ID: 948197793

View in Genome Browser
Species Human (GRCh38)
Location 2:236108126-236108148
Sequence TAGGGGGTCAGGCGGAGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 484}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948197793_948197806 13 Left 948197793 2:236108126-236108148 CCGTCCCTCCGCCTGACCCCCTA 0: 1
1: 0
2: 3
3: 44
4: 484
Right 948197806 2:236108162-236108184 GGGAGAAGGCATGCATGCAAGGG 0: 1
1: 1
2: 2
3: 27
4: 247
948197793_948197800 -7 Left 948197793 2:236108126-236108148 CCGTCCCTCCGCCTGACCCCCTA 0: 1
1: 0
2: 3
3: 44
4: 484
Right 948197800 2:236108142-236108164 CCCCCTAGCAACGCAGCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 61
948197793_948197809 18 Left 948197793 2:236108126-236108148 CCGTCCCTCCGCCTGACCCCCTA 0: 1
1: 0
2: 3
3: 44
4: 484
Right 948197809 2:236108167-236108189 AAGGCATGCATGCAAGGGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 221
948197793_948197798 -8 Left 948197793 2:236108126-236108148 CCGTCCCTCCGCCTGACCCCCTA 0: 1
1: 0
2: 3
3: 44
4: 484
Right 948197798 2:236108141-236108163 ACCCCCTAGCAACGCAGCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
948197793_948197807 14 Left 948197793 2:236108126-236108148 CCGTCCCTCCGCCTGACCCCCTA 0: 1
1: 0
2: 3
3: 44
4: 484
Right 948197807 2:236108163-236108185 GGAGAAGGCATGCATGCAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 234
948197793_948197808 15 Left 948197793 2:236108126-236108148 CCGTCCCTCCGCCTGACCCCCTA 0: 1
1: 0
2: 3
3: 44
4: 484
Right 948197808 2:236108164-236108186 GAGAAGGCATGCATGCAAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 302
948197793_948197804 -1 Left 948197793 2:236108126-236108148 CCGTCCCTCCGCCTGACCCCCTA 0: 1
1: 0
2: 3
3: 44
4: 484
Right 948197804 2:236108148-236108170 AGCAACGCAGCTCAGGGAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 453
948197793_948197805 12 Left 948197793 2:236108126-236108148 CCGTCCCTCCGCCTGACCCCCTA 0: 1
1: 0
2: 3
3: 44
4: 484
Right 948197805 2:236108161-236108183 AGGGAGAAGGCATGCATGCAAGG 0: 1
1: 0
2: 5
3: 45
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948197793 Original CRISPR TAGGGGGTCAGGCGGAGGGA CGG (reversed) Intronic
900183544 1:1322737-1322759 TAGGGGGACCGGCGGCGGGGGGG + Intronic
901024747 1:6273237-6273259 TCTGGGCTCAGGCAGAGGGAAGG + Intronic
902119670 1:14152313-14152335 TGGAGGGTCAGGGGGAGGTACGG - Intergenic
903863265 1:26378589-26378611 GTGGGTGTCAGGCAGAGGGAGGG - Intergenic
904438748 1:30516190-30516212 GAGGGGCTGAGGCAGAGGGAGGG + Intergenic
904704379 1:32378970-32378992 TAGGGGGTCAGGCAGGGTGAAGG + Intronic
905380812 1:37560247-37560269 ACGGGTGTCAGGCTGAGGGACGG + Intronic
906293094 1:44632402-44632424 CCGGGGGTGGGGCGGAGGGAGGG - Intronic
906359258 1:45138727-45138749 CAGGGGGTCAGGTAGAGTGAAGG + Intronic
906390507 1:45411330-45411352 GTGAGGGTCAGGTGGAGGGATGG + Intronic
906544457 1:46611625-46611647 GAGGGGCTCAGAGGGAGGGAAGG - Intronic
906887116 1:49660949-49660971 TGGGGGGTCATGCAGGGGGAGGG + Intronic
909433516 1:75615896-75615918 TGGGGGGTCCGGGGGAGGGAAGG - Intergenic
910331722 1:86080283-86080305 TAGGAGATCAGGCGGAGGTAGGG + Intronic
911133890 1:94418683-94418705 GACGGGGTCGGGCGGAGAGAGGG + Intronic
913320004 1:117581560-117581582 TGCGGGGACAGGCAGAGGGAAGG + Intergenic
915778856 1:158522635-158522657 TTGGGGGGCAAGGGGAGGGAGGG + Intergenic
916804512 1:168245105-168245127 TAGGGGGAAAGAGGGAGGGAAGG + Exonic
917607364 1:176646540-176646562 GTGGGGGTCAGGTGGGGGGATGG - Intronic
917789849 1:178492512-178492534 GAGGTGGTCAGGCTGAGAGAGGG + Intergenic
918215701 1:182391000-182391022 TGGGGGGTCCGGGGGAGGGTGGG + Intronic
919945109 1:202313399-202313421 TGGGGGGTCAGGGGGTGGGGAGG - Intronic
920574899 1:207052330-207052352 TAGGGGGTAGGTAGGAGGGAAGG + Intronic
920969427 1:210730503-210730525 TAGGGGGTCAGAGGTAGGGAAGG - Intronic
921885071 1:220297229-220297251 AAGGGAGTGAGGAGGAGGGAAGG - Intergenic
922251265 1:223850638-223850660 TATAGGGTAAGGTGGAGGGAGGG - Intergenic
922579847 1:226688745-226688767 TTGTGGGTCAGGCAGAGAGAAGG - Intronic
922957786 1:229618883-229618905 TATTGGGGCAGGGGGAGGGATGG - Intronic
923738657 1:236635568-236635590 CAGAGGGTCAGGAGCAGGGAGGG + Intergenic
924207111 1:241724979-241725001 TAGGGAGGCAGGCTGAGGAAGGG - Intronic
924573870 1:245261547-245261569 GAGAGGGACAGACGGAGGGAGGG - Intronic
1063575909 10:7261880-7261902 TAGGGTGGCTGGCGGAAGGACGG + Intronic
1065809343 10:29427138-29427160 AAGGGTGTCAGGCTGGGGGACGG - Intergenic
