ID: 948197097

View in Genome Browser
Species Human (GRCh38)
Location 2:236104250-236104272
Sequence CTGCCCATGTCAGCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948197097_948197099 -7 Left 948197097 2:236104250-236104272 CCAGGCCAGGCTGACATGGGCAG 0: 1
1: 0
2: 3
3: 30
4: 336
Right 948197099 2:236104266-236104288 TGGGCAGTTCCAGTTTCCCAAGG 0: 1
1: 0
2: 3
3: 23
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948197097 Original CRISPR CTGCCCATGTCAGCCTGGCC TGG (reversed) Intronic
900607678 1:3531116-3531138 CTACCCATGTCACCTGGGCCAGG - Intronic
901035147 1:6331922-6331944 CTGCCCATGTGAGACTGGGGAGG - Intronic
901063901 1:6485802-6485824 CTTCCCACCTCTGCCTGGCCCGG + Intronic
901540099 1:9910108-9910130 CTGCCCCTGCCGGCCCGGCCGGG - Exonic
901857701 1:12054775-12054797 CTGCCCTTCTCAGCCTTGCTTGG + Intergenic
902451919 1:16501617-16501639 CTGCTCAGCTCAGCCTGACCGGG + Intergenic
902501036 1:16912047-16912069 CTGCTCAGCTCAGCCTGACCGGG - Intronic
903483422 1:23671162-23671184 GTGCCCATCTCAGGCTGGCATGG + Intergenic
904612057 1:31731248-31731270 GTGCCCATGGCAGCCTCACCAGG - Exonic
905656601 1:39690004-39690026 CTGTCCATGTCAGGATGGGCTGG + Intronic
906193164 1:43911931-43911953 CTGCCCACCTCAGCCTCGCACGG + Intronic
910399614 1:86825661-86825683 CTGGCCTGGTCATCCTGGCCTGG + Intergenic
910674273 1:89801140-89801162 CTGCCCATCTCAGCCTCCCAAGG + Intronic
911199778 1:95032740-95032762 CTGTCCCTGTCAGGATGGCCCGG - Intronic
913482327 1:119300636-119300658 CTGAACATTTCAGCCTGCCCTGG - Intergenic
913655395 1:120955089-120955111 CGGACCAAATCAGCCTGGCCAGG - Intergenic
914993057 1:152515254-152515276 GTGTACAAGTCAGCCTGGCCTGG - Intronic
915701824 1:157803798-157803820 CTGCCCTTCTCAGCCTATCCTGG + Intronic
915972951 1:160366942-160366964 CTGCCAATGGCTGCCTGGCCTGG + Intergenic
916059689 1:161089813-161089835 TTGCCCCTTTCATCCTGGCCTGG - Intergenic
918486679 1:185036122-185036144 CTGCCCTTTTCAGCCAGTCCTGG + Intergenic
919369247 1:196703739-196703761 CTGCCCATCTCAGCCTCCCAAGG - Intronic
920376464 1:205510957-205510979 TTGCCCATCTCAGCATGGCAGGG - Intronic
920838541 1:209534564-209534586 TTTCCCATGCCAGCCTGACCTGG + Intergenic
920838543 1:209534568-209534590 CTGGCCAGGTCAGGCTGGCATGG - Intergenic
920964350 1:210689868-210689890 CTGCCCATGTCAGAATCACCTGG - Intronic
921965132 1:221079925-221079947 CTGCCTATTTCAACCTGTCCTGG + Intergenic
922221752 1:223613633-223613655 CTGCAAATGACAGGCTGGCCTGG + Intronic
922763260 1:228145202-228145224 CTGACCCTGTCAGCCTCCCCAGG - Intronic
924106534 1:240654614-240654636 CTGTCCATGTCAGTGGGGCCTGG - Intergenic
1062789177 10:290651-290673 CTGCCCCGGCCAGCTTGGCCTGG - Intronic
1062817397 10:510529-510551 CTGCCCAGGCCTGCCTGGCACGG - Intronic
1065708521 10:28493446-28493468 CTGCCATTGTCAGCCGGGCGTGG + Intergenic
1065871238 10:29958025-29958047 TGGCCCATGGCAGCCTGGCAGGG + Intergenic
1067686852 10:48470898-48470920 CTACCACTGGCAGCCTGGCCTGG + Intronic
1067803779 10:49379585-49379607 CTGGACACTTCAGCCTGGCCTGG + Intronic
1067935844 10:50611623-50611645 CAGCCCAAGTCAGGCTGTCCTGG - Intronic
1071481840 10:86070457-86070479 GTGCCCATCCCAGCCTGGTCAGG - Intronic
1074536597 10:114332427-114332449 CTGTCCATTTCAGCCAGCCCTGG + Intronic
1074543443 10:114384850-114384872 CTGCCCCTCTCAACCAGGCCTGG - Intronic
