTACCTTACATGG + Intergenic
1112259126 13:97862562-97862584 TGTGACTATGTTAGGTTACATGG + Intergenic
1112657040 13:101462334-101462356 TGTAAATATGTCACCTTACGTGG - Intronic
1112669591 13:101619253-101619275 TGTGAATATGTTAGATTACATGG + Intronic
1112690967 13:101893458-101893480 TGTGACTGTGTTACATGACATGG + Intronic
1112842098 13:103593046-103593068 TGTGAATATGTGAGCTTGCATGG + Intergenic
1112878281 13:104073494-104073516 TGTGATTATGTCTCTTTACATGG + Intergenic
1114673209 14:24424493-24424515 TGTGAATATGTTATGTTACATGG + Intergenic
1114713048 14:24797652-24797674 TGTGAATATGTTACCTTACATGG - Intergenic
1114757000 14:25270450-25270472 TGTAAATATGTAATCTTACATGG - Intergenic
1115156839 14:30350584-30350606 TGTGATAAAGTGACCTTACATGG + Intergenic
1115162586 14:30412530-30412552 TGTGAATATGTTACTTTATATGG - Intergenic
1115495685 14:34002196-34002218 TGTGAATATGTTAGGTTACATGG + Intronic
1115570049 14:34657861-34657883 TGTAAATATGTTACCTTACATGG + Intergenic
1115579550 14:34744599-34744621 TGTGAATATGTTACTCTACATGG + Intergenic
1115593276 14:34884875-34884897 TGTGAATATGTTATCTTATATGG + Intergenic
1115901098 14:38149029-38149051 CATGAATATGTTACCTTACATGG + Intergenic
1116001881 14:39252198-39252220 TGAGAATATGTTACTTTACATGG + Intronic
1116031207 14:39574885-39574907 TGTGATTATGTGACTTTCTATGG + Intergenic
1116062485 14:39941454-39941476 TGTAAATATGTTACCTTAAATGG - Intergenic
1116091523 14:40313179-40313201 ACCGTCTATGTGACCTTACATGG - Intergenic
1116179181 14:41514151-41514173 TATGAATATGTTATCTTACATGG + Intergenic
1116710056 14:48357005-48357027 TGTAAATATGTTACCTTACATGG - Intergenic
1116715520 14:48420657-48420679 TGTGAATATGTTATATTACATGG - Intergenic
1116736104 14:48693927-48693949 TGTGAGTATGTGATGTTACATGG - Intergenic
1116778673 14:49211836-49211858 TATGAGTATGTTACCTTACATGG - Intergenic
1116802287 14:49455360-49455382 TGTACATATGTTACCTTACATGG + Intergenic
1117064385 14:51995520-51995542 TGTGTATGTGTTACCTTACATGG - Intronic
1117105859 14:52396152-52396174 TGTGAATATGCCACCTTACATGG + Intergenic
1117254913 14:53967950-53967972 TGTGAATATGTTACCTTACCTGG - Intergenic
1117291773 14:54341520-54341542 TGTGACTATATTACCTTACATGG + Intergenic
1117484871 14:56185963-56185985 TGTGAATATATTACCTTACATGG + Intronic
1117594075 14:57308452-57308474 TGTCAATATGTTACCTTACATGG + Intergenic
1117794620 14:59379577-59379599 TGTGAATATATTACCTTATATGG + Intergenic
1117799791 14:59431413-59431435 TGTGAATATGTCACCTTGCATGG + Intronic
1117838827 14:59836193-59836215 TGTGAATATGTTACCTTATCTGG - Intronic
1118009254 14:61592594-61592616 TGTGAATATGTTACCTTACATGG - Intronic
1118255842 14:64205159-64205181 TGTGAATATGTTAGATTACACGG - Intronic
1118451142 14:65903538-65903560 TGTAAACATGTTACCTTACATGG + Intergenic
1118525885 14:66642143-66642165 TGTGAATATGTCACATTATAAGG + Intronic
1118885761 14:69864679-69864701 TGTGAATATGCTACCTTATATGG + Intronic
1118987537 14:70769776-70769798 TTTGTCTATGTGTCCTTATAAGG + Intronic
1118989684 14:70786549-70786571 TTTGACCTTGGGACCTTACAAGG + Intronic
1119045274 14:71313500-71313522 TGTGAATATGTTACCTTATGTGG - Intergenic
1119149289 14:72343517-72343539 TGTGAATATGTGACTTCACATGG - Intronic
1119158804 14:72435902-72435924 TGTGAATATGATACCTTACATGG - Intronic
1119201971 14:72760495-72760517 TGTGCGTATGTTACCTTACATGG - Intronic
1119206153 14:72795077-72795099 TATGAATATGTTACCTTACATGG - Intronic
1119571607 14:75679109-75679131 TGTGAATATGTTATCTTACATGG + Intronic
1119637156 14:76283253-76283275 TGTGCATATATTACCTTACATGG + Intergenic
1119847457 14:77840999-77841021 TATGAATGTGTTACCTTACATGG - Intronic
1120063754 14:80015508-80015530 TGAGAATATGTTACCTTATATGG - Intergenic
1120090296 14:80324157-80324179 TGTGGCCATGTTACCTTACAAGG + Intronic
1120125390 14:80735997-80736019 TGTGAATATGTTACCTTACATGG - Intronic
1120185986 14:81394488-81394510 TGTGAATATGTTACTTTATATGG + Intronic
1120440789 14:84536246-84536268 TTTGACTTTGTGTCCTCACAAGG + Intergenic
1120614192 14:86681987-86682009 TGTGAATATGTCACCTTACATGG - Intergenic
1120858756 14:89235585-89235607 TGTGACTATGTTAGATTTCATGG + Intronic
1121055190 14:90846204-90846226 TGTGGCTATGTTAGCTTACGTGG - Intergenic
1121251722 14:92504765-92504787 TGTGACTATGTTTTCTTACATGG + Intergenic
1121298171 14:92847151-92847173 TGTAAATATGTCATCTTACAAGG + Intergenic
1121373443 14:93382407-93382429 TGTCAAGATGTTACCTTACATGG + Intronic
1121654628 14:95586306-95586328 TGTGAATATGTTACTTTCCATGG + Intergenic
1121794653 14:96724996-96725018 TGTGAACATGTCATCTTACATGG - Intergenic
1121794849 14:96726294-96726316 TGTGAATACGTTACCTTGCATGG + Intergenic
1121846823 14:97179522-97179544 TGTGACTATGTTACCTTAGATGG - Intergenic
1121856617 14:97276220-97276242 TGTGAATATGTGACCTTGCATGG + Intergenic
1121864115 14:97346530-97346552 TGTGAATATGTTATCTTACATGG + Intergenic
1121902241 14:97704198-97704220 TGTGAATACGTCACCTTACCTGG - Intergenic
1122034303 14:98936290-98936312 TGTGAATATGTCACTTTACATGG + Intergenic
1122193032 14:100062790-100062812 TGTGACTGTGTGACTTTACATGG + Intronic
1122362094 14:101173636-101173658 TATGACTGTGTGACCCTACCTGG - Intergenic
1122373152 14:101240427-101240449 TGCGAATATGTCACCTTACATGG + Intergenic
1122750835 14:103931689-103931711 TGTGACTATGTAATGTTACATGG + Intronic
1122846813 14:104504721-104504743 TGTGAATGTGTGACTTCACATGG + Intronic
1122941593 14:104983957-104983979 TGTGGCTATGTGACCTTACAGGG - Intergenic
1123103174 14:105819288-105819310 TGTGACTCTGAGATCTTACATGG - Intergenic
1123690262 15:22832839-22832861 TGTGACTGTGCCACCTTCCATGG - Intergenic
1123711220 15:22989187-22989209 TGTGACTATGTTAGTTTACATGG - Intronic
1124052928 15:26215658-26215680 TGTGACTATGTGACTTTACATGG + Intergenic
1124063071 15:26313253-26313275 TGAGACTATGCTACCTTACCTGG + Intergenic
1124081562 15:26503125-26503147 TGTGAATATGTTACACTACATGG - Intergenic
1124125681 15:26936585-26936607 TGTGAATATGGTACCTTACTTGG - Intronic
1124159547 15:27255984-27256006 TGTGTCTATGTTATTTTACATGG + Intronic
1124694756 15:31854723-31854745 TGTGAATATGTTACCATGCATGG - Intronic
1124806087 15:32884539-32884561 TGTGAACATGTTGCCTTACATGG - Intronic
1125063038 15:35447362-35447384 TGTAACCATGTGACCTTCCATGG - Intronic
1125144918 15:36455819-36455841 TGTGAATATATTACCTTATATGG - Intergenic
1125278041 15:38014163-38014185 TATGAATATATTACCTTACATGG - Intergenic
1126260810 15:46688497-46688519 TATGAATATGTTACCTTTCATGG - Intergenic
1126532057 15:49721467-49721489 TGTGAATATGTTACCCTACATGG + Intergenic
1126564920 15:50084956-50084978 TGTGAATACATTACCTTACAAGG - Intronic
1126568862 15:50128536-50128558 TGTGACTCTGTGACAGTAGAGGG - Intronic
1126589013 15:50320601-50320623 TGTGAATATGCTACCTTACATGG + Intronic
1126869173 15:52969370-52969392 TGTGAATATGTAACCTTACATGG + Intergenic
1126974747 15:54163070-54163092 TGTGAATATGTTACCTTACGTGG + Intronic
1127057811 15:55150460-55150482 TGTGAATACATTACCTTACATGG + Intergenic
1127633525 15:60848261-60848283 TGTGAATATGCTACCTTACATGG + Intronic
1127802031 15:62485247-62485269 TGTGAATGTGTTATCTTACATGG - Intronic
1127956140 15:63855231-63855253 TGTGAATATGTTACCTTGCATGG - Intergenic
1128041648 15:64579965-64579987 TGTGAATATGTTACCTTACCTGG + Intronic
1128215434 15:65931060-65931082 TGTGAATATGTTACCTTACATGG + Intronic
1128633549 15:69288400-69288422 TGTGAGTATGTTACCCTGCATGG - Intergenic
1129802300 15:78424343-78424365 TGTGAATAGGTGATGTTACATGG + Intergenic
1129914224 15:79254205-79254227 TATGAAGATGTGACTTTACATGG + Intergenic
1129974213 15:79807867-79807889 TGTGACTATGTTCCATTACCTGG - Intergenic
1130426973 15:83811167-83811189 TGCGACTATGTTATCTTACATGG - Intronic
1130711954 15:86292112-86292134 TGTGAAGATGTTACTTTACATGG + Intronic
1130923771 15:88370004-88370026 TGTGAATATGTTATATTACATGG + Intergenic
1131706154 15:94998792-94998814 TGTGATTATGTGACCTTACATGG + Intergenic
1131940414 15:97558621-97558643 TGTGAATATATTACCTTACATGG - Intergenic
1131997456 15:98145969-98145991 TGTCAATACGTTACCTTACATGG + Intergenic
1132155045 15:99489702-99489724 TGTGAATATGTTACCCCACATGG - Intergenic
1132167168 15:99605370-99605392 TGTGAATATGTTACATTACATGG - Intronic
1132198123 15:99929027-99929049 TGTGAATTTGTCCCCTTACATGG + Intergenic
1132426127 15:101718893-101718915 TGTGACTATGTGATCCTTAAGGG + Intronic
1132979043 16:2725660-2725682 AGTGAGTACATGACCTTACATGG - Intergenic
1133193985 16:4155285-4155307 TGTGAAGATGTCACCTTATATGG + Intergenic
1133481284 16:6173162-6173184 TGTGACTATGTTACCGTACATGG - Intronic
1133614531 16:7463671-7463693 TATAAATATGTTACCTTACATGG - Intronic
1133734257 16:8602088-8602110 TGTGACTCTGTTACCTTACATGG - Intergenic
1133843041 16:9427848-9427870 TGTGAATATATGACCTTACATGG + Intergenic
1133904824 16:10012591-10012613 TGTGAATATGTTACCTTACATGG + Intronic
1133909249 16:10050042-10050064 TGTGAATATGTTAACTTACATGG + Intronic
1133957235 16:10455155-10455177 TGTGAATATGTTACCTTACATGG + Intronic
1134099471 16:11441561-11441583 TGTCAATATGTGACCTTTCATGG + Intronic
1134119000 16:11570570-11570592 TCTGAATATGTGACCTTAAGTGG + Intronic
1134251570 16:12577925-12577947 TGTGAATGTATGACCTTACAAGG + Intergenic
1134253241 16:12589779-12589801 TGTGATTATGTTACCTTATGTGG + Intergenic
1134341181 16:13347879-13347901 TGTGAATATGTTGCATTACATGG + Intergenic
1134371826 16:13633117-13633139 TGTGAATATGTTACCTCACTTGG + Intergenic
1134600702 16:15531408-15531430 TATGAATCTGTTACCTTACACGG - Intronic
1134873747 16:17676639-17676661 TGTGAATGTGTTATCTTACATGG + Intergenic
1134893185 16:17859794-17859816 TGTGACTATGTGACCATCATAGG - Intergenic
1135073510 16:19373209-19373231 TAAGAATATGTTACCTTACATGG + Intergenic
1135198390 16:20414218-20414240 TGTGAGTATGTTATCTTACATGG + Intronic
1135202213 16:20447654-20447676 TGTGCCTATGTGTCAGTACATGG - Intergenic
1135216891 16:20580212-20580234 TGTGCCTATGTGTCAGTACATGG + Intergenic
1135408264 16:22213943-22213965 TGTGAATATGTTACCTTATATGG - Intronic
1135463170 16:22662572-22662594 TGTGAACATGTAACCTCACATGG - Intergenic
1135846924 16:25927356-25927378 TGTGACATTTTGACCTTCCATGG + Intronic
1136012133 16:27370664-27370686 TGTGAACATGTTACATTACATGG + Intergenic
1137583260 16:49647423-49647445 TATGAATATGTTACGTTACATGG + Intronic
1137733823 16:50709734-50709756 TGTGAATATGTTACCTTACGTGG - Intronic
1137804901 16:51295870-51295892 TATGAATATGTTACCTTACGCGG - Intergenic
1138210427 16:55158518-55158540 TGTGATTATGTTACCTCACATGG - Intergenic
1138487620 16:57356931-57356953 TATGAATATGTTACCTTACATGG - Intergenic
1138975846 16:62206825-62206847 TGTGATTATGTTACTTTACTTGG + Intergenic
1139092830 16:63669477-63669499 TATGAATATGTTATCTTACATGG - Intergenic
1139562479 16:67752179-67752201 TGTGACTATGTCACCTTTCATGG + Intronic
1139985497 16:70895267-70895289 TGTGAGTATGCTACCTTACATGG + Intronic
1140023267 16:71260051-71260073 TGTGAATATATTTCCTTACACGG + Intergenic
1140029592 16:71324811-71324833 TGTGAATATGTCACTTTATATGG + Intergenic
1140115986 16:72041920-72041942 TTTGACTAAGTGACTTAACAGGG - Intergenic
1140632080 16:76865186-76865208 TGTGATTATGTTACCTTACATGG - Intergenic
1140642369 16:76991107-76991129 TGTGAATGTGTTACCTTACATGG - Intergenic