1066022665 10:31319171-31319193 TGGGGGGGAAGGGGGAGGGAGGG + Exonic
1066425834 10:35306845-35306867 TAGGGGGCCAGGAGGATGGCAGG + Intronic
1066661323 10:37740190-37740212 CAGGGGGTCTGACCGAGGGAGGG + Intergenic
1067667264 10:48289052-48289074 CAGGTGGGCAGGCGGAGGGTGGG - Intergenic
1068084655 10:52360333-52360355 GAGGGGGCCGGGGGGAGGGATGG - Intergenic
1069853995 10:71429216-71429238 TCAGGGGTCAGCTGGAGGGAAGG + Intronic
1070753618 10:78978041-78978063 TAGCGGGACAGGGAGAGGGACGG - Intergenic
1071973195 10:90929303-90929325 CATGGGGTCAGAGGGAGGGAAGG + Intergenic
1071998157 10:91166970-91166992 TAGGTGGTCAGGATGGGGGAGGG + Intronic
1072688066 10:97550483-97550505 CAGGGAGGCAGGCGGAGGCAGGG - Intronic
1073002948 10:100298843-100298865 TAGGGGGTCAGGAGGAGGCTGGG - Intronic
1073043690 10:100623850-100623872 GAAGGGGTAAGGGGGAGGGAGGG + Intergenic
1073094725 10:100972665-100972687 TAAGAGGTCAGAAGGAGGGAGGG - Intronic
1073152783 10:101323133-101323155 GCGGGGGTCAGGAGGAGAGAGGG + Intergenic
1073634547 10:105183861-105183883 TGTGGGCTCAGGGGGAGGGATGG + Intronic
1076934738 10:133559778-133559800 TAGCGGGTGAGGGGGAAGGAAGG + Intronic
1077016036 11:399521-399543 AAGGGGGACAGGTGGAGGGGGGG - Intronic
1077178008 11:1199317-1199339 CAGAGGGACAGACGGAGGGAGGG + Intronic
1077391628 11:2303075-2303097 GAGGTGGTCAGGGGCAGGGAGGG + Intronic
1077419756 11:2444778-2444800 CAGGGGGTGAGGCGGAGGCAGGG + Intronic
1077454426 11:2669930-2669952 TCTGGAGTCAGGTGGAGGGAAGG + Intronic
1080613240 11:33923559-33923581 TAGGGGGTCAGGGAGGGGCATGG - Intergenic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1082009586 11:47441285-47441307 TAGGGGGGCAGGCCTAGGGAGGG + Intronic
1082992898 11:59223706-59223728 TAGCGGTTCAGGGAGAGGGAAGG - Intergenic
1083540557 11:63509045-63509067 TGGGGAGTCTGGCTGAGGGAAGG - Intronic
1083583765 11:63841370-63841392 TAGGGGTTGAGAGGGAGGGATGG + Intronic
1083974543 11:66107149-66107171 TAGGTGGTCAGACTGGGGGAGGG - Intronic
1084166656 11:67377935-67377957 TAGGGGGTGGGGTGGAGGGGCGG + Intronic
1084304295 11:68271760-68271782 TTGGGGGGCAGGAGGAGGGTTGG - Intronic
1084571245 11:69961192-69961214 CAGGGGGTCATGGGGAGGGCTGG + Intergenic
1084655845 11:70517694-70517716 CAAGGGCTCAGGGGGAGGGAAGG + Intronic
1084812943 11:71626424-71626446 ACGGGGGTCAGGCTGGGGGACGG - Intergenic
1084901766 11:72315134-72315156 TAAGGGGTGAGGGGGAGGGAGGG + Intronic
1084957061 11:72697183-72697205 TCGGAGGTCAGGCCTAGGGAGGG + Exonic
1084991613 11:72930808-72930830 TAGGGGTTGAGGAGGAGGTAGGG + Intronic
1085057061 11:73411206-73411228 TAGGGGCTGAGGTGGAGTGAGGG + Intronic
1085263882 11:75224917-75224939 TACGGGGTGAAGGGGAGGGATGG - Intergenic
1085383292 11:76140073-76140095 GAGGGGGAGAGGGGGAGGGAGGG - Intronic
1085805458 11:79632004-79632026 GAGGGGGTAAGACAGAGGGAAGG + Intergenic
1086188029 11:84042879-84042901 TAGGGGGTGAGGTGCAGGGAGGG + Intronic
1087795632 11:102452741-102452763 TCGGGGGGCAAGCGGCGGGAGGG - Exonic
1088018371 11:105087872-105087894 GAGGGGGTCAGGGGAAGGGAGGG + Intronic
1088814222 11:113410447-113410469 TAGGGGGACTGGAGGTGGGAGGG + Exonic
1089214810 11:116829186-116829208 TAGGGAGCCTGGTGGAGGGAGGG + Intergenic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1089781128 11:120874033-120874055 CCGGGGAGCAGGCGGAGGGAGGG - Intronic
1090078386 11:123593930-123593952 TAGGAGGCCAGGCTGAGGAACGG - Intronic
1090949270 11:131458498-131458520 TAGGGAGAGAGGCTGAGGGAAGG - Intronic
1090973213 11:131660378-131660400 GAGGGGGTGAGGGTGAGGGAGGG + Intronic
1091308098 11:134553415-134553437 GTGGGCGTCAGGGGGAGGGAGGG + Intergenic
1091418551 12:313961-313983 TAGGGGGTGATGTGGAGGGTTGG + Intronic
1092039215 12:5368822-5368844 GAGGGGGTCTGGGGCAGGGATGG - Intergenic
1092292793 12:7173837-7173859 CAGGGGCTCAAGGGGAGGGAGGG - Intergenic
1092960346 12:13591152-13591174 TAGGAGGGCTGGTGGAGGGAAGG - Intronic
1093950086 12:25155777-25155799 TAGGGGGAGAGGTGAAGGGAAGG + Intronic
1095711586 12:45294471-45294493 AAGGGGGCCAGGTGCAGGGAGGG + Intronic
1095948344 12:47766648-47766670 TGGGGGGTCAGGGGGAGGGGAGG - Intronic
1097050716 12:56221642-56221664 CTGGGGTTCAGGAGGAGGGATGG - Intronic
1097825755 12:64173221-64173243 TAAGGGGTCAGGGGGTGGTAAGG - Intergenic
1099970552 12:89495680-89495702 CAGGGAGTCAGGGGGAAGGATGG + Intronic
1101045536 12:100801746-100801768 TGGGGGGTGGGGTGGAGGGAAGG + Intronic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101843209 12:108342295-108342317 GAGGGGGTCAGAAGGAGGAAGGG + Intergenic