1075528192 10:123203386-123203408 CTGCACATGTCAGCCTCACAGGG - Intergenic
1075654088 10:124149908-124149930 GGGCCCCTGTCAGCCAGGCCTGG - Intergenic
1076133908 10:128031512-128031534 CTGCCCAAAACACCCTGGCCAGG - Intronic
1076142734 10:128092747-128092769 TTGCTCATATCAGCCTGGCCTGG + Intergenic
1076280479 10:129242335-129242357 CTGCCCACGTTGGCCTGGGCTGG + Intergenic
1076413787 10:130270770-130270792 CAGCCTGTGCCAGCCTGGCCAGG + Intergenic
1076447493 10:130526654-130526676 CCACACATGTCAGCCTAGCCAGG - Intergenic
1076569972 10:131426150-131426172 CTGCCCAAGGGAGCCCGGCCAGG - Intergenic
1076574829 10:131457620-131457642 TTCCCCATGTCACACTGGCCTGG - Intergenic
1077228190 11:1447395-1447417 CTGCCCCAGGCAGCCAGGCCTGG - Intronic
1077374794 11:2200430-2200452 CTGTCCATGTGAGCCTGGGGAGG - Intergenic
1077439695 11:2562166-2562188 CCGCCCAAGGTAGCCTGGCCTGG - Intronic
1078058452 11:8027756-8027778 CCGCCCATCTCAGCCTCCCCAGG + Intronic
1080693879 11:34584122-34584144 ATGCCCATCACAGCCTTGCCGGG + Intergenic
1081616804 11:44596137-44596159 CTGCTCATGGCAGCCGGGCCTGG + Intronic
1082793686 11:57364969-57364991 CTTCCCAGGTCAGGCTGCCCTGG + Intronic
1083266778 11:61550545-61550567 CCCCACATCTCAGCCTGGCCTGG - Intronic
1084169898 11:67396059-67396081 CTGCCCAGCTCAGCCCAGCCCGG + Intronic
1084183061 11:67456097-67456119 CTGCTCATGTTGGCCTGGGCAGG - Intronic
1084297993 11:68225695-68225717 CTTCCCAGGACAGCCTGGCATGG - Intergenic
1084673521 11:70621425-70621447 CTGCCCATTTCTTTCTGGCCTGG + Intronic
1084777556 11:71387457-71387479 CTGCCCCAGCCAGCCAGGCCAGG + Intergenic
1085309393 11:75507218-75507240 CTCCCCATGTCCGCCTGACAGGG - Intronic
1085697259 11:78715517-78715539 CTGCCAATGCCACCCTGTCCTGG - Intronic
1086406565 11:86503971-86503993 CAGCTCAAGGCAGCCTGGCCTGG + Intronic
1087774236 11:102243084-102243106 CTGCCCAGGGCAGCCTGAGCAGG + Intergenic
1089782652 11:120884463-120884485 CGGCCCATGCCAGCCAGGCGGGG + Intronic
1089939231 11:122398022-122398044 CTGCCCATGTCAGGCTGGAAAGG - Intergenic
1091397687 12:163667-163689 CCGCCCTGGTCAGCCTGGGCAGG + Intronic
1091778449 12:3199616-3199638 CTGTCCCTGTCAGCCTGCCTGGG + Intronic
1093057352 12:14568118-14568140 GCGCGCATGTCACCCTGGCCCGG - Exonic
1096779280 12:53982937-53982959 CTGCCCAGGCCAGCCAGGACAGG - Intergenic
1096809493 12:54160500-54160522 CTGCGCAGGCCAGCCTGCCCAGG - Intergenic
1101330195 12:103751266-103751288 CTGGCCAGGACAGCATGGCCAGG + Intronic
1101961783 12:109256260-109256282 CTGCCCATGTCTGACTCACCAGG + Intronic
1102149886 12:110681758-110681780 CTGCCCTCGCCAGCTTGGCCTGG + Intronic
1102970556 12:117162808-117162830 CTGCAGATGTCAGCCTAGCACGG - Intronic
1104288219 12:127444837-127444859 CTTCCCATCTCAGCCTCCCCAGG + Intergenic
1104602491 12:130162816-130162838 CCGCCCATGCCCGCCCGGCCTGG - Exonic
1104671947 12:130686646-130686668 CTGGCCATGTGCGCGTGGCCCGG - Intronic
1104722157 12:131050570-131050592 CTGCCCATGTAAGACGTGCCTGG - Intronic
1104729696 12:131098039-131098061 CTGCCCAGGTGAGGCTGGCGCGG - Intronic
1105874608 13:24541099-24541121 CTGCCCAGGGGAGCCTGGCTGGG - Intergenic
1107819329 13:44272130-44272152 CTGCCCATCTCAGCTTGGAGTGG + Intergenic
1108395465 13:49986997-49987019 CTGCCCATGTGACACTGGGCAGG - Intergenic
1113055967 13:106268466-106268488 GGGCTCATGTCAGCATGGCCTGG - Intergenic
1117903150 14:60556769-60556791 ATGCACATTTCAGCCTGGCATGG + Intergenic