1140708730 16:77656554-77656576 CGTGAATATGTTATCTTACATGG - Intergenic
1140944059 16:79751018-79751040 TGTGACTATGTTACTTTCCTTGG + Intergenic
1140959959 16:79902335-79902357 TGTGATTACGTTACCTTACTTGG - Intergenic
1140997239 16:80272793-80272815 TGTGGATATCTTACCTTACATGG + Intergenic
1140999440 16:80294861-80294883 TGTGAATATATTACCTTTCATGG - Intergenic
1141029027 16:80571734-80571756 TGTGACTGGGTGACCTCACATGG + Intergenic
1141066160 16:80915761-80915783 TGTGACTGTGTTACCTTACATGG - Intergenic
1141138503 16:81482286-81482308 TGTGACTATGTGGCCTGACATGG - Intronic
1141244606 16:82294213-82294235 AGTGAGTATGTTACCTTACATGG + Intergenic
1141304387 16:82847637-82847659 TGTGAATATGTTAGATTACATGG - Intronic
1141329959 16:83101937-83101959 TGTGAATGTGTTACCTTATATGG + Intronic
1141344667 16:83233809-83233831 TTTGACTATGTTAGGTTACATGG - Intronic
1141372671 16:83502147-83502169 TGTAAATATGTTACCTTACAGGG + Intronic
1141416253 16:83877638-83877660 TGTGAATATGACACCTGACATGG - Intergenic
1141459365 16:84168385-84168407 TATGAATACGTTACCTTACACGG - Intronic
1141747018 16:85932715-85932737 TGTGACTAAGTGACCTTTCATGG + Intergenic
1141747437 16:85935160-85935182 TGTGACTATGTGACCTTTCATGG + Intergenic
1141921681 16:87139709-87139731 TGTGACTATGTTACCTTCTGTGG + Intronic
1142833404 17:2566162-2566184 TGTGAATGTGTTACCTTTCATGG + Intergenic
1143348210 17:6266104-6266126 TGTGAATATGTTACCTTATACGG - Intergenic
1143353811 17:6309442-6309464 TGTGAATATGTTGCTTTACATGG + Intergenic
1143814008 17:9496614-9496636 TATGAATATGTTCCCTTACATGG + Intronic
1144047434 17:11466474-11466496 TGTGAATAAGTTACCTTCCATGG - Intronic
1144153636 17:12475823-12475845 TGTGAATATGTTACACTACATGG + Intergenic
1144192848 17:12862043-12862065 CCTGAATATGTTACCTTACATGG - Intronic
1144588804 17:16506193-16506215 TCTGAATATGTTACCCTACATGG - Intergenic
1145044302 17:19600879-19600901 AGTGATTATGCTACCTTACATGG - Intergenic
1146110584 17:30085431-30085453 TGTGAGTATGTCAGTTTACATGG + Intronic
1146466274 17:33089142-33089164 TGTGACTAGGTTGCCTTACATGG + Intronic
1146537860 17:33668633-33668655 TGTCAATATGTGACCTTATGTGG - Intronic
1146728353 17:35173769-35173791 TGTGAACGTGGGACCTTACATGG - Intronic
1147335973 17:39727215-39727237 TGTGACCCTGTCACCTTCCATGG + Intronic
1147886603 17:43688489-43688511 TGTGAATATGTTACCTTATGTGG - Intergenic
1148231554 17:45938552-45938574 TGTGAATATGTCACTGTACATGG - Intronic
1148397087 17:47317665-47317687 TGTGAATATGTTACCTTACGTGG + Intronic
1148841594 17:50502221-50502243 TGTAAATATGTTACCTTACAAGG - Intergenic
1148993165 17:51683999-51684021 TGTGAAAATGTTGCCTTACATGG + Intronic
1149028767 17:52061108-52061130 TGTGAATGTGTTACCTTATATGG + Intronic
1149040643 17:52184463-52184485 TGTGAATAAGTTACCTTACATGG + Intergenic
1149063323 17:52450362-52450384 TGTAATTATGTTACTTTACATGG - Intergenic
1150063815 17:62091942-62091964 TGTGAATATATTACCTTACTTGG + Intergenic
1150459042 17:65331816-65331838 AGTGAATATGTTACCTTATACGG + Intergenic
1150934639 17:69622548-69622570 TCTGAATATGTTACGTTACATGG - Intergenic
1151035795 17:70797583-70797605 TGTGAATGTGTTACCTTACGTGG - Intergenic
1151307060 17:73269774-73269796 TGTGGGTGTGTTACCTTACAAGG + Intergenic
1152102368 17:78309586-78309608 TGTGACTATGTCACCTTATATGG + Intergenic
1152174601 17:78779520-78779542 TGTGAATAGGTTACCTTACATGG + Intronic
1152211814 17:79006429-79006451 TGTGAATATGTTACATTACATGG - Intronic
1152373534 17:79905593-79905615 TGTGGCTATGTCACCTTACATGG - Intergenic
1153066762 18:1054043-1054065 TGTGATTATATTACCTTACATGG - Intergenic
1153076519 18:1167655-1167677 TGTGAATATGTTACATTACATGG + Intergenic
1153141135 18:1973639-1973661 TGTAACTATGTGACTTTCCAGGG + Intergenic
1153592377 18:6687156-6687178 TGTGAATATGTTATCTTACATGG - Intergenic
1153626332 18:7025175-7025197 TGTGACTATAAGACCTTGCCTGG + Intronic
1153724842 18:7943889-7943911 TGGGACTATGTTACCTTACATGG - Intronic
1153922708 18:9805587-9805609 TGTGACTATGTTAGGTTACATGG - Intronic
1154088076 18:11326949-11326971 TATGAATATGTTACCTTACATGG + Intergenic
1154272382 18:12931377-12931399 TGTGAATAGGTTACTTTACATGG - Intergenic
1155254133 18:23979801-23979823 TGTGACTATGTTATCTTTTATGG + Intergenic
1155361600 18:25008614-25008636 TGGGACTATGTTACCCTCCATGG - Intergenic
1155561277 18:27079991-27080013 TGTGACTCTGTAACCTTACATGG - Intronic
1155567451 18:27151488-27151510 TGTGAATATGTGACATTACATGG + Intronic
1156045522 18:32873020-32873042 TGTGACTATTTTACCTTCCATGG + Intergenic
1156259360 18:35430365-35430387 TGTGACTGTGTTAGGTTACATGG - Intergenic
1156261643 18:35449931-35449953 TGTGAATATGTTACTTTACTTGG - Intronic
1156314230 18:35952252-35952274 TATGAATACGTTACCTTACATGG - Intergenic
1156341555 18:36214378-36214400 TGTGAGGATGTGCCCTTACCTGG + Intronic
1156757977 18:40551623-40551645 TATGAATATGTTACATTACATGG - Intergenic
1156921018 18:42522472-42522494 TGTAAATATGTTACCTTACCTGG + Intergenic
1156922186 18:42535269-42535291 TGTGATTTTGTGAGCTTTCATGG + Intergenic
1157139862 18:45094917-45094939 TGTGAATATGTCATGTTACATGG - Intergenic
1157211182 18:45743307-45743329 TGAGAATATGTGACCTCACATGG - Intronic
1157327987 18:46682633-46682655 TGTGACTATGCAGCCTTACGTGG + Intronic
1157422200 18:47556487-47556509 TGTGAATATGTTCCTTTACATGG + Intergenic
1157659687 18:49429310-49429332 TCTGAATATGTTACATTACATGG - Intronic
1157689248 18:49667606-49667628 TGTGACCATGTGACCTTGGGTGG + Intergenic
1157717993 18:49902380-49902402 TGTGAGTGTGTTACCTTATATGG - Intronic
1157900784 18:51514695-51514717 TGTGAATATGTTAAGTTACATGG + Intergenic
1158160367 18:54475728-54475750 TGTGAATATGTTCCCTTCCATGG + Intergenic
1158696537 18:59708932-59708954 TGTGGGTGTGTTACCTTACACGG - Intergenic
1158808176 18:61000090-61000112 TGTGAATTTGTTACCATACATGG - Intergenic
1158922515 18:62209108-62209130 TGTGAATATGTTACTTTACATGG - Intronic
1158968179 18:62642107-62642129 TGTAAACATGTTACCTTACATGG + Intergenic
1159017240 18:63111230-63111252 TGTGAATATGTAAACTTACATGG + Intergenic
1159124571 18:64208132-64208154 TATGAGTATGTTACCTTATATGG + Intergenic
1159134963 18:64326760-64326782 TGTGACTATGTTCCCGTACATGG - Intergenic
1159257095 18:65960872-65960894 TGTGACTGTGTTACATGACAGGG - Intergenic
1159275168 18:66209923-66209945 TGTGAGTATATTATCTTACATGG - Intergenic
1159406240 18:68006467-68006489 TGTGATTATGTTACCTTATATGG - Intergenic
1159597546 18:70396693-70396715 TGTGAATATGTGAGGGTACACGG - Intergenic
1159796293 18:72848177-72848199 TGTGAATATGTTATGTTACATGG - Intronic
1159950079 18:74476494-74476516 TGTGAATATGTTACCTTATATGG + Intergenic
1160711758 19:555137-555159 TGTGACTGTGGGACGTGACAAGG - Intergenic
1161567947 19:5013768-5013790 TGGGACTATTTCACCTTCCATGG - Intronic
1161761967 19:6180219-6180241 TGTGAATATGTAATCTTTCATGG - Intronic
1162064767 19:8118605-8118627 TGTGACTGTGTGTCTGTACAAGG - Intronic
1163049507 19:14671557-14671579 TGTTAATATGTTACCTTACATGG - Intronic
1164417886 19:28061394-28061416 TGTGACTATAATACCTTACCTGG + Intergenic
1165155537 19:33784943-33784965 CGTGGTTATGTAACCTTACATGG + Intergenic
1166145034 19:40828254-40828276 TGTGAATTTGTTACCTTACATGG + Intronic
1166233838 19:41441883-41441905 TGTGACTATGTTACTTTCTATGG + Intergenic
1167016035 19:46841729-46841751 TGTGAATATGGGACCTTATATGG + Intronic
1167085493 19:47306995-47307017 TGTGAACAGGTGACCTTCCATGG + Intronic
1167090902 19:47342999-47343021 TGTGAAGAGGTGACCTTCCATGG + Exonic
1167285739 19:48598073-48598095 TGTGAATATGTGACCTTATGTGG - Intronic
1167344557 19:48937131-48937153 TGTGAATGTGTGACTTTACAAGG - Intronic
1167514502 19:49915212-49915234 CCTGTCAATGTGACCTTACATGG + Intronic
1167554549 19:50185949-50185971 TGTGAATATGCTACTTTACATGG - Intergenic
1167857455 19:52254172-52254194 TGTGATTATGTTATGTTACATGG + Intergenic
1168192344 19:54748394-54748416 TGTGAATATGTTATTTTACATGG - Intronic
1168196669 19:54779671-54779693 TGTGAATATGTTATTTTACATGG - Intronic
1168200247 19:54809895-54809917 TGTGAATATGTTATTTTACATGG - Intronic
1168205024 19:54843927-54843949 TGTGAATATGTTATTTTACATGG - Intronic
1168320425 19:55506141-55506163 TGTGAATATGTTACTTTACGTGG - Intronic
1168670665 19:58238794-58238816 TGTGAATATGTGACCCTACATGG - Intronic
1168689966 19:58370448-58370470 TCTGACTATGTTACTTCACAAGG - Intronic
926273130 2:11382739-11382761 TGTGACTGTTTTACCTTACATGG - Intergenic
926289944 2:11520791-11520813 TGTCAATATGTGACCTTAGTGGG - Intergenic
926574401 2:14564225-14564247 TGTGAATATGTTATCTTACACGG + Intergenic
926576321 2:14586231-14586253 TGTGAAAATGTTACCTTACATGG + Intergenic
926649892 2:15331808-15331830 TGTGACTATGTAACATGCCATGG + Intronic
926821076 2:16852190-16852212 TGTGCATATGTTACCTTACATGG - Intergenic
926845076 2:17127829-17127851 TGTGAATGTATTACCTTACATGG + Intergenic
926888422 2:17618543-17618565 TGTGAATATGTTACCTTACATGG - Intronic
926995062 2:18725856-18725878 GTTGAATATGTTACCTTACATGG + Intergenic
927093023 2:19726857-19726879 TGTGCCTATGTGACATTATATGG + Intergenic
927293386 2:21426093-21426115 TGTGACTGTTTTACCTTACATGG - Intergenic
927362123 2:22248344-22248366 TGTGAATATGTTACCCTACGTGG + Intergenic
927470590 2:23373084-23373106 TGTGTATATGTTACCTTATATGG + Intergenic
927653599 2:24927463-24927485 TGTGACTATGATGCCTTACATGG - Intergenic
927710318 2:25321522-25321544 TGTGAATATGTCACCTTACATGG - Intronic
927818191 2:26239381-26239403 TGTGAATATGTTAGGTTACACGG + Intronic
928318449 2:30264209-30264231 TGTGAATATGTAATGTTACATGG + Intronic
928340594 2:30439906-30439928 TGTAAATATGTTACCTTACATGG + Intergenic
928650746 2:33401174-33401196 TGTGGGTATGTTACCTTCCATGG + Intergenic
928777353 2:34781509-34781531 TGTCAATATGTTACCTTACATGG + Intergenic
928890447 2:36197696-36197718 TGTGACTATGTTACCTTATATGG + Intergenic
928970733 2:37025977-37025999 TGTGAATATGTTACCTTGCAGGG + Intronic
929057187 2:37888517-37888539 TGGAACTATGTTACCTTCCACGG + Intergenic
929094258 2:38248667-38248689 TGTTAATATGTTACCTTACATGG - Intergenic
929323846 2:40581209-40581231 TGTGAATATGTTACCTTACATGG - Intronic
929464167 2:42129779-42129801 TGTGAATATCTTACCTTACATGG + Intergenic
929827165 2:45317906-45317928 TGTGAATATGTTAGGTTACATGG + Intergenic
930035372 2:47082034-47082056 TGTGAATATGTTACCTTACAGGG + Intronic
930301558 2:49622093-49622115 TGTGAATATATTACTTTACATGG + Intergenic
930733679 2:54753335-54753357 TGTGAATATGTGACATTACATGG + Intronic
930936143 2:56954367-56954389 TGTGAGTATGTTATGTTACATGG - Intergenic
931133241 2:59363735-59363757 TGTGAATATGTTACCTTACAAGG - Intergenic
931375589 2:61704893-61704915 TGTGAATATGTTACCTTACATGG - Intergenic
931451521 2:62370970-62370992 TGTGAATATGTTACCTTACATGG + Intergenic
931456828 2:62416507-62416529 TGTGAATATGCTAGCTTACATGG + Intergenic
931686960 2:64802232-64802254 TGTGAGAGTGTGGCCTTACAAGG + Intergenic
931807530 2:65822177-65822199 TGTGAATATGTTATCTTACAGGG + Intergenic
932131614 2:69192614-69192636 TGTGAATATGTTACCTTACATGG - Intronic
932281300 2:70494299-70494321 TCTGACTATGCTACCTTACATGG - Intronic
932376081 2:71237169-71237191 TATGAATATGTTAACTTACATGG - Intergenic
932512757 2:72311640-72311662 TGTGACTATGTTACCTTATAGGG - Intronic