1102167807 12:110820593-110820615 GAGGGGGAGAGGAGGAGGGAGGG - Intergenic
1102514567 12:113437707-113437729 TAGGAGGCCAGGCTGATGGATGG + Intronic
1102540749 12:113617532-113617554 TAAGGGGGCAGGAGGAGGAAGGG + Intergenic
1102552116 12:113698865-113698887 TGGGGGGTCAGGGGGAGGTGGGG + Intergenic
1102787265 12:115614851-115614873 AAGGGGGACAGGCAGAGGGGAGG - Intergenic
1102863331 12:116355101-116355123 TAGGGGGTCAGGGGTTGGCAGGG + Intergenic
1102880581 12:116481900-116481922 GTGGGGGTCAGGGGGTGGGATGG - Intergenic
1103122135 12:118389220-118389242 TAGGGGGGCAGGCGGCAGGTGGG - Intronic
1103510611 12:121471188-121471210 GATGAGGTCAGACGGAGGGAGGG - Intronic
1104080310 12:125424662-125424684 GAGGGGCTCAGGCTGATGGATGG - Intronic
1104482177 12:129117258-129117280 TAGGGGTTCAGGGGGAGGAGGGG + Intronic
1104960125 12:132484594-132484616 TGTGGGGTCAGGCTGTGGGAAGG - Intergenic
1106006441 13:25774407-25774429 TGGGGAGGCAGGGGGAGGGAGGG + Intronic
1106233597 13:27842066-27842088 TACTGGGTCAGGTGGTGGGAGGG + Intergenic
1106710117 13:32322148-32322170 CAGGGGCTCAGGAGGAGGGATGG - Intronic
1106931302 13:34668622-34668644 GTGGGGGTCAGGAGGAGGGGTGG - Intergenic
1108344052 13:49526928-49526950 GAGGGAGGCAAGCGGAGGGATGG - Intronic
1109113700 13:58354560-58354582 TTGGGGGTCAGGGTGAGGGGAGG - Intergenic
1110523701 13:76510773-76510795 GAGGGGGTAAGTGGGAGGGAAGG + Intergenic
1111482061 13:88842523-88842545 TAGGGGTTCAGGGGGAGGGAGGG + Intergenic
1111990216 13:95108871-95108893 TATGGGGGCAGGTTGAGGGAGGG - Intronic
1112339235 13:98538762-98538784 TAGGAGGTCAGGCGGCAGGTGGG - Intronic
1112493063 13:99884398-99884420 GAAAGGGTCAGGAGGAGGGAAGG - Intronic
1113453744 13:110432373-110432395 TGGGGGGTGAGGATGAGGGAAGG + Intronic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113796600 13:113061886-113061908 TAGGGGGAGAGGAGGAGGAAGGG - Intronic
1114428458 14:22640175-22640197 AAGGGGGAGAGGGGGAGGGAGGG + Intergenic
1114532123 14:23402829-23402851 CAAGGGGGCAGGCGGAGGGCAGG + Intronic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1117351284 14:54884296-54884318 TAGGAGGAAAGGTGGAGGGAGGG + Intronic
1117427423 14:55615375-55615397 TATGGGGGAAGGGGGAGGGACGG - Intronic
1118772153 14:68949311-68949333 GAGGAGGTCAGGAGGAAGGAAGG + Intronic
1118801242 14:69191762-69191784 GAGGGGGTCACGCCGAGGGGCGG - Exonic
1119660372 14:76447171-76447193 GAGGGTCTCAGGAGGAGGGAAGG - Intronic
1121206370 14:92171939-92171961 TAGGGGGTGAGGGGCAGAGATGG - Exonic
1121403358 14:93702267-93702289 TTGGGGGACAGGGGGAGGCATGG + Intronic
1121749635 14:96339709-96339731 TAGGGACTCAGGAGGAGGGGAGG + Intronic
1122291015 14:100680533-100680555 AATGGGGGGAGGCGGAGGGAAGG - Intergenic
1122693409 14:103541913-103541935 CAGGGGCTGAGGCAGAGGGACGG - Intergenic
1122961219 14:105094291-105094313 CGGGGGGTCAGGTGGAGGGCAGG + Intergenic
1122964328 14:105114775-105114797 TGGGAGGTCAGAAGGAGGGATGG + Intergenic
1122965052 14:105119579-105119601 TGGGAGGTCAGAAGGAGGGATGG + Intergenic
1123968250 15:25480343-25480365 TAGGGAGTCAGGGGGTGGGGAGG + Intergenic
1124439169 15:29674722-29674744 GAGGGGGTGTGGAGGAGGGAAGG + Intergenic
1124957753 15:34370852-34370874 GAGGGGGAAAGGAGGAGGGAGGG - Intergenic
1125082401 15:35690499-35690521 TAGAGGGTCGGGGGAAGGGATGG + Intergenic
1125477865 15:40059765-40059787 TAGTTGGACAAGCGGAGGGACGG + Intergenic
1125550608 15:40541729-40541751 TAGGGGGTGAGCAGGAGTGAGGG - Intronic
1125680917 15:41529704-41529726 TTGGGGGCCAGGCAGAGTGATGG + Intronic
1126516335 15:49542498-49542520 TAGGGACTCAGGGGGAAGGATGG - Intronic
1128363808 15:66982533-66982555 TATGGGGTCAGGAGTAGAGAGGG + Intergenic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1129222019 15:74136548-74136570 TAGGGGGGCGGGCGGGGGGGCGG + Exonic
1129685145 15:77681744-77681766 TGAGGGGACAGGTGGAGGGAGGG + Intronic
1129829914 15:78661945-78661967 TGGGGCTTCAGGGGGAGGGAGGG - Intronic
1130098950 15:80877434-80877456 TTGGGGGTGAGGAGGTGGGAAGG - Intronic
1130763116 15:86841322-86841344 TAAGGGGTCAGGGGCAGTGAGGG + Intronic
1130862117 15:87900355-87900377 AATGGGGACAGGCAGAGGGAAGG + Intronic
1131513556 15:93063114-93063136 GATGGAGGCAGGCGGAGGGAAGG + Intronic
1131544848 15:93307627-93307649 TTGGAGGTGATGCGGAGGGACGG + Intergenic
1132227195 15:100151591-100151613 CAGGTGGTCAGCCTGAGGGAGGG - Intronic
1132332443 15:101022238-101022260 TACTGGATCAGGGGGAGGGAAGG - Intronic
1132664593 16:1075858-1075880 TAGGGGGAGAGAGGGAGGGAGGG - Intergenic