1118167761 14:63355001-63355023 CACCCCATGTCAGCCTGACTGGG - Intergenic
1118489775 14:66247773-66247795 TTGGCCATGTCTGCCTGGCTTGG - Intergenic
1119666116 14:76486308-76486330 CTGCACATGGGAGCCTGGGCAGG - Intronic
1120828428 14:88976023-88976045 CTGCCCATGTAAGCCAGCCTGGG + Intergenic
1121774097 14:96578793-96578815 TTTCCCATGGCAGCCTGGCCTGG + Intergenic
1122055148 14:99092877-99092899 CAGCCCATGACAGCCTCCCCAGG - Intergenic
1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG + Intergenic
1122576542 14:102746651-102746673 GTGCCCATCTCTGCATGGCCAGG + Intergenic
1122638221 14:103140298-103140320 CTGCATTTGTCAGCCTGACCCGG - Intergenic
1123111119 14:105867237-105867259 CTGCTCAGGGCAGCCAGGCCAGG - Intergenic
1126107448 15:45155951-45155973 CTGCCCATACCCTCCTGGCCTGG - Intronic
1126218221 15:46182266-46182288 CATCCCATGTCCGCCTGGCCTGG + Intergenic
1126628377 15:50708462-50708484 CTGCCCATCTCAGCCTCCCAAGG - Intronic
1127795291 15:62432926-62432948 CTCCCCATGCCTGCCTGGCAAGG - Intronic
1128091736 15:64923760-64923782 CTGGTCCTGCCAGCCTGGCCTGG + Intronic
1128136094 15:65264708-65264730 CTGCTCATGGCAGCCTTGCATGG - Intronic
1129692107 15:77719473-77719495 ATGTCCATGCCAGCCTGACCTGG - Intronic
1130696687 15:86138464-86138486 CTGTTCATCTCAGCCAGGCCTGG + Intergenic
1131229832 15:90651726-90651748 CTGCCGATTTCAGCCGGACCTGG - Intergenic
1131377741 15:91939530-91939552 CTGCCCACCTCTGCCAGGCCTGG - Intronic
1132668926 16:1094864-1094886 CTGCCCGTGGGGGCCTGGCCCGG - Exonic
1132897409 16:2235629-2235651 CCACCCATGCCTGCCTGGCCTGG + Exonic
1132973944 16:2702283-2702305 CTGGTCATGTCAGCCTGGCTGGG + Intronic
1133602718 16:7355610-7355632 CTCCCCATGTCAGTCTGTACAGG + Intronic
1134058628 16:11185673-11185695 CTACCCTTGGCAACCTGGCCCGG - Intergenic
1134492116 16:14703214-14703236 CTGCCCGGGTCAGCGTAGCCAGG + Intergenic
1134497497 16:14742336-14742358 CTGCCCGGGTCAGCGTAGCCAGG + Intronic
1136453881 16:30369924-30369946 CTGCCCGTGACAGCCGGGGCTGG + Exonic
1137586066 16:49664614-49664636 CTGCCCCTGTCTGCCAGGACAGG + Intronic
1137605302 16:49783182-49783204 CCGCCCATCCCAGCCTGGCAGGG - Intronic
1138009327 16:53362799-53362821 CTGCCTATGGCTTCCTGGCCTGG - Intergenic
1138373297 16:56544459-56544481 CTGTCAAGGTCAGCCTGGCTTGG + Intergenic
1138558246 16:57785438-57785460 CTGCCCATCCCAGCCTCCCCAGG + Intronic
1138593881 16:58018979-58019001 CTTTCCACCTCAGCCTGGCCTGG + Exonic
1139323729 16:66135442-66135464 CTGCCAATGTCAGCCTGAGGTGG - Intergenic
1139949807 16:70663343-70663365 CTGCCCATGACAGAGGGGCCAGG - Exonic
1139965300 16:70741984-70742006 CTGCCGAGGGCAGCCTGGGCCGG - Intronic
1140029930 16:71327525-71327547 CTGCACCAGTCAGCCTGGCATGG + Intergenic
1140097021 16:71883993-71884015 CAGCCCAAGCCAGCCGGGCCGGG + Exonic
1141210195 16:81972561-81972583 TTGCTCATGTCACCCTGGCTGGG + Intergenic
1141624005 16:85251933-85251955 CTGTTCATGGCAGCCTGGCATGG - Intergenic
1142261398 16:89044123-89044145 CTGCCCCTGTCACCCTGGTGTGG + Intergenic