932849248 2:75168280-75168302 TGTGATTATGTTACCTGACATGG + Intronic
932850049 2:75175768-75175790 TGTGACTATGTCACTTTACACGG - Intronic
932879147 2:75484085-75484107 TGTGAATGTGTTACCTTATATGG - Intronic
933101158 2:78259471-78259493 TGTGAATATGTTACCGTACATGG - Intergenic
933112767 2:78424978-78425000 TGTGACTATGCTGCTTTACATGG - Intergenic
933150522 2:78909554-78909576 TGAGACTATGTTACCTTGCACGG + Intergenic
933218009 2:79652682-79652704 TGTAAATATGTTACCTTAAATGG - Intronic
933328572 2:80869126-80869148 TGTGAATATGTCACCTTACATGG + Intergenic
933430331 2:82169083-82169105 TGTGAATTTGTTACCTTACTTGG - Intergenic
933449165 2:82424518-82424540 TTTGAGTATGTTACATTACAAGG + Intergenic
933463866 2:82625137-82625159 TGTAAATATGTTACCATACATGG + Intergenic
933616212 2:84484778-84484800 TGTGACCATGCTGCCTTACATGG - Intergenic
933616658 2:84488744-84488766 TGTAAATATGTCTCCTTACATGG - Intergenic
934032886 2:88064376-88064398 TGTGAATATGTTACCTTATATGG - Intergenic
934508345 2:94915561-94915583 TGTGAATATGTTACCTGACATGG + Intergenic
934559011 2:95302628-95302650 GGTGACAATGTGCCCTCACAGGG - Intronic
934688428 2:96338490-96338512 TGTGAATATGTTATCTTACGTGG + Intronic
934960884 2:98671694-98671716 TCTGAATATGTTACCTTACATGG + Intronic
935072046 2:99703309-99703331 TGTGATTGTGTTACCTTACGTGG - Intronic
935261667 2:101361315-101361337 TGTGAATATGTTCCCTTACATGG + Intronic
935296766 2:101656524-101656546 TGTGAATTTGTTACATTACATGG + Intergenic
935391562 2:102558548-102558570 TGTGAATATGTTACTTTATATGG + Intergenic
935621831 2:105136686-105136708 TGTGAATATGTTACCTTACAAGG + Intergenic
935679939 2:105627317-105627339 TGTGAATATGTAACTTTATATGG - Intergenic
935806798 2:106756892-106756914 TGTGAATATGGCACTTTACATGG - Intergenic
935933794 2:108158875-108158897 TGTGAATATGTCAATTTACACGG + Intergenic
936090176 2:109496754-109496776 CATGACTATGTTACCATACATGG + Intronic
936098907 2:109557624-109557646 TCTGACAATGTAAACTTACAAGG + Intronic
936506108 2:113108618-113108640 TGTGACTATGTTAGGTTACATGG - Intronic
936619574 2:114081669-114081691 TGTGAATATGTTACCCTACAAGG + Intergenic
936622247 2:114112459-114112481 TGTGAATATGGTACCTTATATGG - Intergenic
937157480 2:119731293-119731315 AGTGAATAGGTGACCTTACATGG + Intergenic
937269120 2:120636606-120636628 GGTGACTATGTCACCTTGCATGG + Intergenic
937270001 2:120643622-120643644 TGTGAACATGTCACCTTACATGG - Intergenic
937363534 2:121245016-121245038 TGTGAATATGTCACCTAACATGG + Intronic
937431507 2:121842588-121842610 TGTGAATATGTTACTTTACATGG + Intergenic
937496382 2:122424790-122424812 TGAGGCTATGTGAGCTTACATGG + Intergenic
937518677 2:122685182-122685204 TGTGCCCACGTGACCTTGCAGGG + Intergenic
937583211 2:123514423-123514445 TGTGAATATGTTACCTTATGTGG + Intergenic
937600110 2:123721366-123721388 TGTGAATATGTTACCCTACCTGG - Intergenic
938681825 2:133699931-133699953 TGTGAATATGTTATCTTACATGG - Intergenic
938710702 2:133974037-133974059 TGTGACTATGTTATCCTGCATGG - Intergenic
938728666 2:134129404-134129426 TGTGCTTATGTTGCCTTACAGGG - Intronic
938790771 2:134673502-134673524 TGTGAATATATTGCCTTACAAGG + Intronic
938801794 2:134770647-134770669 TGTGAATATGTTACCTTACATGG - Intergenic
938803254 2:134782754-134782776 TGTGAATATGTTACCATACATGG - Intergenic
938808917 2:134833769-134833791 TGTGAATATGTTACTTTACATGG + Intergenic
939509424 2:143088513-143088535 TATAAATATGTTACCTTACATGG - Intergenic
939528673 2:143329174-143329196 TGTGACTAGGTTACATTATACGG + Intronic
939558256 2:143702950-143702972 TGTGACTATGTTACCTCACATGG - Intronic
939810250 2:146823170-146823192 TGTGAATATGTTACCTTACATGG + Intergenic
940041094 2:149361782-149361804 TGTCAGTATGTTACCTTACATGG + Intronic
940189198 2:151020891-151020913 GGTGAATATGTTACCTGACATGG - Intronic
940224274 2:151385225-151385247 TGTGACTATATTATCTTACATGG + Intergenic
940329402 2:152458068-152458090 TATGAATATGTTACCATACATGG - Intronic
940521908 2:154761866-154761888 TGTGAATATATTACCTTACATGG + Intronic
940546589 2:155096509-155096531 TGGGAATATGTTACCTTACCTGG + Intergenic
940556954 2:155240770-155240792 TATGACTATGTTATATTACAAGG - Intergenic
940868925 2:158843666-158843688 TGTGACTATGTTACCTTCCATGG - Intronic
941114232 2:161452936-161452958 GGTGAATATGTTATCTTACATGG - Intronic
941170208 2:162126905-162126927 TGTGAATATGTTACCTTGCCTGG + Intergenic
941304018 2:163838781-163838803 TGTGAATTTGTTACCTTACATGG + Intergenic
941468453 2:165856965-165856987 TGTGAATGTGTTAACTTACATGG + Intergenic
941547839 2:166876221-166876243 TATCACTATGTTAACTTACATGG + Intergenic
941573693 2:167203150-167203172 TATGAATATGCGACCTTACATGG - Intronic
941678548 2:168370665-168370687 TGTGAATATATTACCTTTCATGG + Intergenic
941947336 2:171114282-171114304 TGTGACTATGTTACCTTACATGG + Intronic
942493029 2:176508981-176509003 TTTGAATATGTTACCTTACATGG - Intergenic
943197925 2:184779451-184779473 TGTGAATATGTTAGGTTACATGG + Intronic
943779794 2:191810544-191810566 TGTGAATATATTACCTTACTTGG - Intergenic
943996180 2:194768949-194768971 TGTGAATATGTTAGCTTACATGG + Intergenic
944086058 2:195849376-195849398 TGTAACTATGCCACGTTACATGG - Intronic
944196257 2:197056917-197056939 TGTGAATATGTTACCTTACATGG - Intronic
944365912 2:198919386-198919408 TGTGAATATGTCACCTGACATGG - Intergenic
944606105 2:201352769-201352791 TGTGACTATGTTACCTTACATGG + Intronic
944903390 2:204238625-204238647 TGTGAATATGGTACCTTACAGGG + Intergenic
944922331 2:204428600-204428622 TGTGAATATGTTACCTCACATGG + Intergenic
944923611 2:204440253-204440275 TATGAGTATGGTACCTTACATGG + Intergenic
945029868 2:205653174-205653196 TGTGAATATGTTACCTTAACAGG + Intergenic
945230979 2:207589506-207589528 TGTGAGTATGTTACCTTATATGG - Intronic
945441728 2:209887527-209887549 TGTGAATATGTTGCCTTACATGG - Intronic
945523870 2:210864285-210864307 TGTGAACACGTGACTTTACATGG + Intergenic
945556547 2:211283030-211283052 TATGAATATGTCACCTTACATGG + Intergenic
945642751 2:212450273-212450295 TGTGACTATATTAACTTACATGG + Intronic
945807729 2:214510869-214510891 TGTCATTATGTTACCTTACATGG + Intronic
945810916 2:214549258-214549280 TGTAAATATGTCACCTTACATGG - Intronic
945830295 2:214776720-214776742 TGTGACTATGTTACCTTACGTGG + Intronic
945932322 2:215867254-215867276 TGTGAATATGTTATGTTACATGG - Intergenic
946038571 2:216764586-216764608 TGTGAATATGTTAAGTTACATGG - Intergenic
946150985 2:217770489-217770511 TGTGAATGTGTTAACTTACATGG - Intergenic
946473015 2:219980491-219980513 TGTGAATATATTACTTTACATGG + Intergenic
946528384 2:220544297-220544319 TGTCAAAATGTGACCTTACATGG - Intergenic
946566537 2:220971828-220971850 TGTGAATATGTTAGCTTACTTGG + Intergenic
946792774 2:223318314-223318336 TGTGAATATGTTACCTTACATGG - Intergenic
946933342 2:224693750-224693772 TGTGTCTATGTCACCTTCCAAGG + Intergenic
947041881 2:225931794-225931816 TGTGACTATATTATGTTACATGG + Intergenic
947274896 2:228379485-228379507 TGTGACTATGTTATGTTATATGG - Intergenic
947307847 2:228766700-228766722 TGTGGCTTTGTGACTTCACATGG - Intergenic
947425928 2:229982838-229982860 TGTGAATATGGGACCTCACACGG - Intronic
947432605 2:230044057-230044079 AGTGAATATGTGACCTAATAGGG + Intronic
947435681 2:230069958-230069980 TGTGAATTTGTTACCTTACATGG - Intergenic
947504946 2:230701006-230701028 TGTGAATACGTGACCTTAGGTGG - Intergenic
947567828 2:231206054-231206076 TGTGAATACGTGAGGTTACACGG - Intronic
947584803 2:231348102-231348124 TGTGACTAAATGACATTACATGG + Intronic
947990627 2:234484844-234484866 TGTGAATATGTTACCCCACACGG + Intergenic
948036970 2:234865586-234865608 TGTGAATATGTTACCATACATGG - Intergenic
948193927 2:236080968-236080990 TGTGACTATGTGACCTTACATGG - Intronic
948326208 2:237123729-237123751 TATAACTATGAGACCTTACATGG + Intergenic
948435205 2:237948626-237948648 TGTGAATATGTTGCCTCACAAGG - Intergenic
948436820 2:237959416-237959438 AGTGAATATATGACTTTACATGG - Intergenic
948618089 2:239214442-239214464 TGTGACTGTGTAACCTTACCCGG - Intronic
1168802219 20:650906-650928 TCTGAATGTGTTACCTTACATGG + Intronic
1168901339 20:1367679-1367701 TGTGAATGTGTCACCTTACATGG - Intronic
1169247834 20:4037858-4037880 TGTGAGTATATTACCTCACATGG - Intergenic
1169416803 20:5424145-5424167 TGTGAGTATGTTATCTTACTTGG - Intergenic
1169453002 20:5728270-5728292 TGTGAATATGTTACTTTACAGGG + Intergenic
1169756213 20:9046050-9046072 TGTGAATATGTTATTTTACATGG + Intergenic
1169844475 20:9974753-9974775 TCTGCATATGTAACCTTACATGG - Intergenic
1170413925 20:16120419-16120441 TGTGACTATGTTACCTTACATGG - Intergenic
1170567463 20:17615242-17615264 TGTGACCATGTGACACTGCAGGG + Intronic
1170730004 20:18965573-18965595 TGTGAATATATTACTTTACATGG + Intergenic
1171063185 20:21986591-21986613 TGTGAATATGTCATATTACATGG + Intergenic
1171110505 20:22476621-22476643 TGTGTCTATGTCAGATTACAAGG - Intergenic
1171211992 20:23324321-23324343 TGTGACTACGTGACTTTACATGG - Intergenic
1171460325 20:25294417-25294439 TGTGCCCATGAGACCTTACTGGG + Intronic
1171726202 20:28623295-28623317 TGTGACCATATTACTTTACATGG - Intergenic
1171751927 20:29060078-29060100 TGTGACCATATTACTTTACATGG + Intergenic
1171857311 20:30359045-30359067 TGTGACCATATTACTTTACATGG + Intergenic
1172046336 20:32083289-32083311 TGGGAATATGTTACCTTACATGG - Intronic
1172049129 20:32102979-32103001 TGTGAAAATGTTACCTCACATGG - Intergenic
1172760296 20:37316684-37316706 TGTGACTCTGTGAGCTGACCCGG - Exonic
1172886595 20:38235364-38235386 CTTGAATATGTTACCTTACATGG + Intronic
1173052307 20:39575335-39575357 TTTGAATATGTTACCTTACATGG + Intergenic
1173327230 20:42045156-42045178 TGTGAATATGTTAGGTTACATGG - Intergenic
1173470907 20:43322898-43322920 TGTGAATATGGTACCTTACAAGG + Intergenic
1173573695 20:44096180-44096202 TGTGAGCATGTTACCTTGCATGG - Intergenic
1173832786 20:46102669-46102691 CGTGAATATGTCACCTTAAACGG + Intergenic
1173888182 20:46480221-46480243 TGTGAGTATGTGACCTTACTTGG - Intergenic
1173888419 20:46481891-46481913 TGTGAATGTGTTACCTTACATGG + Intergenic
1174419762 20:50391794-50391816 TGTGAACATGTGACCTTACATGG + Intergenic
1174481228 20:50832917-50832939 TGTGAATATGTCACCTTCCTTGG - Intronic
1174552918 20:51374566-51374588 TGTGAATATGTTACCTCATAAGG - Intergenic
1174661110 20:52214027-52214049 CGTGAGTATGTTACCTAACATGG - Intergenic
1174661260 20:52215163-52215185 TGTGAATATGTTACCTTACAGGG + Intergenic
1174705323 20:52649400-52649422 TGTGAATATGTTGCCTTACCTGG + Intergenic
1174856489 20:54050305-54050327 TATGAGTATGTGACCTTACATGG - Intronic
1175021815 20:55859194-55859216 TATGAATATGTTACCCTACATGG + Intergenic
1175059187 20:56226370-56226392 TATGAATATGTTACCTTACATGG + Intergenic
1175074978 20:56364540-56364562 TGTGAATATGTCACCTTACATGG - Intronic
1175148466 20:56914143-56914165 TGTGAATATGTCACCTTACATGG + Intergenic
1175172467 20:57090236-57090258 TGTGAACATGTCACTTTACATGG + Intergenic
1175270994 20:57734146-57734168 TGTGAATATGCAACTTTACAAGG - Intergenic
1175385411 20:58591799-58591821 TGTGAATGTGTCATCTTACAGGG + Intergenic
1175478725 20:59296292-59296314 TGTGAATATGTCAACTAACATGG - Intergenic
1175505614 20:59482332-59482354 TATGAATGTGTGACCTTACATGG - Intergenic
1175774308 20:61643420-61643442 TGTGAATTTGTGACCTTACACGG - Intronic