1132989812 16:2786889-2786911 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989873 16:2787083-2787105 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989916 16:2787217-2787239 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989961 16:2787353-2787375 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1134849197 16:17467153-17467175 TAGGGCGGCAGGCGGGGGGTGGG + Intronic
1135221873 16:20621239-20621261 TGGGGGTTCAGGTGGGGGGAGGG - Intronic
1135234924 16:20746309-20746331 TAGGTGATCAGACTGAGGGATGG - Intronic
1135236222 16:20759070-20759092 TAGGGGTTCAGGATGAGGGCTGG + Intronic
1136240045 16:28937985-28938007 TTGGGGGTCAGGATGGGGGATGG - Intronic
1136296859 16:29308846-29308868 CAGAGGGACAGGCAGAGGGATGG - Intergenic
1137373361 16:47929428-47929450 GAGGGGGTCAGGGGCAGGGGTGG + Intergenic
1137464680 16:48697480-48697502 GAGGGGGTAAGGTGGATGGAGGG + Intergenic
1138013174 16:53402757-53402779 TGGGGGGAGGGGCGGAGGGATGG + Intergenic
1138111309 16:54326376-54326398 TAGGGAGTGAGGAGGAGGGAAGG - Intergenic
1138644928 16:58417841-58417863 TTGGGGGTGAGGCAGAGAGAAGG - Intergenic
1139387926 16:66586158-66586180 TAGGAAGTCAGGCCGAGGGCAGG + Intronic
1140486288 16:75296183-75296205 TGGGAGATCAGGTGGAGGGAAGG + Intronic
1140709214 16:77660889-77660911 CAGGGGCTGAGGGGGAGGGAGGG + Intergenic
1142058453 16:88015099-88015121 CAGAGGGACAGGCAGAGGGACGG - Intronic
1142172255 16:88628872-88628894 TAGGGGGCAGGGCAGAGGGACGG + Intronic
1142405221 16:89884842-89884864 GAGGGCGTCAGGCAGACGGAGGG - Intronic
1142707018 17:1701761-1701783 GAGGGGGGCGGGCGGAGGGGAGG + Intergenic
1142742997 17:1941591-1941613 TCGGGGGCCAGGCGGTGGGGGGG + Intronic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144778103 17:17795026-17795048 TTTGGGGTCAGGCGTAGCGAAGG - Exonic
1144899176 17:18568500-18568522 GATGGAGGCAGGCGGAGGGAAGG - Intergenic
1144938285 17:18917740-18917762 TAGGGGAAGAGGAGGAGGGAGGG + Intronic
1145400129 17:22524998-22525020 TAGGGGGTTAGGTATAGGGAGGG - Intergenic
1146796812 17:35787424-35787446 AAGGGAGTCAGGCAGAGGGAAGG - Intronic
1147360009 17:39924528-39924550 TAGGGGGTGAGGCTGGGGGATGG - Intronic
1147384685 17:40074295-40074317 AAGGGGGGCGGGCGGTGGGAGGG - Exonic
1147390709 17:40107562-40107584 TAGAGGGCCAGGCAGATGGAAGG + Intergenic
1147574734 17:41592608-41592630 TAGGGGGTCGGGGGTGGGGACGG + Intergenic
1148085847 17:44993425-44993447 TAAGGGTCCAGGCAGAGGGAAGG - Intergenic
1148202268 17:45757025-45757047 GAGGAGGTCAGGTGGAGAGAGGG - Intergenic
1148273715 17:46284163-46284185 AAGGGTGTCAGGCTGGGGGACGG + Intronic
1148561598 17:48609893-48609915 TAGAGAGGCAGGTGGAGGGAGGG - Intronic
1148563817 17:48621438-48621460 TAGGGGAGCAGGGGGAGGAACGG + Exonic
1149312421 17:55407612-55407634 TATGTGTTCAGGAGGAGGGAAGG + Intronic
1149711837 17:58750481-58750503 CAGGGGTTCTGGGGGAGGGAGGG - Intergenic
1150001260 17:61442075-61442097 TTTGGGGGCAGGGGGAGGGAAGG - Intergenic
1150065472 17:62105386-62105408 TTGGGGGTGAGGGTGAGGGAAGG - Intergenic
1150455472 17:65303694-65303716 TAGGGGGTGGGAGGGAGGGAGGG + Intergenic
1151338921 17:73457293-73457315 GAGGGGGGGAGGGGGAGGGAGGG - Intronic
1151405744 17:73885012-73885034 TAGAGGGTCAGGCAGAGGCTGGG + Intergenic
1151541727 17:74768082-74768104 GAGGGGGTCCTGAGGAGGGAGGG - Intronic
1151932465 17:77241292-77241314 CAGGGGGTGCGGCGGGGGGAGGG + Intergenic
1152285389 17:79409770-79409792 CATGGGGTCAGGCTGGGGGATGG + Intronic
1152435079 17:80271509-80271531 GTGGGGATCAGGCAGAGGGAAGG + Intronic
1153447325 18:5188509-5188531 AAGGGGCTCAGGGGGAAGGATGG - Intronic
1153926796 18:9841729-9841751 TTGGGGGACAGGCAGAGGGAGGG + Intronic
1154031203 18:10755904-10755926 TAGAGGGTGAGGAGGAGGGATGG + Intronic
1154031275 18:10756196-10756218 AAGGGGATAAGGAGGAGGGATGG + Intronic
1154347894 18:13558877-13558899 TAGAGGGGCAGGGGGAGGGCTGG - Intronic
1155079158 18:22390378-22390400 TAGGGGGTGGGGTGGAGGGAGGG + Intergenic
1157595259 18:48860192-48860214 TAGGGGGTCAGGCGCAGCGGGGG + Exonic
1157616143 18:48988862-48988884 TGGGGGCTCAGACGGAGTGAAGG + Intergenic
1159206971 18:65265434-65265456 TTGGGGGTCTAGGGGAGGGAGGG + Intergenic
1159958916 18:74540505-74540527 CAGGGGGCCAGGCTGAGGCAGGG - Intronic