1142472221 17:170795-170817 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142472232 17:170827-170849 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142472255 17:170891-170913 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142472266 17:170923-170945 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142472313 17:171055-171077 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142472420 17:171349-171371 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142472455 17:171447-171469 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142472526 17:171643-171665 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142472549 17:171707-171729 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142472584 17:171805-171827 CTGCCCTCTGCAGCCTGGCCCGG - Intronic
1142744012 17:1946110-1946132 CTGCCCTGGTCACCCTGCCCTGG - Intronic
1142808325 17:2383371-2383393 CCTCCCATGACAGCCTGCCCAGG + Intergenic
1143001179 17:3796241-3796263 GTGCCCAGGTCTGCCAGGCCTGG + Intronic
1143118119 17:4591988-4592010 CTGCCCCTCTCAGCTGGGCCAGG - Intronic
1143875368 17:9986895-9986917 CTCCAGATGTCTGCCTGGCCTGG - Intronic
1143960202 17:10710861-10710883 CTGACAATGTGTGCCTGGCCTGG + Exonic
1144722409 17:17480545-17480567 CCTCCCATCTCAGCCTGCCCAGG - Intronic
1144833104 17:18142666-18142688 AGGCCCTTGCCAGCCTGGCCTGG - Intronic
1145094199 17:20009948-20009970 CTTCCCCTGTCACCCCGGCCAGG - Intronic
1146635500 17:34501387-34501409 ATACCAATGCCAGCCTGGCCAGG + Intergenic
1146808121 17:35881641-35881663 ATGCCAATTTCAGCCTAGCCCGG - Intergenic
1147163172 17:38579346-38579368 CTCCCCATGTCTTCCTGCCCTGG - Intronic
1147563197 17:41521366-41521388 CTGCCCCAGGCAGCCTGCCCAGG + Exonic
1148799306 17:50213232-50213254 GATCCCATGTCTGCCTGGCCTGG + Intergenic
1149318225 17:55458727-55458749 CTGGCCAGGGCAGTCTGGCCAGG + Intergenic
1149397987 17:56264347-56264369 ATGCCCATGTCAGCCCAGGCAGG - Intronic
1149826744 17:59835368-59835390 CTGCCCACCTCAGCCTCCCCTGG + Intronic
1149863529 17:60137879-60137901 CTGCAGATGTCATGCTGGCCTGG - Intergenic
1150294338 17:63999632-63999654 CTGCCCCTGCCAGCCTGGATGGG - Intronic
1150536850 17:66051741-66051763 CTCCCCAGGCCAGCCTGGCTTGG - Intronic
1150848184 17:68680259-68680281 CTTCCCATGTCACCCAGGCTGGG + Intergenic
1151349307 17:73522305-73522327 CTGCCCACCTCATCCTGGCCTGG + Intronic
1152302253 17:79501988-79502010 CTGTCCACTTCACCCTGGCCGGG - Intronic
1152351721 17:79787291-79787313 CTGTCCCTGTCTGCCTGGGCAGG + Exonic
1152585802 17:81188958-81188980 CAGCCCAGGTCAGCTTGGCCTGG - Intergenic
1152606565 17:81294599-81294621 CAGCCCTTGTCAGCCCGGGCCGG - Intronic
1152722603 17:81930203-81930225 TTGCCCATCTCTGCCTGGCCAGG + Intergenic
1152860419 17:82693295-82693317 ATGCCCAAGTCGGCCGGGCCTGG - Intronic
1152875988 17:82786490-82786512 CAGCTCTCGTCAGCCTGGCCTGG + Intronic
1153467391 18:5404135-5404157 CTCCCCATGGCAGCAGGGCCAGG - Intronic
1153904865 18:9652184-9652206 CTGCCCATGTCAGCCTCCCAAGG + Intergenic
1154502351 18:15003146-15003168 CAACCCATGGCAGCCTGGGCCGG + Intergenic
1155576124 18:27248948-27248970 CTGCCCATCTCAGCCTCCCAAGG + Intergenic
1155585176 18:27356214-27356236 CTGCCCCCTTCAGCCTGGCACGG + Intergenic
1157904901 18:51561015-51561037 CTGCCCATCCCAGCTTTGCCTGG - Intergenic
1158936712 18:62371244-62371266 CTGCCCCTGACAGTGTGGCCAGG - Intronic
1159754850 18:72351547-72351569 CAGACCATATTAGCCTGGCCAGG + Intergenic
1159841428 18:73403522-73403544 CTCCCCATGGCAACTTGGCCTGG - Intergenic
1160014154 18:75127796-75127818 CTGTGCATGACAGCCTGGCCAGG - Intergenic
1160152130 18:76403262-76403284 CTGCACCTGTCTGCCTGACCTGG + Intronic
1160662315 19:306821-306843 CAGCCTATGGCAGCCGGGCCCGG + Intronic