1176064077 20:63185408-63185430 TATGACCATGTGTCCTTCCATGG - Intergenic
1176924210 21:14727132-14727154 TGTGAATATGTTAATTTACATGG + Intergenic
1176958528 21:15133501-15133523 TGTGAATATGTTATCTTCCATGG - Intergenic
1176964740 21:15199464-15199486 TGAGAGAACGTGACCTTACAGGG - Intergenic
1176978629 21:15353434-15353456 TATGAATATGTTACCTTACAGGG + Intergenic
1177140254 21:17350738-17350760 TGTGAATACATTACCTTACATGG - Intergenic
1177278131 21:18942499-18942521 TGTGAATATGTCAATTTACATGG - Intergenic
1177573819 21:22924695-22924717 TGTGAACATGTTACCTTACATGG + Intergenic
1177588326 21:23128354-23128376 TATAAATATGTTACCTTACATGG - Intergenic
1177710113 21:24762971-24762993 TGTAAATATGTTACCTTATATGG - Intergenic
1177710837 21:24772399-24772421 TGTAAATATGTTACCTTACCTGG + Intergenic
1178010240 21:28276641-28276663 TGTGAATATATTACTTTACATGG + Intergenic
1178020653 21:28404573-28404595 TGTAAATATGTTACCTTGCATGG - Intergenic
1178046975 21:28706029-28706051 TGTGAATATGTTGCCTTACAAGG - Intergenic
1178183511 21:30192248-30192270 TGTGAATATGTTATCTTACATGG - Intergenic
1178461282 21:32804994-32805016 TGTGAATACATTACCTTACATGG + Intronic
1178637199 21:34314576-34314598 TGTGAGTGTGTTACCTTACATGG + Intergenic
1178642339 21:34355229-34355251 TGTGAATATGTTACCTTACCTGG + Intergenic
1178751535 21:35308811-35308833 TGTGCATATATTACCTTACATGG - Intronic
1178787050 21:35663528-35663550 TGTGATCAGGTTACCTTACATGG - Intronic
1179038563 21:37781951-37781973 TGTGAACATGTTACTTTACATGG + Intronic
1179147000 21:38776631-38776653 TGTAAATATGTGGCCTTACATGG + Intergenic
1179240062 21:39581996-39582018 TGTGACTATGTTAGGTCACATGG + Intronic
1179241557 21:39597527-39597549 TGTGAATATGGCACATTACATGG + Exonic
1179252620 21:39685168-39685190 TGTGAATATGTTAGATTACATGG - Intergenic
1179355482 21:40654845-40654867 GGTGAATATTTCACCTTACATGG - Intronic
1179471762 21:41614971-41614993 TGTGAATATGTGACCTTATGTGG - Intergenic
1179517641 21:41919816-41919838 TGTGACTGTGAGACCCTACAGGG + Intronic
1179586562 21:42377151-42377173 TGTGACTGTGTCACCTTACAGGG + Intronic
1179792452 21:43763423-43763445 TGTGAATTTGTGACCTTACCTGG - Intergenic
1180391106 22:12282915-12282937 TGTGACCATATTACTTTACATGG - Intergenic
1180408634 22:12581838-12581860 TGTGACCATATTACTTTACATGG + Intergenic
1180606445 22:17062387-17062409 TGTGAATTTCTGACCTTACCTGG - Intergenic
1181145298 22:20841667-20841689 TGTGAATATGTTACTTTACATGG + Intronic
1181990440 22:26832872-26832894 TGTGAATATGTTATCTTACATGG - Intergenic
1182106293 22:27692175-27692197 TGTGAATATGTTACTTTACCTGG + Intergenic
1182127372 22:27825862-27825884 TGTGACTATGTTACCTTACAGGG - Intergenic
1182266484 22:29119843-29119865 TGTGAATACGTTACCTTAGATGG + Intronic
1182995539 22:34808655-34808677 TGTGACTCTGTCACCTTACATGG + Intergenic
1183125147 22:35771128-35771150 AGTGAATATGTTACCTTACACGG + Intronic
1183514877 22:38259338-38259360 TGTGAACATGCTACCTTACATGG + Intronic
1184298149 22:43539206-43539228 TGTGACTATGTTGTCTTACATGG - Intronic
1184422025 22:44387606-44387628 TGTGAATGTGTCACCTTTCATGG + Intergenic
1184494048 22:44826992-44827014 TGTGATTAGGTCACCTTACATGG + Intronic
1184534043 22:45074325-45074347 TGTGAGTGTGTCACCTGACATGG - Intergenic
1184558107 22:45244474-45244496 TGTGAATATGTTGCCTTACCTGG + Intergenic
1184618025 22:45651340-45651362 TGTGAATATGTCAAATTACAAGG + Intergenic
1184805164 22:46790426-46790448 TGTGACTACGTCACCTTACATGG - Intronic
1184832311 22:46996523-46996545 TGTGGATGTGTGGCCTTACATGG - Intronic
1184931971 22:47688014-47688036 TGCGAACATGTCACCTTACATGG - Intergenic
949118591 3:358468-358490 TATGACTTTGTTACTTTACATGG - Intronic
949357543 3:3197880-3197902 TGTGCATATGTTACCTTAAATGG - Intergenic
949438592 3:4056143-4056165 TGTGAATATGTTAGGTTACACGG - Intronic
949479090 3:4476507-4476529 TGTAAATATGCCACCTTACATGG + Intergenic
949485882 3:4537498-4537520 TGTGAATATGTTACCTCATATGG + Intronic
949521332 3:4856922-4856944 TGTGAATATGTTGCCTTACATGG - Intronic
949644547 3:6077904-6077926 TGTAACTATGTTACCTGACATGG + Intergenic
949852184 3:8430434-8430456 TGTGATTTTGTTACCCTACATGG + Intergenic
950340000 3:12234673-12234695 TGTGACAGTGTCACCTTAGAGGG + Intergenic
950365931 3:12484203-12484225 CGTGACTATGTGACATTTGACGG + Intergenic
950570178 3:13794931-13794953 TGGGACTATGTTACCTTATATGG + Intergenic
951390625 3:22099146-22099168 TGTGACTATGTCAGTTGACATGG + Intronic
951569979 3:24051810-24051832 TCTGCTTATGTGACCTTTCAGGG - Intergenic
951641240 3:24838357-24838379 TGTGAATAAGTTACCTTTCATGG - Intergenic
951814767 3:26741808-26741830 TATGAATAGGTGACCTTACATGG + Intergenic
951820038 3:26798151-26798173 TGTGAATATGTTACCTTACATGG + Intergenic
952164685 3:30734178-30734200 TGAGACTTTGTGATCTAACATGG - Intronic
952324992 3:32313059-32313081 CATGAATATGTTACCTTACATGG - Intronic
952483169 3:33783098-33783120 TGTGAATATGTTGCCTTAAATGG + Intergenic
952581544 3:34838968-34838990 TGTGTCTCTGTGTCCTCACATGG + Intergenic
952816008 3:37448770-37448792 TGTGAATATGTCACCTTATATGG - Intergenic
952883569 3:37999753-37999775 TGTGATTATGTGCAATTACAAGG - Intronic
953064096 3:39453556-39453578 TGTGAGTATGTTACCTTATGGGG + Intergenic
954623699 3:52010558-52010580 TGTGATTATGTTACTTAACATGG + Intergenic
954850594 3:53596472-53596494 TGTGAGTATGTTACCTTACATGG + Intronic
954894117 3:53961137-53961159 TGTGAATATGTTGTCTTACATGG + Intergenic
955022608 3:55135537-55135559 TGTGAATATGCTACCATACATGG - Intergenic
955142141 3:56279943-56279965 TGTGTATATGTTACTTTACATGG + Intronic
955169602 3:56550405-56550427 TGTGAATATGTAACCTTACATGG - Intergenic
955223176 3:57039892-57039914 TGGGACTGTGTTACCTTACATGG - Intronic
955463191 3:59208169-59208191 TATGAATATGTTACCTTACATGG + Intergenic
955467627 3:59253330-59253352 TGTGCATATGTCACCTTATATGG + Intergenic
955514049 3:59709146-59709168 TGTGAATATGTTACCTTACGTGG + Intergenic
955679992 3:61490171-61490193 TGTGAACATGTTACCTTACATGG + Intergenic
955863639 3:63358537-63358559 TGTGAACCTGTTACCTTACATGG - Intronic
955896592 3:63707091-63707113 TGGGAATATGTTACCTTACATGG - Intergenic
955898400 3:63725788-63725810 TGGGACTATGTGAGCTTGAAAGG - Intergenic
956096008 3:65716987-65717009 TGTGAATATGTTCCCTTACATGG + Intronic
956196481 3:66657913-66657935 TGTGAATATGTTATCTTAAATGG - Intergenic
956229045 3:66992505-66992527 TGTGACTATGTTATCTCACATGG - Intergenic
956353039 3:68359331-68359353 TATGAATATGTTACCCTACAAGG + Intronic
956374067 3:68595272-68595294 TGTGAATATGTTACCTTACATGG - Intergenic
956552290 3:70474797-70474819 TGTGTCTCTGTGTCTTTACATGG + Intergenic
956561435 3:70580602-70580624 TGTGAATATGTTACTTTACAGGG + Intergenic
956586386 3:70869580-70869602 TGTGAATATGTTACTTTACATGG + Intergenic
956721941 3:72125658-72125680 TGTGGATGTGTTACCTTACATGG + Intergenic
956860629 3:73320407-73320429 TGTGAATATGTTACATTACATGG - Intergenic
956899825 3:73703824-73703846 TATAACTATGTCACCTTACATGG - Intergenic
956974615 3:74565520-74565542 TATGAATATGTTACCTTCCATGG - Intergenic
957568251 3:81911821-81911843 TGTGAATATGTTGCTTTACATGG - Intergenic
957586103 3:82134014-82134036 TGTGACTGTGTTATCTTACAGGG - Intergenic
957943409 3:87033903-87033925 TGTGAATATGTTACCTTATGTGG + Intergenic
958009443 3:87857828-87857850 TGTGAATATGTTACCTTACATGG - Intergenic
958045911 3:88283379-88283401 TGTGAAAACGTGACTTTACAAGG - Intergenic
958482478 3:94660772-94660794 TGTGAATATGTTACCTAACATGG + Intergenic
958787804 3:98617260-98617282 TGTGAATATGTTACCTTTCATGG - Intergenic
958853783 3:99359988-99360010 TGTGAATATATCACCTTACATGG + Intergenic
958860716 3:99442303-99442325 TGTGAATATGTTACATCACATGG - Intergenic
958964654 3:100545881-100545903 TGTGAATATATTACCTTACTTGG + Intronic
959010828 3:101074133-101074155 TGTGAATATATCACCCTACATGG + Intergenic
959167069 3:102793773-102793795 TGTAAATATGTTACCTTACATGG + Intergenic
959283424 3:104377437-104377459 TTTGAATATGTTACCTTACATGG + Intergenic
959297617 3:104557156-104557178 TGTGAATATGTTATATTACATGG - Intergenic
959319633 3:104855131-104855153 TGTGAGCATGTTACCTTAGATGG + Intergenic
959472314 3:106767095-106767117 TCTGACTATGTTATCTTATATGG + Intergenic
959592716 3:108097542-108097564 TGTGAATATGTTACTTTACGTGG - Intergenic
959712767 3:109401428-109401450 TGTGTCTCTGTGTCTTTACAGGG + Intergenic
959794950 3:110415284-110415306 TGTGAGTATGTTGCCTTACATGG + Intergenic
959861938 3:111226322-111226344 TGTGAAAATGTAACCTTACATGG - Intronic
959908017 3:111731785-111731807 TATGAGTATGTTATCTTACATGG - Intronic
959965949 3:112355047-112355069 TGTGAATATGTTACTTTACATGG - Intronic
960085886 3:113590930-113590952 TGTGAATATGTTACCTTACCTGG + Intronic
960179958 3:114564294-114564316 TGTGAGTATGTTGCCTTAGATGG - Intronic
960236697 3:115291707-115291729 TGTGAGTTTGTTACCTTACGTGG + Intergenic
960300944 3:116001895-116001917 TGTGAATATGCTACCTTACATGG - Intronic
960305412 3:116054355-116054377 TGTGACTATGTTACCTTGAAAGG - Intronic
960400557 3:117192652-117192674 TATGAATATGTCACTTTACAGGG + Intergenic
960514535 3:118589132-118589154 TGTGAATATGTTACATTACATGG + Intergenic
960636971 3:119793744-119793766 TGTGAATATGTTTCCTTATATGG - Intronic
960673728 3:120175480-120175502 TGTGAATATGTGACCTTATGTGG + Intronic
960704876 3:120472345-120472367 TGTGAATGTGTTACTTTACATGG + Intergenic
960748553 3:120918301-120918323 TGTGAATATGTTAGCTTATATGG - Intronic
960897985 3:122526233-122526255 TATGAATATGTTACCTTACATGG - Intergenic
961078724 3:124005893-124005915 TGTGAATATGTTACCTTACAGGG + Intergenic
961170642 3:124795565-124795587 TGTGACTGTGTGGCCTTACGTGG + Intronic
961345712 3:126262027-126262049 TGGGAATATGTCACCTTACATGG + Intergenic
961611513 3:128143510-128143532 AGTGAATATGTTACCTTCCATGG - Intronic
961669654 3:128519606-128519628 TGGGAATATGTCACTTTACATGG + Intergenic
961991068 3:131191599-131191621 TTTGAATATGTTATCTTACATGG - Intronic
962012478 3:131405889-131405911 TGTGAATATGTGACTTTGTATGG - Intergenic
962444901 3:135455501-135455523 TGTGCATATGTTATCTTACATGG - Intergenic
962644988 3:137429406-137429428 TGTGACTATATTGCCTTACATGG - Intergenic
962855151 3:139338539-139338561 TGTGTGTGTGTGGCCTTACATGG - Intronic
962886517 3:139632835-139632857 TGTGAATATGTTATATTACATGG + Intronic
962979303 3:140473369-140473391 TGTGAATATGTGGCATTACATGG + Intronic
963075748 3:141344869-141344891 TGTGAATATGTTACCTTCCATGG - Intronic
963107427 3:141659308-141659330 TGTGGATATGTTACCTTATATGG - Intergenic
963110783 3:141686193-141686215 TGTGAATATGTCACTTCACATGG + Intergenic
963169799 3:142239512-142239534 TGTGAATGTGTTGCCTTACATGG + Intergenic
963372546 3:144419641-144419663 TGTGAATGTGTTACCTTACATGG - Intergenic
963909218 3:150800732-150800754 TGTGAATATGTTACTTTACATGG - Intergenic
963981333 3:151540832-151540854 TGTGAATATGATACCTTGCATGG + Intergenic
964020043 3:151999115-151999137 TCTGAATATGTTACCTTACATGG + Intergenic
964143788 3:153434113-153434135 TGTGAATATATTGCCTTACAGGG - Intergenic
964206450 3:154180232-154180254 TGTGAATATGTTATCTTACATGG - Intronic
964441046 3:156710518-156710540 TGTCAATATGTAACCTTATATGG + Intergenic
964466914 3:157003705-157003727 TGTGAGTATGTTTCCTTATATGG - Intronic
964621561 3:158724325-158724347 TGTGACTATGTTATTTTACATGG + Intronic