1160150299 18:76392844-76392866 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150308 18:76392867-76392889 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150317 18:76392890-76392912 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150327 18:76392913-76392935 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150336 18:76392936-76392958 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150345 18:76392959-76392981 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150355 18:76392982-76393004 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150364 18:76393005-76393027 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150373 18:76393028-76393050 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150382 18:76393051-76393073 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150392 18:76393074-76393096 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150402 18:76393097-76393119 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150411 18:76393120-76393142 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150420 18:76393143-76393165 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150449 18:76393212-76393234 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150466 18:76393263-76393285 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150475 18:76393286-76393308 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150485 18:76393309-76393331 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150494 18:76393332-76393354 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150504 18:76393355-76393377 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150513 18:76393378-76393400 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150522 18:76393401-76393423 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150560 18:76393498-76393520 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150608 18:76393613-76393635 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150636 18:76393682-76393704 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150645 18:76393705-76393727 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150673 18:76393774-76393796 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150682 18:76393797-76393819 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150719 18:76393894-76393916 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150728 18:76393917-76393939 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150738 18:76393940-76393962 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150747 18:76393963-76393985 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150764 18:76394001-76394023 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150773 18:76394024-76394046 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150782 18:76394047-76394069 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150820 18:76394144-76394166 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150857 18:76394241-76394263 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150866 18:76394264-76394286 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150876 18:76394287-76394309 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150885 18:76394310-76394332 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150895 18:76394333-76394355 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150904 18:76394356-76394378 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150914 18:76394379-76394401 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150923 18:76394402-76394424 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150932 18:76394425-76394447 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150970 18:76394522-76394544 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150998 18:76394591-76394613 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160151026 18:76394660-76394682 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160151035 18:76394683-76394705 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160151064 18:76394752-76394774 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160553522 18:79711459-79711481 CAGGAGGGCAGGCGTAGGGACGG + Intronic
1160703498 19:518722-518744 TAGAGGGTGAGGAGGAGGGGAGG + Intronic
1160941407 19:1621972-1621994 TGGGGGGTCAGGCAGGAGGAGGG + Intronic
1161114408 19:2488835-2488857 CAGGGGGTGAGGTGGAAGGAAGG - Intergenic
1161241245 19:3225028-3225050 TGGGGTGGGAGGCGGAGGGAGGG - Intronic
1161793263 19:6373250-6373272 AGGGGGGTCGGGCGCAGGGATGG + Intronic
1161847317 19:6719137-6719159 GAGGGGCTCAGGAGGAGGGGGGG + Intronic
1161978174 19:7617519-7617541 TAGAGGGTGAGGCAGTGGGAGGG - Intronic