1161443320 19:4304719-4304741 CAGCCCAGGTCACCCCGGCCCGG - Exonic
1161589798 19:5124208-5124230 CTGCCCATGTGACCCTGAGCTGG + Intronic
1161885248 19:6989531-6989553 ATGTCCATGTCAGCCAGGCGTGG - Intergenic
1162368020 19:10261177-10261199 CTGCCTGTGTGGGCCTGGCCAGG + Intergenic
1163002274 19:14375819-14375841 CTACTCATCCCAGCCTGGCCTGG - Intergenic
1163279103 19:16304277-16304299 CTGCCAAAGTCAGCCAGGCACGG + Intergenic
1163283584 19:16332203-16332225 CAACCCAGGTCTGCCTGGCCTGG + Intergenic
1163705263 19:18808682-18808704 CTGCCCTTGTCCCCCTGACCAGG + Intergenic
1164306740 19:24010649-24010671 CTGCCCGTGTCAGCCTCCACAGG + Intergenic
1165456034 19:35911275-35911297 CTCCCCACTTCAGCCAGGCCTGG + Intergenic
1165914055 19:39247325-39247347 CCGTCCTTGTCAGCCTCGCCTGG + Intergenic
1166190553 19:41173820-41173842 CTGCCAGAGTCAGCCTGGCCTGG - Intergenic
1166256139 19:41606273-41606295 CTGCCCATGTGGTCCTGGCCAGG + Intronic
1166779539 19:45333913-45333935 CTTCCCATCTGAGCCCGGCCTGG - Intronic
1167375261 19:49107778-49107800 CTGCCCACCTCATCCAGGCCCGG + Exonic
1167715283 19:51138943-51138965 CTGCCCAGGACAGACTGGGCTGG - Intergenic
925358165 2:3257298-3257320 CAGCCCATGGCAACATGGCCTGG - Exonic
925751173 2:7091421-7091443 GACTCCATGTCAGCCTGGCCTGG + Intergenic
925926011 2:8671218-8671240 CTGCCCATGCCAGAACGGCCAGG - Intergenic
927878233 2:26673020-26673042 CTGTCAAAGTCAGCCAGGCCGGG - Intergenic
927894869 2:26775224-26775246 GAGCCCTTCTCAGCCTGGCCTGG - Intronic
929466277 2:42147394-42147416 CTGCCCAGGATAGCATGGCCAGG + Intergenic
931927964 2:67095872-67095894 TTCCCCCAGTCAGCCTGGCCTGG + Intergenic
935738504 2:106126101-106126123 CTGCCCATGCCACCCTGTCTGGG + Intronic
936406552 2:112209868-112209890 CTGCACAGGTCAGCCTGGCCTGG + Intergenic
937985973 2:127638265-127638287 CTGCTTATGGCAGCCTGGCCTGG + Intergenic
938501525 2:131833318-131833340 CAACCCATGGCAGCCTGGGCCGG + Intergenic
941957846 2:171222437-171222459 CCTCCCATCTCAGCCTGCCCAGG + Intronic
946843697 2:223840697-223840719 CTGCCCATCTCAGCCAGGCCAGG - Intergenic
946875804 2:224128687-224128709 CTGACCATAACAGTCTGGCCTGG + Intergenic
947528535 2:230894077-230894099 CTGCTCAGCACAGCCTGGCCTGG - Intergenic
948193536 2:236078448-236078470 TTTCACATGTCAACCTGGCCAGG - Intronic
948197097 2:236104250-236104272 CTGCCCATGTCAGCCTGGCCTGG - Intronic
948536906 2:238653239-238653261 CAGCCCATGGCAGCATGGGCCGG - Intergenic
948567831 2:238897769-238897791 CTGCCCATCCCAGCCCGGGCTGG + Intronic
948971747 2:241433780-241433802 CTGCCCATCTCAGCCTCCCAAGG - Intronic
1170888510 20:20360378-20360400 CTGCCCATGTACGCGTGGCCAGG + Exonic
1170892626 20:20389047-20389069 CTTCGCATGACAGCCTGGCCAGG - Intergenic
1171390736 20:24800193-24800215 CCGCCCATGTCAACCTCTCCTGG + Intergenic
1171905199 20:30894224-30894246 CCGCGCATGCCAGCCTGGGCTGG + Intergenic
1172013243 20:31858523-31858545 CTCCCCATAGCAGCCTAGCCTGG + Intronic
1172121779 20:32603009-32603031 CAGCCCATGCCAGCCTGAGCCGG - Intronic
1172139827 20:32714580-32714602 CTGCCCATCTCAGCCTCCCAAGG - Intronic
1172442530 20:34976342-34976364 CTTCCCGTGTGAGCCTGGTCTGG + Intronic
1173776704 20:45714501-45714523 CTGTCCATATAAGCCTGGCTGGG - Intergenic
1174449244 20:50609545-50609567 CTGCCCAGCCCAGCTTGGCCCGG + Intronic
1174505586 20:51015498-51015520 CGGCCCCTGCCAGCCTAGCCAGG - Intronic