964670399 3:159219119-159219141 TGTGAATTTGGTACCTTACATGG - Intronic
964828981 3:160862041-160862063 TGTGAATACATTACCTTACATGG - Intronic
964862675 3:161219915-161219937 TGTGAATATATTACCTAACATGG + Intronic
964897098 3:161611831-161611853 TGTGAACCTGTCACCTTACATGG - Intergenic
965056649 3:163725660-163725682 TGTGATTATTTTACCTTAGATGG - Intergenic
965217930 3:165888262-165888284 TCTGAATATGTTACCTTACATGG - Intergenic
965555961 3:170018670-170018692 TATGAATATGTTACCTTACCTGG - Intergenic
965701924 3:171466948-171466970 TGTAATTACGTTACCTTACAAGG + Intergenic
966018542 3:175176511-175176533 TGTGAATATATTACCTTGCATGG + Intronic
966101222 3:176270641-176270663 TGTGATTCTGTCACCTTACATGG + Intergenic
966101305 3:176271771-176271793 TGTGATTCTGTTACCTTACATGG + Intergenic
966666147 3:182473133-182473155 TATGAGTATGTCACATTACATGG - Intergenic
967000258 3:185327360-185327382 TGTGAATATGTTACCTTCCATGG - Intronic
967279135 3:187805436-187805458 TGTGAATATGTTATATTACATGG + Intergenic
967629249 3:191724102-191724124 TGTGGATATGCTACCTTACATGG - Intergenic
967894716 3:194386520-194386542 TGTGAATATGTTACCTCAGATGG - Intergenic
968142308 3:196268463-196268485 TGTGACTGTTTTACCATACATGG + Intronic
969174705 4:5389765-5389787 TGTGCCTGTGTCACCTTACAGGG + Intronic
969309524 4:6345383-6345405 TGTGACTATGTTATGCTACACGG + Intronic
969342764 4:6552709-6552731 TGTGAATTTGTTACCTTACATGG - Intronic
969377427 4:6772014-6772036 AGCGACTATGTTACCTTACCTGG - Intergenic
969496123 4:7527269-7527291 TGTGACTATGCTACCTTACATGG + Intronic
969595934 4:8149309-8149331 TGTGACTATGTGACCTCATGCGG - Intronic
969843903 4:9904550-9904572 TGGGAATATATTACCTTACATGG - Intronic
969863074 4:10052887-10052909 TGTGAATATGTCACCATACCTGG + Intronic
970063966 4:12069719-12069741 TGTGAGTATATTACCTTACACGG + Intergenic
970176622 4:13346069-13346091 TGTGAATATGTTACCTTCCTTGG + Intergenic
970466860 4:16332872-16332894 TGTGACTATGTTACCTCACGTGG - Intergenic
970493400 4:16599507-16599529 TCTGTGAATGTGACCTTACATGG - Intronic
970554582 4:17218357-17218379 TGTGAATATGTGATGTTGCATGG - Intergenic
970580015 4:17466575-17466597 TGTGAATATGGCACCTTACATGG + Intronic
970602808 4:17653749-17653771 ACTGAGTATGTTACCTTACATGG + Intronic
970658006 4:18253397-18253419 TGTGGCTATGTGATATTACATGG + Intergenic
970814287 4:20135678-20135700 GGTTAATATGTTACCTTACATGG - Intergenic
971460996 4:26896350-26896372 TGTGATTATGATACATTACATGG - Intronic
971536921 4:27764471-27764493 TGTGATTATGTCAGTTTACACGG + Intergenic
971694695 4:29885483-29885505 TGTGAATATGTCAGGTTACATGG + Intergenic
971759560 4:30747736-30747758 TGTGAATATGTTACCTTACATGG - Intronic
971793333 4:31196843-31196865 TGTGAATATGTTAACTTACTTGG + Intergenic
971813665 4:31460629-31460651 TGTGAATATGTTACCTTACATGG + Intergenic
971985221 4:33813377-33813399 TGTGCATATGTTACCATACATGG - Intergenic
972003307 4:34066581-34066603 TGTGATTATGTTACCTTATAGGG - Intergenic
972027169 4:34396955-34396977 TGTGAATGTATTACCTTACATGG - Intergenic
972080087 4:35139646-35139668 TGTGAATATGGTATCTTACATGG - Intergenic
972233248 4:37099655-37099677 TGTGACTATGTTACATTACATGG + Intergenic
972297782 4:37756760-37756782 TGTGAATATGTCACCTTACATGG + Intergenic
972354816 4:38270313-38270335 TGTGACTATGTTATCTTACATGG + Intergenic
972360263 4:38320062-38320084 TGAGACCATGTGTCCTTACCCGG + Intergenic
972791527 4:42375719-42375741 TGTGACTATGTTACCTTACATGG - Intergenic
972874918 4:43346718-43346740 GGTGACTATGTTACCTTGCATGG + Intergenic
972908554 4:43784152-43784174 TGTGAATATTTTACCTTACAGGG + Intergenic
973167585 4:47096534-47096556 TGTGAGTATGTTACCTTATGTGG + Intronic
974070972 4:57123342-57123364 TGTGGCTATGTTACATTACCTGG - Intergenic
974160622 4:58133451-58133473 TGTTAATATGTTACCTTATAAGG + Intergenic
974378819 4:61111401-61111423 TGTGATTATGTTATCTTATATGG + Intergenic
974482586 4:62465502-62465524 TTTGAATATGTTATCTTACATGG - Intergenic
974576078 4:63724697-63724719 TGTGAAAATGTTAACTTACATGG - Intergenic
974743989 4:66045917-66045939 TGTGAATATTTAACCTTAGATGG + Intergenic
974985827 4:69025438-69025460 GGAGACTGTGTGACGTTACATGG + Intronic
975077784 4:70234212-70234234 TGTAACTATGTGTACTTACCAGG - Exonic
975196192 4:71527063-71527085 TGTGAATATGTAATGTTACATGG - Intronic
975343622 4:73269238-73269260 GATGAATATGTGACCATACATGG - Intergenic
975419812 4:74149842-74149864 TGTGAATATATCACCTTACATGG + Intronic
975439255 4:74392125-74392147 TATGAATATGTTACCTTCCATGG + Intergenic
975597243 4:76060573-76060595 TGTGAATATGTTATATTACATGG + Intronic
975600383 4:76093634-76093656 TGTGAATATGTTATTTTACATGG - Intronic
975739038 4:77410456-77410478 TGTGAGTATGTGACATAAAATGG + Intronic
975785230 4:77880514-77880536 TGTGAATATATTACCTTACATGG - Intronic
975904815 4:79196687-79196709 TGTGAATATGTTAGGTTACATGG + Intergenic
976069526 4:81225151-81225173 TATGAAGATATGACCTTACATGG - Intergenic
976348009 4:84027478-84027500 TGTGAATACGTTACCTTACATGG - Intergenic
976392605 4:84520893-84520915 TGTGACTATGTTAGGTTCCATGG - Intergenic
976830732 4:89310635-89310657 TATGAATATATTACCTTACATGG - Intergenic
976838850 4:89407644-89407666 TGTGAATATGTTACCTGATATGG + Intergenic
976932567 4:90586885-90586907 TGTGAATATGTTACCATCCATGG + Intronic
976938238 4:90666302-90666324 TGTGACTATGTAACATAACATGG - Intronic
977033482 4:91918581-91918603 TGTGAATATGTTAGGTTACATGG + Intergenic
977080763 4:92524676-92524698 TGTGAATATGTTAGGTTACATGG - Intronic
977175563 4:93815711-93815733 TGTGAATATGTTACTTTACATGG + Intergenic
977246030 4:94632591-94632613 TGTGACTATGTTATGTTATATGG + Intronic
977294416 4:95194755-95194777 TGTGAGTATTTTACCCTACATGG - Intronic
977429614 4:96914525-96914547 TGTGAATATGCCACCTTACATGG - Intergenic
977442001 4:97079601-97079623 TGTGATGATGTTACCTTACATGG - Intergenic
977799962 4:101216231-101216253 TGTTACTATTTTCCCTTACAGGG - Intronic
977895893 4:102364787-102364809 TCCAACTATGTGACCTTCCAGGG + Intronic
978071532 4:104478261-104478283 TGTGACGGTGTGACTTTAGAAGG + Intronic
978280354 4:107004667-107004689 TGTGAATATATTACCTTACGTGG + Intronic
978426144 4:108584583-108584605 TGTGAATATGTTTCATTACATGG - Intergenic
978661016 4:111126420-111126442 TGTGAATATGCTACCCTACATGG + Intergenic
978941135 4:114437109-114437131 TGTGAATATGTTACCTTATGTGG + Intergenic
979155372 4:117381190-117381212 TGTGAATATGATAACTTACATGG - Intergenic
979265498 4:118697746-118697768 TGTAATTATGTGTCCATACAGGG - Intronic
979533759 4:121796487-121796509 TGTGAATATGTTGCCTTATATGG - Intergenic
979576007 4:122293459-122293481 TGTGACTGTGTGACCCTGCCAGG + Intronic
979724598 4:123945410-123945432 TGTGAGTATGTCACATTACATGG + Intergenic
979864855 4:125741397-125741419 TGTGCCTATGTAGCCTTACATGG - Intergenic
980554703 4:134387992-134388014 TGTGAGTGTGTTACTTTACATGG - Intergenic
980726468 4:136767959-136767981 TGTGAACATGTTACCTTACATGG - Intergenic
980809375 4:137854999-137855021 TGGGAATATGTTACTTTACATGG + Intergenic
980878267 4:138684033-138684055 TGTGAATATGTTGCCTTACATGG + Intergenic
981291104 4:143076642-143076664 TGTGAATATGTTGCCTTATATGG + Intergenic
981339792 4:143608161-143608183 TGTGAATGTGTTACTTTACATGG - Intronic
981402419 4:144328985-144329007 TGTGACTATGTTACATTGCATGG + Intergenic
981434185 4:144700439-144700461 TGTGAATGTGTTACCTTATATGG + Intronic
981722458 4:147815398-147815420 TGTGAATATGTTATTTTACATGG + Intronic
981759017 4:148173262-148173284 TGTGAATGTGTCACCTTACATGG + Intronic
982067771 4:151669725-151669747 AGAGACTATGTGACCTTACCCGG - Intergenic
982320582 4:154072895-154072917 TCTGACTGTGTTACCTTACATGG + Intergenic
982650367 4:158080808-158080830 TATGAATATGTTACCTTACCAGG - Intergenic
982802816 4:159725219-159725241 TGTGACTATGTTATTTTACATGG + Intergenic
982831244 4:160063381-160063403 TGTGATTATGTTACCCTACATGG - Intergenic
983113734 4:163785804-163785826 TGTGAATATGTTACCATAAATGG + Intronic
983285873 4:165738391-165738413 TGTGAATATGTTAACTTATATGG + Intergenic
983423444 4:167550834-167550856 TGTGAACATGTTACTTTACATGG + Intergenic
983499569 4:168483584-168483606 TGTGTGCATGTTACCTTACAGGG + Intronic
983745025 4:171187588-171187610 TGTGAATGTGTTAGCTTACATGG - Intergenic
983827498 4:172281821-172281843 TGTGAATATGTTACCTTACATGG - Intronic
984181596 4:176489762-176489784 TGTGAATATGTGGCTTTACATGG - Intergenic
984218903 4:176948981-176949003 TGTGAATATGTCATCTTATATGG + Intergenic
984418682 4:179492248-179492270 TGTAAATATGTTACCTTACATGG + Intergenic
984483663 4:180337748-180337770 TGTGAATAGGTTACATTACATGG - Intergenic
984720463 4:182968454-182968476 TGTGTCTGTGTGACTGTACAAGG + Intergenic
985116142 4:186593455-186593477 TGTGAATATGTCACTATACATGG + Intronic
985434327 4:189914409-189914431 TGTGACCATATTACTTTACATGG + Intergenic
985522766 5:386338-386360 TGTGAATATGTCACTTTACGTGG + Intronic
986203865 5:5604609-5604631 TGTGAATATGCTACCTTACATGG + Intergenic
986244309 5:5991430-5991452 TGTGACTATGTTACCTTATATGG + Intergenic
986293935 5:6422106-6422128 TGTGTGTCTCTGACCTTACATGG - Intergenic
986425899 5:7631262-7631284 TGGGACTATGTTAGGTTACATGG - Intronic
986619845 5:9660647-9660669 TGTGACTATGTCACCATACATGG + Intronic
986768095 5:10946326-10946348 TTTGACTACCTGACCTTATATGG - Intergenic
986849678 5:11796233-11796255 TGTGAACATGTGACATTGCACGG - Intronic
986899526 5:12414283-12414305 TGTGAATATGTCACCTTACAGGG + Intergenic
986962890 5:13237075-13237097 TGTGAATATGTTGCCTTACATGG - Intergenic
987168830 5:15231329-15231351 TGTGTCTATGTCACCTCACTTGG - Intergenic
987385450 5:17324894-17324916 TGTGAATATGTTACTTTATAGGG + Intergenic
987446485 5:18025955-18025977 TGTGACTATGTTACCCTACATGG - Intergenic
987451091 5:18084884-18084906 AGTGACTATGTGACCAAAGATGG + Intergenic
987736293 5:21847704-21847726 TGTGAATATGTTATATTACATGG - Intronic
987964276 5:24851802-24851824 TGTGACTATATTACCTTACATGG - Intergenic
988101923 5:26690635-26690657 TGTGACTATATTACCTTACATGG + Intergenic
988133890 5:27143232-27143254 TGTGAGTATGTTACATTATATGG + Intergenic
988168570 5:27626009-27626031 TGTGAATATGTTATCTTACATGG + Intergenic
988445576 5:31282584-31282606 TGTGACTGTGTTTCCTCACATGG - Intronic
988472353 5:31551494-31551516 TGTGAATATGTTACATTATATGG + Intronic
988600173 5:32632351-32632373 TGTGAATATGTTTCCTCACATGG - Intergenic
988710417 5:33768891-33768913 TGTGAATATGTTAGATTACATGG + Intronic
988729348 5:33954947-33954969 TGTGATTATGTGCTGTTACATGG + Intronic
989136102 5:38156540-38156562 TGTGAATATGTTACCTTACATGG - Intergenic
989445559 5:41524553-41524575 TGTGAAAATGTTACCTTACATGG + Intergenic
989650811 5:43688133-43688155 AATGACTATTTTACCTTACATGG + Intronic
989729650 5:44633425-44633447 TGTGAATATGTCCCCTTACATGG + Intergenic
990047953 5:51457692-51457714 TGTGAATATGTTAGGTTACATGG + Intergenic
990148647 5:52790759-52790781 TGTGAATATGTTATCTTAGATGG - Intronic
990283498 5:54276632-54276654 TGTGAATATGTTATCTTACATGG + Intronic
990329430 5:54711582-54711604 TATGACTATGTCACCTTACCTGG - Intergenic
990516505 5:56535527-56535549 TGTAACTATGTTACCTTATATGG - Intronic
990568878 5:57057485-57057507 TGTGAATATGTTATGTTACATGG + Intergenic
990611247 5:57459038-57459060 TGTGAATATGTTACCTTACCTGG + Intergenic
990620699 5:57555824-57555846 TATGAAAATGTTACCTTACATGG - Intergenic
990623071 5:57581174-57581196 TATGAATATGTTACCTTACAGGG - Intergenic
990639358 5:57764458-57764480 TGTGAATATGTTACCTTAAGTGG - Intergenic
990719742 5:58680856-58680878 TGTGAATGTGTTAACTTACAGGG - Intronic
991040723 5:62172718-62172740 TGTGAATATATTATCTTACATGG - Intergenic
991122135 5:63028931-63028953 TGTAAATATGTTACCTTATATGG + Intergenic
991185335 5:63800110-63800132 TGTAAATATGTTACTTTACATGG - Intergenic
991210259 5:64096285-64096307 TGTGACTGTGTTGTCTTACATGG - Intergenic
991259802 5:64654421-64654443 TGTGAATGTGTTACCTTACATGG - Intergenic
992077722 5:73206574-73206596 TGTGAATAAGTTACCTCACAAGG - Intergenic
992115582 5:73535805-73535827 TGTGACTTTGTTAGGTTACATGG + Intergenic
992324791 5:75650151-75650173 TGTGAATATGTTATGTTACATGG + Intronic
992579760 5:78159698-78159720 TGTGAATATGTTACCTTACGTGG - Intronic
992596844 5:78355942-78355964 TGTAAATATGTTACCTTACATGG - Intergenic
992647841 5:78828780-78828802 TGTGAATATGTTAGGTTACACGG + Intronic
992658443 5:78933756-78933778 TGTGAATATGTTACCTTACATGG + Intronic
992885338 5:81153217-81153239 CGTGTGTATGTTACCTTACATGG + Intronic
993013560 5:82510633-82510655 TGTGAGTATGTGAGGTTGCATGG - Intergenic
993196646 5:84757193-84757215 TGTGAAAATGCCACCTTACATGG + Intergenic
993687594 5:90959131-90959153 TGTGATTCTGTAACTTTACAGGG + Intronic
993731536 5:91428671-91428693 TGTGAATATGTTACCTTACACGG + Intergenic
993832017 5:92771531-92771553 TGTGAATATGTTACCTTACAAGG - Intergenic
993986903 5:94608082-94608104 TGAGACTATGTTATGTTACATGG - Intronic
994048021 5:95330983-95331005 TGTGAATATGTGACCTTACATGG + Intergenic
994447954 5:99901775-99901797 TATGAATATGTTACCTAACAGGG + Intergenic
994675150 5:102811575-102811597 TGTGAATATGTTAACTTACATGG - Intronic
994697702 5:103093167-103093189 TGTGAATATGTAATCTTACATGG + Intronic
994739044 5:103595311-103595333 TGTGAATATGTTACCTTACATGG - Intergenic
994774107 5:104022453-104022475 TGTGAATATGTTACCTTGGATGG - Intergenic
995015546 5:107305058-107305080 TGTGCATATGTTACCTTAAATGG - Intergenic
995136271 5:108683260-108683282 TGTGAATATGTTACTTTACATGG + Intergenic
995281119 5:110336920-110336942 TCTGAATATGATACCTTACATGG + Intronic
995281565 5:110341328-110341350 TGTGACTATGTTATGTTGCATGG + Intronic
995405977 5:111796383-111796405 TGTGAGTATGTTATCTTACATGG - Intronic
995439794 5:112177481-112177503 TGTGAATATATGACCCTAGATGG - Intronic
995856722 5:116600590-116600612 TGTGAATATGTTACCTTACATGG - Intergenic
996081951 5:119267111-119267133 TGTAAATATGTTATCTTACATGG - Intergenic
996140201 5:119897684-119897706 TGTGAATATATGACGTTACGTGG + Intergenic
996368532 5:122728275-122728297 TATGAATATGTTACATTACATGG + Intergenic
996600413 5:125256164-125256186 TGTGAATATATTACCTTCCATGG + Intergenic
996624822 5:125557836-125557858 TGTGAATATGTTATCTTACATGG - Intergenic
996642781 5:125777096-125777118 TGTGAATATGTTACCTTATATGG - Intergenic
996767622 5:127050146-127050168 TGTGATTATGTTACATTATATGG - Intronic
996857851 5:128030213-128030235 TGTGAATATGTTGCCTTATACGG + Intergenic
996929199 5:128866120-128866142 TGTGAATATGCTACCTTACTTGG + Intronic
997113197 5:131097789-131097811 TGTGACCATGTTAAATTACATGG - Intergenic
997120434 5:131167642-131167664 TGTGAATATGTTACTTTACATGG + Intronic
997251392 5:132391440-132391462 TGTGACTATGTAAACTAACTCGG - Intronic
997298699 5:132786251-132786273 TGTGAATATCTTACCTTACATGG + Intronic
997370771 5:133358250-133358272 TATGAGTATGTCCCCTTACATGG - Intronic
997438001 5:133889016-133889038 TATGACTATGATGCCTTACATGG + Intergenic
997902287 5:137777972-137777994 TATGAATATGTTACCTTACATGG - Intergenic
998298160 5:140991910-140991932 TGTGAATATGTTATGTTACATGG - Intronic
998619971 5:143782938-143782960 TGTGAACATGTCCCCTTACATGG + Intergenic
998665775 5:144295648-144295670 TGTGAATATATTACCTTACATGG + Intronic
998878667 5:146625730-146625752 TGGGAATATCTTACCTTACATGG + Intronic
999003966 5:147955570-147955592 TAAGAATATGTTACCTTACATGG + Intergenic
999063125 5:148656214-148656236 TGTGGTTATGTTACCTTGCATGG + Intronic
999446028 5:151640078-151640100 TGTGAATATGTTACCTTATGAGG - Intergenic
999648511 5:153742903-153742925 TGAGAATATGTGACATTACAAGG - Intronic
999684731 5:154091968-154091990 TGTGAATGTGTTACCTTACATGG + Intronic
999687149 5:154113158-154113180 TGTGAATATGTTACCTTATGTGG + Intronic
999718632 5:154381977-154381999 TGTGAATATGTTACCTTATGTGG - Intronic
999877856 5:155828094-155828116 ATTGACTTAGTGACCTTACAAGG + Intergenic
999966545 5:156816352-156816374 TGTGAATATGTTACATCACATGG + Intergenic
1000248246 5:159468266-159468288 TGTTAATATATTACCTTACATGG + Intergenic
1000279228 5:159767838-159767860 TGTGAATATGTTACCTTATATGG - Intergenic
1000287402 5:159838442-159838464 TGTGAATATGTTACCTTACCTGG + Intergenic
1000355077 5:160386554-160386576 TGTGCATATGTTACTTTACATGG - Intergenic
1000428692 5:161124235-161124257 TGTGATGATGTGAACTTACATGG + Intergenic
1000561934 5:162800065-162800087 TGTGACTGTGTTACCTTATATGG - Intergenic
1000816009 5:165922756-165922778 GGTGAATATGTTACATTACATGG + Intergenic
1000921640 5:167145184-167145206 TGCGACTACGTTACCTTACATGG - Intergenic
1001172034 5:169428474-169428496 TGTGAATATGTTATCTCACATGG + Intergenic
1001289209 5:170444514-170444536 TGTGAGTATGTTACCTTGCATGG - Intronic
1001307719 5:170587808-170587830 TGTGAATATGTTACCTTACATGG - Intronic
1001657027 5:173358978-173359000 TGTGACTATGTTACCTTATGTGG - Intergenic
1001658185 5:173370149-173370171 TGTGATTCTGTGACCTTATATGG - Intergenic
1001698132 5:173687825-173687847 AGTGAATATGTAATCTTACATGG - Intergenic
1001765914 5:174246852-174246874 TGTGAATATGATACCTTATATGG + Intergenic
1001805255 5:174579188-174579210 TGTGACTGTGTTATCTTACCTGG + Intergenic
1001907561 5:175485599-175485621 TGTGAATATGTTACCTCACATGG - Intronic
1002583480 5:180225392-180225414 TGTGAATACGTTACGTTACATGG + Intergenic
1002949092 6:1790876-1790898 AGTGACTATGTTACCTCACATGG + Intronic
1003133108 6:3412655-3412677 TGTGAGTATTTTACCTTTCATGG + Intronic
1003268078 6:4584024-4584046 TGGGAATATGTTACCTTACATGG - Intergenic
1003492938 6:6639764-6639786 TGTGAATATGTTACCTTATATGG - Intronic
1003626634 6:7747235-7747257 TGTGAATATGCCACCTTATATGG + Intronic
1003804573 6:9712770-9712792 TGTGATTATGTGAAATTATATGG + Intronic
1003981278 6:11392497-11392519 TGAGACTATGTTACCTTACATGG - Intergenic
1004003528 6:11618524-11618546 TATGACTGTGTTACCTTACATGG - Intergenic
1004136590 6:12973120-12973142 TGTGAATATGGTACCTTACATGG - Intronic
1004274052 6:14220311-14220333 TGTGATTGTGTTACCTGACATGG + Intergenic
1004576461 6:16900417-16900439 TGTGAATATGTTAACTTACATGG + Intergenic
1004876663 6:19962474-19962496 TGTGAATATGTTATCTTACATGG + Intergenic
1004985436 6:21077399-21077421 TGTGAATATGTTACCTTGCATGG + Intronic
1005105298 6:22218351-22218373 TGTAACTATGTTAGCTCACATGG + Intergenic
1005163952 6:22897729-22897751 TGTGACTCTGTTGCCTTACATGG + Intergenic
1005204334 6:23383474-23383496 TGTGACTATGTTACCTTGCTTGG - Intergenic
1005347456 6:24904542-24904564 TGTGACTATGTCGCCCTACATGG - Intronic
1005604825 6:27465957-27465979 TGTGAATTTGTTACCTAACATGG + Intronic
1005615861 6:27572687-27572709 TGTGAATACGTTACCTTACATGG + Intergenic
1005761839 6:28974563-28974585 TGTAAATATGTTAACTTACATGG + Intergenic
1005902602 6:30230534-30230556 TGTGAATATGTTACCGTACATGG + Intergenic
1006252419 6:32798963-32798985 TGTGAATCTGTTACCTTACATGG + Intergenic
1006662297 6:35657635-35657657 TGTAAATATGTTACCTTATAGGG - Intronic
1006757615 6:36430346-36430368 TGTGAATATGTTACCCTACCAGG + Intronic
1007119156 6:39366055-39366077 TGAGACTCTGTGACCTGCCAGGG - Intronic
1007308106 6:40923005-40923027 TGTGACTATATTACATGACATGG - Intergenic
1007404687 6:41627779-41627801 TATGAGTATGTTACCATACAGGG - Intergenic
1007699123 6:43755715-43755737 TGTGACTCAGTGTCCTTACCTGG - Intergenic
1007995430 6:46302896-46302918 ACTGTCTATGTGACCTTAGATGG - Intronic
1008067308 6:47062990-47063012 TGTGAATATATGACCTTATGTGG + Intergenic
1008081104 6:47195321-47195343 TGTAACCATGTGACCTCAAACGG - Intergenic
1008122457 6:47633962-47633984 TGTGAATACATTACCTTACACGG - Intergenic
1008132819 6:47738128-47738150 TGTGACTACGTTACCTTACCTGG - Intergenic
1008133439 6:47744438-47744460 TGTAAATATATTACCTTACATGG - Intergenic
1008348537 6:50459768-50459790 TGTGAATATGTTACCTTATGTGG - Intergenic
1008492884 6:52104220-52104242 TGTGAATAGGTTACCTTACATGG + Intergenic
1008526546 6:52413062-52413084 TGTGTCTATGTGTCTTCACATGG - Intergenic
1008547095 6:52592705-52592727 TGTGACTATGTTACCTTACATGG - Intergenic
1008757537 6:54815601-54815623 TGAGAATATGTTACCTTACATGG - Intergenic
1008818843 6:55606726-55606748 TGTGAATATGTTATTTTACATGG + Intergenic
1008873499 6:56301143-56301165 TGCGAATATGTTGCCTTACATGG + Intronic
1009744444 6:67795661-67795683 TATGAATATGTTACCTTTCATGG - Intergenic
1009761325 6:68010521-68010543 TGTGAACATGTTACCTTACATGG + Intergenic
1010010611 6:71043865-71043887 TGTGATTATGTTACCTTAACTGG + Intergenic
1010302076 6:74273007-74273029 TGTGAATATGTTACTTTATATGG - Intergenic
1010311520 6:74391455-74391477 TGTGAGTATGCTACCTTATATGG - Intergenic
1010572722 6:77497088-77497110 TGTGAAGATGTCACCTTACATGG - Intergenic
1010812661 6:80317650-80317672 TACGAATATGTTACCTTACATGG - Intronic
1011010788 6:82701756-82701778 TGTGAATATGTTACCTTACCTGG - Intergenic
1011476692 6:87755558-87755580 TGTGAACATGTTACCTTACATGG - Intergenic
1011753348 6:90475139-90475161 TCTGAATATGTTAGCTTACATGG - Intergenic
1011997785 6:93615251-93615273 TGTGTATATGTTACCTTATATGG + Intergenic
1012084375 6:94805353-94805375 AGTGAATATGTTGCCTTACATGG - Intergenic
1012173419 6:96048255-96048277 TGTGAATATGTTACCTTATATGG - Intronic
1012193863 6:96315473-96315495 TGTGAATATGTTACTTTACATGG + Intergenic
1012471460 6:99576880-99576902 TGTGAATATGTTATGTTACATGG - Intergenic
1012798151 6:103789992-103790014 TGTGAATATGGTACTTTACACGG + Intergenic
1012814854 6:104010432-104010454 CGTGCATATGTGACCCTACATGG + Intergenic
1012943532 6:105442206-105442228 TGTGAATCTGTTACCTTACATGG + Intergenic
1013055363 6:106577630-106577652 TGTGAATATGGCACCTTACATGG + Intronic
1013776742 6:113687313-113687335 TGTGAATATGTTACCTTACCTGG - Intergenic
1013847671 6:114473661-114473683 TGTGCATATGTTACTTTACATGG + Intergenic
1014402983 6:121014022-121014044 TGTGAATATGTTACTTTACATGG - Intergenic
1014451964 6:121592202-121592224 TGTGACTATGTTGCCTTACATGG + Intergenic
1014617268 6:123618527-123618549 TGTAAATATGTTACCTTACCTGG - Intronic
1015379321 6:132548745-132548767 TGTGAATGTGTTATCTTACATGG + Intergenic
1015700321 6:136028837-136028859 TGTGAATATGTTAGGTTACATGG - Intronic
1015896379 6:138020883-138020905 TGTGATTATATTACATTACATGG - Intergenic
1015971717 6:138749144-138749166 TGTGCATATGTTAGCTTACATGG - Intergenic
1016248278 6:142014081-142014103 TGTGACTATGACACCTTCCGAGG + Intergenic
1016308021 6:142703533-142703555 TGTGAATATGTGACCTTACCTGG + Intergenic
1016393472 6:143598129-143598151 TGTGAATATGTTACTTTACATGG + Intronic
1016879938 6:148901090-148901112 TGTGAATATGTTACCCTACATGG - Intronic
1016887414 6:148970965-148970987 TGTGAATATGTTACCTTGTATGG - Intronic
1017430921 6:154369905-154369927 TGTGACGATGTTATTTTACATGG - Intronic
1017533535 6:155322003-155322025 TGTGAATATGTGAGGTTACATGG + Intergenic
1017818521 6:158032147-158032169 TGTGACTGTGCGACCTCAGACGG + Intronic
1018529751 6:164750258-164750280 TGTGAATGTGTGACCTCACCTGG + Intergenic
1018626245 6:165781548-165781570 TATGACTAGGTTACCTCACATGG + Intronic
1018772447 6:166983224-166983246 TGTGCCTGTGTCACCTGACATGG - Intergenic
1019844136 7:3480042-3480064 TGTGAATATGTCCCTTTACATGG + Intronic
1020470520 7:8529288-8529310 TATGACTACGTCACTTTACATGG - Intronic
1020686108 7:11297590-11297612 TGTGAATATGTAATGTTACATGG + Intergenic
1021084721 7:16408685-16408707 TGTGACTATGTTACCTTAAATGG + Intronic
1021113809 7:16725759-16725781 TGTGAATATGTTACTTTACATGG - Intergenic
1021301752 7:18981797-18981819 TGTGAATATGTTACCTTACATGG - Intronic
1021402270 7:20222834-20222856 TGTAAATATGTTACCTGACATGG - Intergenic
1021448838 7:20762225-20762247 TGTGGACATGTGACGTTACATGG - Intronic
1022356300 7:29617760-29617782 CGTGAAGATGTTACCTTACATGG - Intergenic
1022514702 7:30968195-30968217 TGTGAATATGTTACCTTAAACGG - Intronic
1022874185 7:34511826-34511848 TCTGAATATGTTACCTTACATGG + Intergenic
1023019778 7:36001074-36001096 TGTGAATATGCTACTTTACATGG + Intergenic
1023451121 7:40286479-40286501 TATGAATATGCCACCTTACATGG - Intronic
1023451344 7:40289110-40289132 TATGAATATGCCACCTTACATGG + Intronic
1023546681 7:41325109-41325131 TGTGAATATGTTACCTTATCTGG - Intergenic
1023754227 7:43401104-43401126 TATGAATATGTTACCTTACATGG - Intronic
1024410184 7:49031483-49031505 TTTCAGAATGTGACCTTACATGG + Intergenic
1024786816 7:52917305-52917327 TTTGTAAATGTGACCTTACATGG + Intergenic
1024868257 7:53929905-53929927 TGTGAATATGTTGCCTTCCATGG + Intergenic
1025251193 7:57352683-57352705 TGTGAATACGTGACCTTACATGG - Intergenic
1025625701 7:63219369-63219391 TGTGAATATGTTATCTTACATGG - Intergenic
1025656419 7:63523804-63523826 TGTGAATATGTTATCTTACATGG + Intergenic
1025656467 7:63524284-63524306 TGTGGATATGTTATCTTACATGG - Intergenic
1025971472 7:66330153-66330175 TGTGAATATGTTACCTTATCTGG + Intronic
1026120387 7:67531737-67531759 TATGATTATGTGACTTTTCATGG - Intergenic
1026189575 7:68112598-68112620 TGTGAATATGTTATCTTACATGG - Intergenic
1026839679 7:73663009-73663031 TGTAAATATGTTACCTTACATGG - Intergenic
1027483356 7:78727457-78727479 TGTGACTATCAGAACTTTCAAGG + Intronic
1027515580 7:79137847-79137869 TGTGAATATGTTACCATACGTGG + Intronic
1027569168 7:79841500-79841522 TTTGAGTATGTAACTTTACATGG + Intergenic
1027593309 7:80141116-80141138 TGTGAATATGTCACCTCACAGGG - Intronic
1027848959 7:83424652-83424674 TGTGAATATGTTACCTTACATGG + Intronic
1027920004 7:84381000-84381022 TGTAAATATGTTGCCTTACATGG - Intronic
1028478538 7:91278230-91278252 TATGAATACGTTACCTTACATGG - Intergenic
1029025921 7:97417019-97417041 TGTGAATATGTTGCATTACATGG - Intergenic
1029031716 7:97475188-97475210 TCTGAATATGTTACCTTACACGG + Intergenic
1029574309 7:101392913-101392935 TGTGAATATGCTACTTTACATGG + Intronic
1029946487 7:104538777-104538799 TGTGAATATGTTAGCTTACGTGG + Intronic
1030161602 7:106514965-106514987 TTGGACTATGTGATCTTACAAGG + Intergenic
1030164169 7:106536244-106536266 TGTGAATATGTTATCTCACATGG + Intergenic
1030168125 7:106574812-106574834 TGTGAATATGTTACCTTATACGG + Intergenic
1030306023 7:108019469-108019491 TGTGAATATATTACGTTACATGG - Intergenic
1030323911 7:108199789-108199811 TATGAATATGTCACCTTACATGG - Intronic
1030354710 7:108529314-108529336 TGTGAATATGCTACTTTACATGG + Intronic
1030413171 7:109207719-109207741 TGTGAATGTGTTATCTTACATGG + Intergenic
1030426981 7:109390453-109390475 TATGAATATGTTACCTTACACGG - Intergenic
1030513275 7:110511475-110511497 TGTGACTGTATTATCTTACATGG - Intergenic
1030548361 7:110927379-110927401 GGTGAATATGTTACATTACATGG + Intronic
1030935424 7:115580214-115580236 TGTTAATATGTTACCTTAAATGG + Intergenic
1031132042 7:117843874-117843896 TGTGAATATGTTCCCTTACATGG + Intronic
1031240788 7:119236760-119236782 TGTAAATATTTTACCTTACATGG - Intergenic
1031706841 7:124991422-124991444 TGTAAATATGTTACCTGACATGG + Intergenic
1032538301 7:132683054-132683076 TGTGACTATGTCACTTTACATGG + Intronic
1032876901 7:136047420-136047442 GGTGAATAGGTTACCTTACATGG - Intergenic
1033414261 7:141148306-141148328 TGTGAGTATGTTACCTTGCATGG - Intronic
1033436789 7:141340047-141340069 TGTGAACATGTTATCTTACATGG + Intronic
1033626128 7:143111323-143111345 TGTGAATCTGTTACCTTACCTGG - Intergenic
1033814750 7:145058050-145058072 TGTGAATATTTTACCTAACATGG - Intergenic
1033982099 7:147178093-147178115 TGTGAATGTGTTGCCTTACATGG + Intronic
1034053420 7:148007944-148007966 TGTGAATATGCGACCTTACATGG + Intronic
1034125867 7:148671118-148671140 TGGGAATATGTTACCTTACATGG + Intergenic
1034356752 7:150456610-150456632 TGTGGCTGTGTTACTTTACATGG - Intronic
1034695634 7:153050855-153050877 TATGAATGTGTAACCTTACATGG + Intergenic
1034999906 7:155604268-155604290 TGTGAATATGTCACCTTACATGG + Intergenic
1035139595 7:156745068-156745090 TGTGAATATGTTACCTTACATGG - Intronic
1035253882 7:157613963-157613985 TGTGACTCTGTGAGCTCACAGGG + Intronic
1036085282 8:5607004-5607026 TGTGGATATGTGACATTAAATGG - Intergenic
1036086984 8:5623264-5623286 TGTGTCTATATTACCTTACATGG + Intergenic
1036439027 8:8763700-8763722 TGTGACAGTGTGTCCATACATGG - Intergenic
1037177864 8:15967862-15967884 TGTGAGTATATTACCTTACTTGG - Intergenic
1037209589 8:16370548-16370570 TATGAATATGTTACTTTACATGG + Intronic
1037218797 8:16490682-16490704 TGTGAATATGTTAGGTTACACGG + Intronic
1038853657 8:31306944-31306966 TATGAATATGTTAACTTACATGG + Intergenic
1039016805 8:33158437-33158459 TGTGAATATGTTACCTTACATGG - Intergenic
1040521578 8:48180785-48180807 CGTGAATATGTGACGTCACATGG - Intergenic
1040635079 8:49263831-49263853 TGTGATTATGTTATTTTACATGG + Intergenic
1040805643 8:51393613-51393635 TGTGAATATGTCACCTTACGTGG + Intronic
1040849750 8:51887192-51887214 TGCGAATATGTGACCTTATATGG - Intronic
1040991443 8:53354439-53354461 TGAGAATGTGTGACCTTACATGG - Intergenic
1041342030 8:56856296-56856318 TCTGAATGTGTTACCTTACATGG - Intergenic
1041395977 8:57391655-57391677 TGTGAATATGTTACTTTACACGG + Intergenic
1041501030 8:58538939-58538961 TGAGAATATGTTAACTTACATGG + Intergenic
1041619887 8:59954581-59954603 TGTGACTATGTCACCTTAAATGG + Intergenic
1042113249 8:65404111-65404133 TGTGTCTCTGTGTCTTTACATGG - Intergenic
1042162049 8:65906195-65906217 TGTGAGTGTGTTACCTTACCTGG + Intergenic
1042236875 8:66621994-66622016 TGTGAATATATTACCTTCCATGG - Intergenic
1042525588 8:69761540-69761562 TATGAATATGTTATCTTACATGG - Intronic
1042793378 8:72633461-72633483 TCTGAATATGTGAAGTTACATGG - Intronic
1042835523 8:73076301-73076323 TGTGAATATGTTATATTACATGG + Intronic
1043169997 8:76953933-76953955 TGTGAATATGTTATTTTACAAGG + Intergenic
1043348370 8:79327228-79327250 TGTGAATATATTACCTTTCAAGG + Intergenic
1043413789 8:80028514-80028536 TGTGAATATGTTACCTTCCGTGG + Intronic
1043447766 8:80335919-80335941 TGCGAATATGTTACATTACATGG - Intergenic
1043470039 8:80553194-80553216 TGGAACTATGTGAACTGACATGG + Intergenic
1043534822 8:81191086-81191108 CGTGAATATGTTACCTTAAATGG + Intergenic
1043582083 8:81725733-81725755 TGTGACTCTGTCACCTTACATGG - Intronic
1043669596 8:82865495-82865517 TGTGAATATGTTACTTTATATGG - Intergenic
1043817636 8:84822303-84822325 TGTGACTTGGTGGCTTTACATGG - Intronic
1043860109 8:85306504-85306526 TGTGACTATATTACCTAACATGG + Intergenic
1043880363 8:85535583-85535605 TGTGAGAATGTGACCTTATTTGG - Intergenic
1043986988 8:86705451-86705473 TGTGAATATGTTACATTACATGG + Intronic
1043993787 8:86788160-86788182 TGTGAATATGTTATCTTAAATGG - Intergenic
1044270660 8:90239416-90239438 TGTGAATATGTTACATTACATGG + Intergenic
1044475540 8:92621046-92621068 TGTGAATATATTACCTTACTAGG + Intergenic
1044753392 8:95437506-95437528 TGTGAATATCTTACATTACATGG + Intergenic
1044854994 8:96466761-96466783 TATGAATATGTTACCTTACATGG + Intergenic
1045078979 8:98603886-98603908 TGTGAATATGTTACTTTACATGG + Intronic
1045291637 8:100838247-100838269 TGTGAATATATTACCTTACATGG + Intergenic
1045661371 8:104441404-104441426 TGTGAATATGTTACTTTACATGG + Intronic
1045872652 8:106943865-106943887 TGTGAATCTGTTACATTACATGG - Intergenic
1045912859 8:107430546-107430568 TGTGACTATGTTACCTTACATGG + Intronic
1046019588 8:108648476-108648498 TGTGAATATGTTATTTTACATGG + Intronic
1046138216 8:110059181-110059203 TATGACTATGTTACCTTATATGG - Intergenic
1046248589 8:111600312-111600334 TGTGAATATGTTATTTTACATGG - Intergenic
1046283238 8:112061063-112061085 TGTGAAAATGTTACCTTATATGG - Intergenic
1046610954 8:116425005-116425027 TGGGAATATGTTACCTTACATGG - Intergenic
1046895846 8:119472165-119472187 TGTGAATATGTTACCTTACATGG + Intergenic
1046980758 8:120334002-120334024 TGTGAATATGTTACCTTATGTGG - Intronic
1047023740 8:120805272-120805294 TGTGAATATGTTAACTTACGTGG + Intronic
1047349089 8:124056145-124056167 TGTAAGTATGTTACCTTAAATGG - Intronic
1047436182 8:124837144-124837166 TGTGAATATGTGACCTTAGATGG - Intergenic
1047613359 8:126542484-126542506 TGTGAATATGTCACCTTTCATGG - Intergenic
1047655264 8:126970460-126970482 TGTGATTATGTCTCCTTGCATGG - Intergenic
1047688719 8:127329107-127329129 TGTGAATGTGTCAGCTTACATGG + Intergenic
1048162017 8:132030057-132030079 AGTGGCTATGTGAGCATACAAGG - Intronic
1048257223 8:132914181-132914203 TGTGAATATGTTAGGTTACATGG - Intronic
1048284365 8:133130336-133130358 TGTGACTGTGTTACCTTCCATGG + Intronic
1048322331 8:133409793-133409815 TGTAAATATGTTACTTTACATGG + Intergenic
1048323505 8:133420956-133420978 TGTGAATATGTTACTTTACATGG + Intergenic
1048356343 8:133657021-133657043 TGTGACTATGTGGCCTTCCATGG - Intergenic
1048450216 8:134526964-134526986 TGTGAACATGTTACCTTACATGG + Intronic
1048509925 8:135053063-135053085 TGTGAATATATGATCTTACATGG + Intergenic
1048838646 8:138545645-138545667 TGTGACTATGTTCCCTTACTTGG - Intergenic
1049117578 8:140702857-140702879 TGTGAATATGTTTCCTTACGTGG + Intronic
1049149612 8:141026214-141026236 TGTGAATATGTGTCCTTACGTGG - Intergenic
1050055214 9:1645627-1645649 TGTGAATATGTTACTTTACATGG + Intergenic
1050127877 9:2378271-2378293 TGTGAATATGTTACCTTACGTGG + Intergenic
1050344172 9:4669809-4669831 TGTGCATATGTTACCTTACATGG - Intergenic
1050429831 9:5551127-5551149 TGTGAATATGTCACCTTACATGG - Intronic
1050635141 9:7604484-7604506 TGTGAATATGCTGCCTTACATGG + Intergenic
1050721132 9:8591232-8591254 GATGACTATGTTACCCTACAAGG - Intronic
1050821142 9:9881717-9881739 TCTCACTCTGTGACCTTCCAGGG + Intronic
1050915485 9:11125163-11125185 TGTGAATATATTACCCTACATGG - Intergenic
1051086901 9:13360268-13360290 TGTGAATATGTTGCCTTATATGG + Intergenic
1051301711 9:15658506-15658528 TGTGAATATGTTACCTTACATGG + Intronic
1051339884 9:16101492-16101514 TGTGATTATGTTACACTACATGG + Intergenic
1051550259 9:18319806-18319828 TGTGAATATGTTACCTTACATGG + Intergenic
1052402210 9:28014733-28014755 TGTGACTGTCTGACCTTGAAGGG + Intronic
1052467756 9:28851525-28851547 TGTGAATATGTTACTTTACATGG - Intergenic
1052509413 9:29396340-29396362 TGTGACTATGTTAGCTTATATGG - Intergenic
1052524595 9:29598347-29598369 TGTGAATATGCTACCTTATATGG + Intergenic
1052764541 9:32627370-32627392 TGTGAATATGTTGCTTTACATGG - Intergenic
1053214771 9:36261226-36261248 TGTGACCATGTTTCCTTACTTGG - Intronic
1053294970 9:36906195-36906217 TGTGACTATGTGACCTTACATGG + Intronic
1053366647 9:37527291-37527313 TGTGCATATGTTGCCTTACAAGG - Intronic
1053445347 9:38148927-38148949 TGTGAATATGTTACTTTACATGG + Intergenic
1053450983 9:38193803-38193825 TGTGAATATGTTACATTCCACGG + Intergenic
1053723411 9:40972568-40972590 TGTGACCATATTACTTTACATGG + Intergenic
1054342552 9:63879428-63879450 TGTGACCATATTACTTTACATGG - Intergenic
1054742593 9:68823218-68823240 TGTGAATATGTCACCTTCTAAGG - Intronic
1054754250 9:68941236-68941258 TGTGAATATGTTACCTTATATGG + Intronic
1054862427 9:69967576-69967598 TATGAATATGTTACCTTATATGG - Intergenic
1054960327 9:70961012-70961034 TGGGAATATGTTATCTTACATGG + Intronic
1055567986 9:77588183-77588205 TGTGAATATGTTACTTGACATGG - Intronic
1055792495 9:79937688-79937710 TGTGAATATGTTACTTTATATGG + Intergenic
1055817150 9:80220143-80220165 TGTGAATATTTTACCTTATATGG - Intergenic
1055893150 9:81144817-81144839 TGTGACTATGCTATCTTACATGG + Intergenic
1056028287 9:82524259-82524281 TGTGAATATGTTATGTTACATGG - Intergenic
1056036261 9:82609236-82609258 TGTGAATATGTTATCTTACATGG - Intergenic
1056053599 9:82796996-82797018 TGTGACTCTGTTATCTTATATGG + Intergenic
1056328499 9:85502387-85502409 TGTGGCTATGTCATCTTGCATGG + Intergenic
1056389886 9:86131323-86131345 TGTGAATATGTTATTTTACATGG - Intergenic
1056488976 9:87086307-87086329 TGTGAATGTGTCACCTTACATGG + Intergenic
1056896987 9:90560121-90560143 TGTGAATATGTGACCTTGCATGG - Intergenic
1057041379 9:91850336-91850358 TGTGACCATGTGGCCTTACATGG + Intronic
1057081969 9:92179963-92179985 TGTGAATGTGTTATCTTACATGG + Intergenic
1057468241 9:95335618-95335640 GGTGAATTTGTTACCTTACATGG - Intergenic
1057865382 9:98676017-98676039 TGTGGATATGTTACCTTGCATGG + Intronic
1058090926 9:100804553-100804575 TGTGAATATGTTACTTTTCATGG + Intergenic
1058197170 9:101991980-101992002 TGTGATAATCTTACCTTACATGG + Intergenic
1058255041 9:102751305-102751327 TGTGAATATGTTACTTTACATGG + Intergenic
1058308683 9:103473771-103473793 TGTGAATATGTTACCTTTCTTGG - Intergenic
1058335959 9:103829165-103829187 TGTGAGTATGTTACTTTACATGG - Intergenic
1058352613 9:104043842-104043864 TGTGAATATGTTACTTTATATGG + Intergenic
1058442009 9:105018083-105018105 TGCAAATATGTTACCTTACATGG - Intergenic
1058577110 9:106415579-106415601 TGTGAATATGTTACCTTACATGG + Intergenic
1059462608 9:114443633-114443655 TGTGACTATGTTAGGTTATATGG - Intronic
1059589680 9:115645322-115645344 TGTGAATATGTTACATTACGTGG + Intergenic
1059977380 9:119731889-119731911 TGTGAATATGTTACCTTGAATGG + Intergenic
1060012231 9:120053865-120053887 TGTGAATATGTTACATTACATGG - Intergenic
1060074053 9:120576208-120576230 TGTGCATATGGGACCTTATAAGG - Intronic
1060112730 9:120918220-120918242 TGTGAGTATGTGACCTCACATGG - Intronic
1060118776 9:120968115-120968137 TGTGAATATGTTACCTTATGTGG + Intronic
1060204022 9:121671449-121671471 TGTGAATATGTTGCCTTACATGG - Intronic
1060273950 9:122168098-122168120 TGTGAATATGCTACTTTACATGG - Intronic
1061646481 9:132006544-132006566 TGTGAGCATGTGTCCTTGCAGGG - Intronic
1062045127 9:134421504-134421526 TGGGACTATGCGACCTTGCATGG - Intronic
1062188942 9:135237017-135237039 TGTGACTATGTCACCTTGCATGG - Intergenic
1062307050 9:135913558-135913580 TGTGAATGTGTGACCTTACCTGG + Intergenic
1203451742 Un_GL000219v1:123413-123435 TGTGACCATATTACTTTACATGG - Intergenic
1203375571 Un_KI270442v1:373065-373087 TGAAACTATGTGACATTCCAAGG - Intergenic
1185650937 X:1647729-1647751 TGTGAATATGTGACCTCACCTGG - Intergenic
1185743813 X:2555468-2555490 TGTGAATATGTGACCTTATATGG - Intergenic
1185762164 X:2696909-2696931 TATGACTAGGAGACCGTACAAGG - Intronic
1185808931 X:3087166-3087188 TGTGAACATGTGATATTACATGG - Intronic
1185985161 X:4824561-4824583 TGGGAATATGTTACCTTTCATGG - Intergenic
1185993645 X:4919458-4919480 TCTGAATGTGTCACCTTACATGG + Intergenic
1186002316 X:5026550-5026572 TGTGACTATGTTACCTAACATGG + Intergenic
1186103622 X:6182559-6182581 TGTGAATATGTGACCTTTCACGG + Intronic
1186125889 X:6413415-6413437 TGTAAATATGTGACCTTGCATGG + Intergenic
1186304170 X:8236307-8236329 TGTGACTATATTAGCTTACATGG - Intergenic
1186365776 X:8891873-8891895 TATGAACTTGTGACCTTACATGG + Intergenic
1186379256 X:9039851-9039873 TGTGACTATATTAGTTTACATGG - Intronic
1186420970 X:9426105-9426127 TGTGAATATGTTACTTTACATGG + Intergenic
1186461561 X:9752458-9752480 TGTGAATATGTTCCCTTATATGG + Intronic
1186526058 X:10249403-10249425 TGTGAATATGTTACCCTACATGG + Intergenic
1186532629 X:10312574-10312596 TGTGACTATGTTACCTGACATGG - Intergenic
1186582981 X:10840773-10840795 TGTGAATATGTAATGTTACATGG + Intergenic
1186584781 X:10861212-10861234 TATGATTATGTTACTTTACATGG - Intergenic
1186594026 X:10961100-10961122 TGTGAATATGTTACCTTACATGG + Intergenic
1186622863 X:11259915-11259937 TGTGAGTATGTTATTTTACATGG + Intronic
1186624480 X:11278200-11278222 TGGGAATGTGTTACCTTACATGG + Intronic
1186659660 X:11656799-11656821 TGTGAATATGCCACTTTACATGG - Intronic
1186672645 X:11782706-11782728 TGTGAATATGTTACCTCACATGG - Intergenic
1186965827 X:14785276-14785298 TGTGCATATGTTACCTTACCCGG - Intergenic
1187077364 X:15948425-15948447 TGTGAATATGTGACCTTACATGG - Intergenic
1187093054 X:16117706-16117728 TGTGAATATGTTCCCTTATATGG + Intergenic
1187135483 X:16543498-16543520 CATGACTATGTGACTTTACATGG - Intergenic
1187171808 X:16859482-16859504 TATGACTTTGTTACTTTACAAGG - Intronic
1187209424 X:17214540-17214562 TGTGAATATGTTACTTTATATGG - Intergenic
1187506230 X:19880671-19880693 TGTGACTATGTTCCCTTCCATGG + Intronic
1187971033 X:24658765-24658787 TGTGAATATGTTACCTTATATGG - Intronic
1188316756 X:28683987-28684009 TGTGGACATGTAACCTTACATGG - Intronic
1188325727 X:28798557-28798579 TATGACTATGTCATATTACATGG - Intronic
1188327540 X:28823890-28823912 TGTGAACATGTTACCTTACATGG - Intronic
1188355244 X:29182756-29182778 TGTGAATATGTTAGCATACATGG + Intronic
1188369006 X:29346255-29346277 TGTGAGTGTTTTACCTTACATGG - Intronic
1188480240 X:30629997-30630019 TGTGAATATGTATCCTTCCATGG + Intergenic
1188584166 X:31752186-31752208 TGTGAATATGTTACCTTACATGG - Intronic
1189062231 X:37766822-37766844 TGTGGATATGTTACCTTATACGG - Intronic
1189085816 X:38022706-38022728 TGTGAATATGTTACCTTAGATGG - Intronic
1189161523 X:38813991-38814013 TGTGAGTATGTTACCTTGCGTGG + Intergenic
1189203326 X:39216539-39216561 TGTGAATATGTTATCTTACATGG + Intergenic
1189220766 X:39369708-39369730 TGTGAATACGTTACATTACAGGG + Intergenic
1189264277 X:39701796-39701818 TGTGAATATGTTACCTTATATGG + Intergenic
1189532693 X:41902580-41902602 TGTGAGTATGTTACTTTACATGG - Intronic
1189561182 X:42192913-42192935 TGTGAATATGTTACCTTACAAGG + Intergenic
1189595424 X:42559885-42559907 TATGAATATGTTACCTTACATGG - Intergenic
1189682382 X:43529892-43529914 TGTGAATATATTACCTTAGATGG + Intergenic
1189705184 X:43752448-43752470 AATGAATATGTTACCTTACATGG - Intergenic
1189979014 X:46490363-46490385 TGTGATTATGTTACTTTAAATGG + Intronic
1190315981 X:49151346-49151368 TGTGAATATGTTACCTTATATGG - Intergenic
1190357065 X:49616054-49616076 TGTGAATATATTATCTTACACGG - Intergenic
1190381327 X:49842034-49842056 TATGAATATGTTACTTTACATGG - Intergenic
1190577230 X:51852346-51852368 TGTGAAGATGTTACCTTACATGG - Intronic
1190891147 X:54569037-54569059 TTTGAATATGTTACTTTACATGG - Intergenic
1191677660 X:63808590-63808612 TGTGAATATGTTAGGTTACATGG + Intergenic
1192388361 X:70697270-70697292 TGTGAGTATGTTACCTTACATGG - Intronic
1192495571 X:71614797-71614819 TGTGACTATGTTACCTTAGATGG - Intergenic
1192846885 X:74915520-74915542 TGTGAATATGTTAGGTTACATGG + Intronic
1193090894 X:77493020-77493042 TGTGAATATGTTACCTTATATGG - Intergenic
1193331955 X:80244812-80244834 TGTGAATATGTTACTTTACATGG + Intergenic
1194079810 X:89446590-89446612 TGTGAATATGTCACCTAGCATGG + Intergenic
1194391700 X:93325966-93325988 TGTGAATATATTACCTTACATGG - Intergenic
1194597678 X:95878894-95878916 TGTGAATATGTTACTATACATGG + Intergenic
1194754906 X:97727429-97727451 TGTGAATATATTACCTTACATGG + Intergenic
1194812160 X:98399946-98399968 TGTGACTATGTTACATTACATGG + Intergenic
1195026488 X:100882802-100882824 TGTGAATACGTTACCTTGCATGG + Intergenic
1195208649 X:102628774-102628796 TGCGAATATGTTACCTTACATGG - Intergenic
1195208756 X:102630086-102630108 TGTCAATATGTTACCTTACATGG - Intergenic
1195288183 X:103405620-103405642 AGTGAATATGTTACATTACATGG - Intergenic
1195849360 X:109266377-109266399 TGTGAATATGTTACTTTATATGG - Intergenic
1196083800 X:111661885-111661907 TATGAATATGTTACCTGACATGG + Intergenic
1196138644 X:112236796-112236818 TGTGAATATGTTACCTTACATGG + Intergenic
1196292265 X:113956877-113956899 TGTGAATATGTTACCTTACCTGG + Intergenic
1196685906 X:118510096-118510118 TGTGAATATGTTACTTTACATGG - Intronic
1196714392 X:118797590-118797612 TGTGGCTATGTAACTTTACATGG + Intergenic
1196770744 X:119291031-119291053 TGTGAATATGTTACCTTACATGG + Intergenic
1196804076 X:119569334-119569356 GGTGAATATGTTACCTTACATGG - Intergenic
1197134755 X:123048220-123048242 TGTGACTATATTACTTCACATGG + Intergenic
1197201365 X:123751650-123751672 TGTGAATATGTTAGGTTACATGG + Intergenic
1197541011 X:127760886-127760908 TGTGAATATGTTGCCTTGCATGG - Intergenic
1197562120 X:128036514-128036536 TGTGAGTATGTTACCTTGAATGG - Intergenic
1197805003 X:130390190-130390212 TGTGAATATGTGACTTCACATGG - Intergenic
1197805293 X:130393028-130393050 TATGAATATATGACCTTACTTGG + Intergenic
1197895754 X:131312609-131312631 TGTGAATGTGTTACCTTACCTGG - Intronic
1198197333 X:134377049-134377071 TGTAACTAGGTGCCCTTTCAAGG - Intronic
1198495039 X:137183819-137183841 TGTGAATATGTTAGGTTACATGG - Intergenic
1198587340 X:138137238-138137260 TGTGACTATGTTAGGTTACGTGG - Intergenic
1198712017 X:139514708-139514730 TATGAATATGTTACCTTATATGG + Intergenic
1199021314 X:142881628-142881650 TGTGAATATATGCCCTTCCATGG + Intergenic
1199336576 X:146625104-146625126 TGTGAATACGTTACATTACATGG - Intergenic
1199480048 X:148288491-148288513 TGTGTCTCTGTTACCTTATATGG - Intergenic
1199480173 X:148289665-148289687 TGTCAATATGTTACCTTACATGG - Intergenic
1199666048 X:150097376-150097398 TGTGAATATGTGACCTTACAAGG - Intergenic
1199694802 X:150336334-150336356 TGGGAGTATGTTACCTTCCAAGG - Intergenic
1199754529 X:150851925-150851947 TGTGAATATGTGACGTTACATGG - Intronic
1199765422 X:150937765-150937787 TGTGAGTGTGTTACCTTAAATGG - Intergenic
1199867534 X:151866292-151866314 TGTGAATATGTTACCTTCCATGG - Intergenic
1200086421 X:153609499-153609521 CGTGAGTATGTTACATTACATGG - Intergenic
1200432429 Y:3101879-3101901 TGTGAATATGTCACCTAGCATGG + Intergenic
1201225100 Y:11810975-11810997 TGTGAGTATGTTATCTTACATGG - Intergenic
1201683015 Y:16669924-16669946 TATGGATATGTGACTTTACATGG + Intergenic
1201929837 Y:19330646-19330668 TGTAAATATGTTACCTTGCAGGG + Intergenic
1202047757 Y:20751568-20751590 TGTGACTATGTTTCCTTATATGG + Intergenic