1162059477 19:8086002-8086024 TGGGGGGACAGGCAGTGGGAGGG + Intronic
1162440064 19:10687310-10687332 CAGTGGGTCAGGCGGAGGACGGG - Intronic
1163028387 19:14527687-14527709 CAGGGGAGCAGGCGGAGGCAAGG - Intronic
1163682295 19:18690080-18690102 TTGGGGGTGAGGGGAAGGGAAGG + Intronic
1163919700 19:20276982-20277004 ATGGGGGTCAGGCTGGGGGATGG - Intergenic
1164914305 19:32038083-32038105 GAGGGGGGCAGGAGGAGGGCAGG + Intergenic
1165445886 19:35856641-35856663 CAAGGGGTGAGGAGGAGGGAAGG - Intronic
1165856438 19:38881363-38881385 GAGGGGGTCAGGGGGAGGAGGGG + Intronic
1165935185 19:39384664-39384686 TTGGGGCCCAGGTGGAGGGAGGG + Exonic
1166075626 19:40412262-40412284 TAGGGGGTCAGGGGGAGTTAAGG + Intronic
1166126956 19:40720699-40720721 GAGGGGGTCAGGAGGAGGGAAGG - Intronic
1166357007 19:42233240-42233262 CAGGGGGTGGGGCTGAGGGATGG - Intronic
1167070960 19:47221734-47221756 CAGGGTGTCAGGAGGTGGGAGGG + Exonic
1167160894 19:47766449-47766471 TAGAGGGTGAGCAGGAGGGAAGG + Intergenic
1167541256 19:50088941-50088963 TAGGGGTTTGGGAGGAGGGAAGG + Intergenic
1167628837 19:50610545-50610567 TAGGGGTTTGGGAGGAGGGAAGG - Intergenic
1167649675 19:50722489-50722511 GAGGGGCTCAGGAGGAAGGAGGG + Intergenic
1168346693 19:55653258-55653280 TGGGTGGTCAGGCGGGAGGACGG + Intergenic
1168517211 19:57017921-57017943 GAGGGGATCAGAGGGAGGGAAGG - Intergenic
925046045 2:773789-773811 TTGGGGGGCAGGCTGGGGGACGG - Intergenic
925969628 2:9097191-9097213 TTGGTGATCAGTCGGAGGGAAGG + Intergenic
926090865 2:10048377-10048399 ACAGGGGGCAGGCGGAGGGAGGG - Exonic
926295493 2:11565746-11565768 TAGGGGGTCATGGGGAGGACTGG - Intronic
926846100 2:17140734-17140756 CAGGGATTCAGGAGGAGGGAAGG + Intergenic
927928106 2:27026923-27026945 CAGGGGGTCAGGGAAAGGGAGGG + Exonic
928529137 2:32172941-32172963 TAGGAGGGAAGGCGGAGTGATGG - Intronic
929745262 2:44650429-44650451 TTGTGGGTTAGGTGGAGGGAAGG + Intronic
929929255 2:46239476-46239498 TGGGGCTTCAGGAGGAGGGAGGG - Intergenic
931857056 2:66313933-66313955 AAGGGGGTGAGGTGGGGGGAGGG - Intergenic
932341061 2:70962939-70962961 TGGGGTGTCAGGCTTAGGGAGGG - Intronic
932736904 2:74260643-74260665 TAGGAGGTGAGGAAGAGGGAGGG - Intronic
933529927 2:83495420-83495442 TAGGGTGGGAGGAGGAGGGAGGG + Intergenic
937294023 2:120798962-120798984 CAGGGTGTGGGGCGGAGGGATGG - Intronic
937996911 2:127701297-127701319 AAGAGGGTCAGGCGCTGGGAGGG + Exonic
938135703 2:128754917-128754939 TTGGGGGTCAGGTGAAGAGATGG - Intergenic
938270663 2:129967566-129967588 TCAGGGGCCAGGTGGAGGGAAGG + Intergenic
938690117 2:133779977-133779999 TAGAAGGTGAGGGGGAGGGAGGG + Intergenic
940138490 2:150465839-150465861 CAGAGGGTCAGGCAGAAGGATGG - Intergenic
941042828 2:160642599-160642621 GTGGGGGGCAGGGGGAGGGATGG - Intergenic
941773989 2:169371932-169371954 GTGGGGGGCAGGAGGAGGGAGGG + Intergenic
943697809 2:190955271-190955293 TTGGGGGTCAGGGTAAGGGAGGG - Intronic
944867841 2:203879978-203880000 TCGGGGGTGAAGAGGAGGGAGGG + Intergenic
946002159 2:216491446-216491468 TAGGAGGTAGGGCTGAGGGAGGG - Intergenic
946140751 2:217688605-217688627 CAGGAGGTCAGAGGGAGGGATGG + Intronic
946308197 2:218868110-218868132 AAGCTGGTCAGGGGGAGGGATGG - Intronic
946352362 2:219163577-219163599 AAGGGGGTCAGGAGGAGTCAAGG + Intronic
946417282 2:219546431-219546453 GAGGGGGTCAGAGGGATGGAAGG - Intronic
946996670 2:225400344-225400366 GAGGGAGTCAGGGGCAGGGAGGG + Intergenic
948197793 2:236108126-236108148 TAGGGGGTCAGGCGGAGGGACGG - Intronic
1168766033 20:381916-381938 AGGGGGGTGAGGCAGAGGGAAGG - Intronic
1169189184 20:3646521-3646543 TGGAGGGGAAGGCGGAGGGAGGG + Intronic
1169260109 20:4131498-4131520 CAGGGGCTCTGGAGGAGGGAGGG + Intronic
1169770571 20:9195653-9195675 TAGGAGGTCAGGAGGATTGATGG - Intronic
1169981142 20:11385216-11385238 CAGTGGATCAGGCGGAGTGAGGG + Intergenic
1170134559 20:13058572-13058594 TGGGGGGTGAGGCAGAGGGGAGG + Intronic
1170710402 20:18785728-18785750 TCAGGGGTTAGGAGGAGGGAAGG - Intergenic
1170868688 20:20184523-20184545 TAGGGGGTCAGGGTCAGGGAGGG + Intronic
1172107864 20:32527513-32527535 AAGGGGGTGAGAGGGAGGGAAGG - Intronic
1173319158 20:41971928-41971950 TATTGGGTCAGGGAGAGGGAGGG - Intergenic
1173380297 20:42533806-42533828 TAGGGACTGAGGCTGAGGGAGGG - Intronic
1173787122 20:45802089-45802111 TAGGGGAGCAGACGGAGAGAGGG + Intronic
1173837658 20:46136345-46136367 TTGGGGGTCAGGAGGAGGAAGGG + Intergenic
1174501656 20:50989370-50989392 TAGGGAGTCAGGAGGAGGCAGGG + Intergenic
1175966255 20:62661574-62661596 TGGGGGGTCATGGTGAGGGAAGG - Intronic
1176057151 20:63154858-63154880 GAGGGAGTCGGGAGGAGGGAGGG - Intergenic
1176100359 20:63361712-63361734 TAGGGGATCCGGCGCAAGGAGGG + Intronic
1176119989 20:63450074-63450096 GAGGGGGTGAGGCGGGGTGAGGG - Intronic
1176126947 20:63479828-63479850 GAGGGCGTCAGGAGGAGGGCAGG + Intergenic
1176974554 21:15305181-15305203 TAGGGGCTCAAGGGGAGGGAGGG - Intergenic
1178102948 21:29289958-29289980 TAGGGGGTCAGGCCTTTGGAAGG - Intronic
1179223662 21:39432665-39432687 TTGGGAGTGAGGCGCAGGGAAGG - Intronic
1179485987 21:41711071-41711093 CTGGGGGTGAGGCAGAGGGAGGG - Intergenic
1180058988 21:45375084-45375106 TGGGGTGTCAGGCGGGGGGTGGG + Intergenic
1180160308 21:45996200-45996222 AAGGGGGCCAGGAGGAAGGATGG - Intronic
1181139314 22:20792466-20792488 TATGGGGTGAGGAGGAGGGAAGG + Intronic
1181237666 22:21457464-21457486 AAGGGTGTGAGGCGGAGGGGAGG + Intergenic
1182864564 22:33592103-33592125 AAGGGGGACAGAGGGAGGGAGGG + Intronic
1182921049 22:34079550-34079572 TAGGGGTGCAGGAGGAGGGTGGG + Intergenic
1183663703 22:39235515-39235537 TGGGGTGCCAGGAGGAGGGAGGG - Intronic
1183676677 22:39302769-39302791 TGGGGGCTCAGGCTGAGGGAGGG - Intergenic
1184182153 22:42836987-42837009 TTGGGGGACATGGGGAGGGAAGG - Intronic
1184582467 22:45426750-45426772 TAGGGGCTGAGGGGGAAGGAAGG + Intronic
1184898694 22:47429683-47429705 GAGGGGTCCAGGCAGAGGGAGGG + Intergenic
1184947423 22:47813473-47813495 TAGGAGGTCAGGCTGCGTGAGGG + Intergenic
951767844 3:26220067-26220089 GTGGGGGACAAGCGGAGGGATGG - Intergenic
951981912 3:28575707-28575729 GAGGGGGTAAGGCTGAGGGTCGG + Intergenic
952255983 3:31696144-31696166 CAGGGGGGCAGGCAGAGAGAGGG - Intronic
953202510 3:40790145-40790167 TTGGGGGTGAGGCTGATGGAGGG + Intergenic
953510606 3:43534525-43534547 AAGGGGGTTGGGGGGAGGGAGGG + Intronic
953928270 3:46993348-46993370 GAGGGGGTCAGGGGTTGGGAGGG - Intronic
954063515 3:48088590-48088612 GAGGGGGCCAGGCGGGGGGCTGG - Intronic
955132850 3:56188056-56188078 TAGGGTGACAGGGGGAGGAAAGG + Intronic
955231890 3:57106888-57106910 TTGGGGGTAAGGTGGAGGCAGGG - Intronic
955663789 3:61328791-61328813 TAGGGTGGCTGGCGGATGGAGGG + Intergenic
956167729 3:66408970-66408992 GAGGGGGGGAGGAGGAGGGAAGG + Intronic
958761689 3:98316705-98316727 GAGGGTGTCGGGCTGAGGGATGG + Intergenic
959102189 3:102023401-102023423 TAGGGGGTCAGGAGCAGAAAGGG + Intergenic
961503526 3:127355005-127355027 TAGGGGGAGAGAGGGAGGGATGG - Intergenic
961545264 3:127629013-127629035 GGGGGGGACGGGCGGAGGGACGG + Intergenic
963214394 3:142728199-142728221 CATGGGGTTAGGGGGAGGGATGG + Intronic
963397915 3:144757157-144757179 TGGGGGGCCAGGGGGTGGGAGGG - Intergenic
964341072 3:155708938-155708960 CAGGGGCTAAGGGGGAGGGAGGG - Intronic
964436412 3:156658484-156658506 TAGGGGGTGGGGAGAAGGGATGG + Intergenic
965463627 3:169000003-169000025 TGGGGGGAGAGGAGGAGGGAGGG + Intergenic
968479523 4:827070-827092 TCGGGAGCCAGGCGGCGGGAGGG + Intergenic
968511508 4:997738-997760 ATGGGGGCCAGGCGGAGGGTGGG + Intronic
968726449 4:2250088-2250110 TAGGTGGACAGACGGACGGATGG + Exonic
969091197 4:4695266-4695288 TTGGGGGTCTGGGGTAGGGAAGG - Intergenic
969433937 4:7173162-7173184 TAGGGGGTCAGGAGTGTGGACGG + Intergenic
969543348 4:7807868-7807890 ATGGTGGTCAGGAGGAGGGATGG - Intronic
970159604 4:13175682-13175704 TAGGGGGTGTGGAGGAGGTAAGG - Intergenic
970504499 4:16713716-16713738 TAGTGGGACAAGAGGAGGGATGG + Intronic
971642901 4:29158260-29158282 TAGGGGGTCAGTTTTAGGGAGGG + Intergenic
973565677 4:52184825-52184847 TGGGGGGGCAGGTGGAGGCAGGG - Intergenic
974397830 4:61362400-61362422 TTGGGGGACAGGTGGAGGGGTGG - Intronic
975786966 4:77900990-77901012 TAGGGGGTAAGGGAGGGGGAAGG + Intronic
976153845 4:82121192-82121214 GAGGGGGTGAGAGGGAGGGAGGG + Intergenic
976226089 4:82797028-82797050 TAGGGGGTGTGGCTCAGGGAGGG - Intronic
976613088 4:87049783-87049805 GAGGGGGTCAGACAGATGGAGGG + Intronic
977287028 4:95120781-95120803 GAGGGGAGCAGGGGGAGGGAAGG - Intronic
977319132 4:95489106-95489128 GAGGGGGAGAGGAGGAGGGAGGG + Intronic
977706241 4:100074085-100074107 TCAGGGGTCAGGGGGAGGGAGGG - Intergenic
978886582 4:113772600-113772622 CACGGGGTCAGGGGGAGGGCAGG - Intergenic
980562978 4:134501948-134501970 AAGGGGGGCAGGCGGGGGGCTGG - Intergenic
981300844 4:143184827-143184849 GAGGCGGACAGGCGGAGGGGCGG + Intergenic
981570797 4:146148613-146148635 GAGTGGGGCAGGCAGAGGGAGGG + Intergenic
981616242 4:146647784-146647806 TAGGTGGTGAGTCGGAGGGTGGG - Intergenic
984364945 4:178786299-178786321 TAGGGGGTGTGGTGGGGGGAGGG + Intergenic
986548580 5:8926835-8926857 TGGGGGGTCAGGAGGAAGTAGGG + Intergenic
986739852 5:10696329-10696351 TAGGGGGTGTGGCGGGGGGGAGG + Intronic
986865097 5:11976837-11976859 AAGGGGGACAGGAGGAGGGAAGG - Intergenic
986994146 5:13586939-13586961 CAGGGGGTGGGGTGGAGGGAGGG - Intergenic
987336941 5:16905414-16905436 CAGGGGGACAGCTGGAGGGAAGG + Intronic
990052761 5:51528271-51528293 TAGGGGGTGAGGAGTAGGGAGGG + Intergenic
992605157 5:78448066-78448088 GAGGGGGAAAGGAGGAGGGAGGG - Intronic
993283554 5:85959931-85959953 AGGGTGGGCAGGCGGAGGGAAGG - Intergenic
993521234 5:88904264-88904286 TAGGGGGTCGGGAGGGGGGAGGG - Intergenic
994028916 5:95118018-95118040 CAAGGGGTGAGGTGGAGGGAGGG + Intronic
994086902 5:95768884-95768906 GTGGGGGAGAGGCGGAGGGAGGG + Intronic
996091877 5:119359277-119359299 AAGGAGGTCAGGTGGAGAGAAGG - Intronic
996506060 5:124268808-124268830 TAGGGGTTCAGGGGGAGGGAGGG - Intergenic
996871862 5:128201215-128201237 TGGGGGGTGAAGGGGAGGGAAGG - Intergenic
997472617 5:134125139-134125161 GAAGGGGTCATGGGGAGGGAGGG + Intronic
998375418 5:141687280-141687302 CCTGGGGTCAGGGGGAGGGAAGG + Intergenic
998792220 5:145777811-145777833 TTGGGGGCCAGGGGGTGGGAAGG + Intronic
999404331 5:151293752-151293774 GAGGGGGAGAGGAGGAGGGAGGG + Intronic
1000593385 5:163185556-163185578 TAGCGGGTCAGGAGGAAGGAAGG + Intergenic
1001586103 5:172834655-172834677 GAGGGGGCTCGGCGGAGGGAAGG - Intronic
1001706035 5:173741734-173741756 TAGGGGGACAGGGGGAGAGGGGG + Intergenic
1002352537 5:178593060-178593082 CATGGGGTCATGGGGAGGGATGG - Intergenic
1002888841 6:1317119-1317141 GAGGGGGGCGGGAGGAGGGATGG - Intergenic
1002888879 6:1317194-1317216 GAGGGGGGCGGGAGGAGGGATGG - Intergenic
1004395734 6:15245393-15245415 GAGGGGGCGAGGAGGAGGGAGGG + Intergenic
1004395812 6:15245673-15245695 AAGGGGGTGAGGTGGAGCGACGG + Intergenic
1005666430 6:28062291-28062313 TAGGGTGTCCAGAGGAGGGAGGG + Intergenic
1006578567 6:35063400-35063422 AAGGGCGTCAGGCTGAGTGAAGG - Intronic
1006623148 6:35381210-35381232 CTGGAGGTCAGGAGGAGGGAAGG - Intronic
1007408110 6:41646317-41646339 TAGGGGGCCAGGAGGTTGGATGG + Intronic
1007620735 6:43212969-43212991 CAGGGAGGCAGGCGCAGGGAAGG + Intronic
1007874834 6:45084957-45084979 TAGGAGGTAAGAGGGAGGGAGGG + Intronic
1008512051 6:52284944-52284966 CAGTGAGTGAGGCGGAGGGAGGG - Intergenic
1010376999 6:75182347-75182369 TGGGGGGGCTGGGGGAGGGATGG - Intronic
1011186438 6:84681821-84681843 GAGGGCGTAAGGCAGAGGGAGGG + Intergenic
1011705475 6:89996725-89996747 CAGAGGTTCAGGTGGAGGGAAGG - Intronic
1012556659 6:100521767-100521789 TAGGGGCTAAGGCCAAGGGATGG + Intronic
1013267340 6:108512663-108512685 TAGGGGGTGGGACTGAGGGATGG - Intronic
1013337707 6:109181654-109181676 CAGGTGGCCAGGCAGAGGGATGG - Intergenic
1013490831 6:110644789-110644811 AAGGGGGCCAGGGGGAGGGGAGG + Intronic
1013608538 6:111773378-111773400 GAGGGGGGGAGGGGGAGGGAGGG + Intronic
1014107335 6:117582252-117582274 TAGGGGGGGAGGCAGAGGGAGGG - Intronic
1015226933 6:130868734-130868756 TTGGGAGTTAGGCTGAGGGAGGG - Intronic
1016119742 6:140331193-140331215 TAGGGGGTCACTAGGAGTGATGG + Intergenic
1016330225 6:142946382-142946404 CGGGGGGAGAGGCGGAGGGAGGG + Intergenic
1016992799 6:149941662-149941684 TCGCGGCGCAGGCGGAGGGAGGG + Intergenic
1016995574 6:149960573-149960595 TGGGGGGTCAGGAGGAAGGGAGG - Intergenic
1017163822 6:151390368-151390390 GAGGGGCTGAGGGGGAGGGAGGG + Intronic
1018998615 6:168729029-168729051 TAGGAGATTAGGGGGAGGGAAGG - Intergenic
1019315092 7:380579-380601 CAGGGGGACAGAGGGAGGGAGGG + Intergenic
1019315107 7:380609-380631 CAGGGGGACAGAGGGAGGGAGGG + Intergenic
1019315122 7:380639-380661 CAGGGGGACAGAGGGAGGGAGGG + Intergenic
1019336227 7:484364-484386 TTGGGGGTACGGCAGAGGGACGG - Intergenic
1019421161 7:952018-952040 GAGGGGGTTTGGGGGAGGGAGGG - Intronic
1019522221 7:1466173-1466195 CAGCAGGGCAGGCGGAGGGAAGG - Intergenic
1020331764 7:7025383-7025405 TAGGGGATGAGGCAGAGGGAGGG - Intergenic
1020531769 7:9346905-9346927 TAGGTGGTCATGAGGTGGGAGGG + Intergenic
1021276943 7:18663448-18663470 TGGGGGGTGAGGGGGAGGGAGGG - Intronic
1021867237 7:24970486-24970508 TAGGAGCTCAGGAGGAGTGAGGG - Intronic
1022317882 7:29262778-29262800 TGGGGGTGCAGGGGGAGGGAGGG + Intronic
1022829993 7:34056235-34056257 TGGGGGGTAGGGTGGAGGGAGGG + Intronic
1022989639 7:35694990-35695012 TGAGGGGTCAGGCGGAGAGCCGG - Exonic
1023991211 7:45129979-45130001 AAGGGGGTCAGGCTGTGGCAGGG - Intergenic
1024977521 7:55127447-55127469 TGGGGGGTGAGGGGGTGGGAAGG - Intronic
1025002746 7:55331135-55331157 TAGGGGGTCAGAGAGTGGGAGGG - