ID: 948193935

View in Genome Browser
Species Human (GRCh38)
Location 2:236081001-236081023
Sequence ATTAGGACGTTGACATCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2307
Summary {0: 2, 1: 82, 2: 278, 3: 686, 4: 1259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948193925_948193935 30 Left 948193925 2:236080948-236080970 CCGTATCTGCAGTTAGGTTGCCA 0: 1
1: 0
2: 0
3: 6
4: 126
Right 948193935 2:236081001-236081023 ATTAGGACGTTGACATCTTTGGG 0: 2
1: 82
2: 278
3: 686
4: 1259
948193927_948193935 10 Left 948193927 2:236080968-236080990 CCATGTAAGGTCACATAGTCACA 0: 2
1: 20
2: 169
3: 509
4: 931
Right 948193935 2:236081001-236081023 ATTAGGACGTTGACATCTTTGGG 0: 2
1: 82
2: 278
3: 686
4: 1259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948193935 Original CRISPR ATTAGGACGTTGACATCTTT GGG Intronic
Too many off-targets to display for this crispr