1175499682 20:59440992-59441014 CTGGCCATGTCAGACTGACGAGG + Intergenic
1175759779 20:61554075-61554097 TTGGCCAGGACAGCCTGGCCTGG + Intronic
1175779613 20:61674135-61674157 CTCCCCAAGCCTGCCTGGCCAGG + Intronic
1176309617 21:5142708-5142730 CACCCCAGGTCAGACTGGCCCGG + Intronic
1177431465 21:20997133-20997155 GAGCCCATGTCAATCTGGCCTGG - Intergenic
1178560798 21:33637877-33637899 CTGCCCAAGAGAGCCTGGCATGG - Intronic
1178702518 21:34845452-34845474 CTGCCTATGGCTGCCTGGCCTGG + Intronic
1179847441 21:44119325-44119347 CACCCCAGGTCAGACTGGCCCGG - Intronic
1181308429 22:21930253-21930275 CAGGCCATGCCAGCCTGGGCTGG - Intronic
1181756398 22:25028048-25028070 TTGCCCATCTCACCCAGGCCTGG - Exonic
1181982656 22:26776634-26776656 CTGCTCATTGCAGCCAGGCCTGG + Intergenic
1181992873 22:26850858-26850880 CTGTCCATGTCTGCCCAGCCAGG - Intergenic
1182458594 22:30468749-30468771 CCACCCAGGTCAGCCTGGTCTGG - Intronic
1182960201 22:34465020-34465042 CTGCCACCTTCAGCCTGGCCTGG - Intergenic
1183477409 22:38043111-38043133 CTGGCCATGTGCCCCTGGCCTGG + Intergenic
1183776918 22:39972237-39972259 CAGCACAGGTCAGCCTGGCCAGG + Exonic
1185065823 22:48631229-48631251 TTGCCCACTTCACCCTGGCCTGG - Intronic
1185269669 22:49923185-49923207 CGGCCCAGGACAGCCCGGCCAGG - Intronic
1185315757 22:50178467-50178489 CGGCCCACGGGAGCCTGGCCAGG + Intronic
949584130 3:5421308-5421330 CTGCCCACCTCAGCCTCCCCAGG - Intergenic
949905418 3:8854624-8854646 CTGCCCATGTCAATGAGGCCAGG + Intronic
950499649 3:13355537-13355559 TTTGCCATGGCAGCCTGGCCAGG + Intronic
951720110 3:25689148-25689170 CTGCCCACCTCAGCCTCCCCAGG - Intergenic
953250919 3:41245182-41245204 GTGCCCATGTGGCCCTGGCCTGG - Intronic
953639026 3:44688286-44688308 ATGGACATGTCAGCCTGACCAGG + Intergenic
954123902 3:48517486-48517508 CTGCCCATGTATGCCAGGCCAGG + Intergenic
954198853 3:49012448-49012470 CTGCCCATGAGAGGCAGGCCTGG + Exonic
954590988 3:51781398-51781420 TTGACCATGGCAACCTGGCCTGG - Intergenic
955215442 3:56981711-56981733 CAGACCATGTGAGCTTGGCCAGG - Intronic
955780184 3:62476442-62476464 CTGCACATGTATGGCTGGCCTGG - Intronic
955995518 3:64676845-64676867 CTTCCCATCTCAGCAAGGCCAGG - Intronic
956680263 3:71772774-71772796 TTGCCCATGTCTGCCAGGCTTGG - Exonic
956729827 3:72186446-72186468 CTGCAAATGTCTGGCTGGCCTGG + Intergenic
961302067 3:125928496-125928518 CTTCCCATCTGATCCTGGCCTGG - Intergenic
961604120 3:128081199-128081221 CTCCCCAGGTGTGCCTGGCCTGG - Exonic
964503576 3:157374612-157374634 CAGCACATGCCATCCTGGCCTGG - Intronic
965714345 3:171586649-171586671 CAGCCCATTTCAGACTCGCCAGG - Intergenic
965781195 3:172287974-172287996 CTATCCATGACAGTCTGGCCAGG + Intronic
966874554 3:184314830-184314852 CGGCCCACGTGTGCCTGGCCCGG + Intronic
967214258 3:187197278-187197300 CAGACCATCTCACCCTGGCCTGG - Intergenic
968073777 3:195804641-195804663 CTGCCCGAGGCAGCCTGGCAAGG - Intronic
968530995 4:1091617-1091639 CTGCCCATGGCTCACTGGCCCGG + Intronic
968995576 4:3943349-3943371 CTTCCCATCTGATCCTGGCCTGG + Intergenic
969348030 4:6581424-6581446 AAGCCCATGTGTGCCTGGCCTGG + Intronic
969430071 4:7148773-7148795 CTGCCCGTCTCAGCCTGGAAAGG + Intergenic
969818378 4:9702897-9702919 CTTCCCATGTGATCCTGGCCCGG - Intergenic
970596292 4:17603412-17603434 CTTCCCATGTCAGCCTCCCAAGG - Intronic
974120441 4:57631835-57631857 CTGCCCATGTCGGCCTGATTGGG - Intergenic
977308121 4:95351034-95351056 CTGACAGTGTCTGCCTGGCCAGG - Intronic
977920059 4:102633304-102633326 CGGCTCATGCCAGCCTGCCCAGG + Intronic
979492128 4:121339975-121339997 CTGCCCTTGTTAGCTTGGCTTGG + Intronic
980344837 4:131600756-131600778 CTGCCCATCTCAGCCTCCCAAGG - Intergenic
984562489 4:181286935-181286957 CCGCCCACCTCAGCCTGGGCGGG + Intergenic
984973311 4:185209571-185209593 CCGCCCGCGTCAGGCTGGCCAGG + Intronic
985711222 5:1431140-1431162 CTGCCCTCGCCAGCCGGGCCTGG - Intronic
987456274 5:18150987-18151009 ATCCCCATATCAGCCAGGCCTGG - Intergenic
990021997 5:51139158-51139180 ATGCCTTTGTCAGCCTGGTCTGG + Intergenic
990941977 5:61211836-61211858 CTGCACTTGCCAGACTGGCCTGG - Intergenic
994893825 5:105674754-105674776 TTGCCCATCTCTGCCTGGCTGGG - Intergenic
997837826 5:137210699-137210721 CTGCCCCTGTGTGCCTTGCCTGG - Intronic
998446820 5:142205031-142205053 CTGGCCACTTCAGCCTGGCAAGG + Intergenic
999283417 5:150379725-150379747 CTGCCCAGGTAAGACTTGCCAGG + Exonic
999721822 5:154404189-154404211 CGGCCGGAGTCAGCCTGGCCCGG + Exonic
1000457218 5:161465323-161465345 GTGGCCTTGTCAGCCTGTCCTGG - Intronic
1000748135 5:165061357-165061379 CTGCCCTTGTCCTTCTGGCCTGG - Intergenic
1002183190 5:177441943-177441965 CTGCCAAACTCAGCCAGGCCAGG - Exonic
1002189918 5:177472973-177472995 CTGCCCGGCTCAGCCCGGCCCGG - Exonic
1002334201 5:178466788-178466810 CTGGCCGTGCCAGGCTGGCCAGG + Intronic
1002442123 5:179269954-179269976 CTGCCAAGGCCAGCATGGCCAGG + Intronic
1002905505 6:1445638-1445660 CTGCCCATGTCCGCCACCCCAGG - Intergenic
1003640827 6:7873811-7873833 CTGCCCATGTCTGCTTGACCTGG + Intronic
1005451849 6:25981312-25981334 CTGTCCATGTCAGCCTTCCTGGG + Intronic
1006513984 6:34535976-34535998 CTGGCCCTGGCAGCCTGGCAGGG + Intergenic
1006798359 6:36744676-36744698 TTTCCCAGGCCAGCCTGGCCAGG - Intronic
1007250295 6:40490665-40490687 CTGCCCCTCACAGCCAGGCCTGG + Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007760239 6:44128741-44128763 CTCCCCACCTCACCCTGGCCTGG - Intronic
1007834543 6:44664508-44664530 CTTCCCATGGCAGCAGGGCCCGG - Intergenic
1007848689 6:44782367-44782389 CTGCCCATGCCACCCTGGCCAGG - Intergenic
1010211908 6:73368977-73368999 CTGCCCAAGTCAGCCTCACCTGG - Intronic
1013012381 6:106132385-106132407 CGGCCCTCGTCAGGCTGGCCCGG - Intergenic
1013357783 6:109361887-109361909 CTGCCCAAGACAGACTGGTCTGG + Intergenic
1015980988 6:138838474-138838496 CTGCCCAAGTCAGCTGGCCCTGG + Exonic
1017141228 6:151191786-151191808 CTGCGCATGTCAGACAGACCTGG - Intergenic
1018057053 6:160061297-160061319 CTGCCCTTCACAGCCGGGCCTGG - Intronic
1018333560 6:162760391-162760413 CTGCCTCTGACAGCGTGGCCTGG - Intronic
1019157820 6:170050871-170050893 CTGCCCATGACCGCCTGCCCCGG + Intergenic
1019768004 7:2865520-2865542 CTGCCCAGGTAAGGCTGGCCCGG + Intergenic
1019791547 7:3017242-3017264 CTGCCCAGCTCAGGCTGCCCAGG + Intronic
1020112662 7:5456259-5456281 CTGCACCAGTCAGCCTGCCCTGG + Intronic
1020258615 7:6517298-6517320 CTGCCCATCTCAGCCTCCCAAGG + Intronic
1021587712 7:22227594-22227616 CTGCCCACCTCAGCCTCCCCAGG - Intronic
1022680951 7:32545611-32545633 CTGCCCATCTCAGCCTCTGCAGG + Intronic
1027221047 7:76214168-76214190 CAGCCCCTTTGAGCCTGGCCTGG + Intronic
1029734005 7:102455573-102455595 CTGCCCCTGACAGGCTGGGCTGG - Exonic
1033142309 7:138838420-138838442 TTCCCCTTGTCAGCCTGGCATGG - Intronic
1033531923 7:142272751-142272773 CTGGCCATGTCAGCAAGTCCGGG - Intergenic
1034489674 7:151386562-151386584 CTGCCCGTGTCAGCTTTGGCAGG + Intronic
1034694484 7:153041802-153041824 CTGCACATGGGAGCCTGGACTGG + Intergenic
1034764237 7:153702945-153702967 CTTCCCATGTCAGCCTCTCCAGG - Intergenic
1035735055 8:1881698-1881720 CTGGCCGTGTCTGCCTGCCCTGG - Intronic
1037752514 8:21692085-21692107 CTGCCCCAGTCAGCCTGGCTGGG - Exonic
1038078549 8:24105641-24105663 CTGCCCATATCTGCATGCCCTGG + Intergenic
1040874073 8:52131993-52132015 CAGCCCATTGCAGCCTGGCAAGG + Exonic
1042558270 8:70052182-70052204 CTGCCCATGACAGCCATGTCCGG - Exonic
1042947290 8:74167985-74168007 CTGCCCAAGACAGGATGGCCTGG - Intergenic
1049107053 8:140620668-140620690 CTCTCCATGTTAGCCTGGGCTGG - Intronic
1049184838 8:141244631-141244653 CTGCTCACATCCGCCTGGCCTGG - Intronic
1049203071 8:141351234-141351256 CTGGCCCTGCCAGCCTGTCCAGG + Intergenic
1049742296 8:144247009-144247031 GTGCCCACGTCGGCATGGCCTGG + Intronic
1049788245 8:144461570-144461592 CTGCCCACCTCACCCAGGCCAGG - Intronic
1053666580 9:40321899-40321921 CTGGTCATGGCAGCCTGGTCAGG + Intronic
1054377732 9:64461927-64461949 CTGGTCATGGCAGCCTGGTCAGG + Intergenic
1054518029 9:66054384-66054406 CTGGTCATGGCAGCCTGGTCAGG - Intergenic
1055324264 9:75112064-75112086 CTGCCCACCTCAGCCTGGCTGGG + Intronic
1056792368 9:89634063-89634085 CTGCCCATGTCAGCGGTCCCTGG - Intergenic
1057552629 9:96063318-96063340 CTGCCCATCTCCCCATGGCCGGG + Intergenic
1057596386 9:96418687-96418709 CCGCCCTTGTCTCCCTGGCCCGG - Intergenic
1058310464 9:103495522-103495544 CTGCTCACCTCAGCCTTGCCGGG - Intergenic
1058874997 9:109236533-109236555 CTGCCCACCTCAGGCTGTCCTGG + Intronic
1060189358 9:121582304-121582326 CTGCTCATCCCACCCTGGCCTGG - Intronic
1060825000 9:126682963-126682985 CATCCCAGGCCAGCCTGGCCAGG - Intronic
1060886921 9:127160978-127161000 CTGCACCTCTCAGCCTTGCCTGG + Intronic
1061322317 9:129839060-129839082 GTCCCCATGCCAGGCTGGCCGGG + Intronic
1061681761 9:132245980-132246002 CTGCCCAGGGCTGCCTGGCCTGG - Intergenic
1062265901 9:135686346-135686368 CTGCACACAGCAGCCTGGCCTGG + Intergenic
1062459129 9:136655553-136655575 TTTCCCAAGTCACCCTGGCCCGG - Intergenic
1062615004 9:137392376-137392398 CTGCCCCCGACAGCCAGGCCTGG - Intronic
1062718764 9:138023914-138023936 CTGGACATGGCAGCGTGGCCGGG - Intronic
1186311120 X:8320220-8320242 CAGCCCATGTCATCTTGGGCTGG - Intergenic
1188778072 X:34246795-34246817 CTTCCCAAGTCATCATGGCCTGG - Intergenic
1189995108 X:46630598-46630620 CTGCCCAGGTCATGCTGACCTGG + Intronic
1198342060 X:135724360-135724382 CTGCCCATCTCAGCCTCCCAAGG + Intergenic
1198345930 X:135758936-135758958 CTGCCCATCTCAGCCTCCCAAGG - Intergenic
1198347844 X:135776435-135776457 CTGCCCATCTCAGCCTCCCAAGG - Intergenic
1198349749 X:135793697-135793719 CTGCCCATCTCAGCCTCCCAAGG - Intergenic
1198351652 X:135810973-135810995 CTGCCCATCTCAGCCTCCCAAGG - Intergenic
1198353563 X:135828235-135828257 CTGCCCATCTCAGCCTCCCAAGG - Intergenic
1198355468 X:135845491-135845513 CTGCCCATCTCAGCCTCCCAAGG - Intergenic
1198357378 X:135862776-135862798 CTGCCCATCTCAGCCTCCCAAGG - Intergenic
1198359292 X:135880055-135880077 CTGCCCATCTCAGCCTCCCAAGG - Intergenic
1198701848 X:139405476-139405498 CTGGCCATTTCAGCCTGTCTGGG + Intergenic
1200128927 X:153830696-153830718 CTGCCCATGGCCGCCAGCCCCGG + Intergenic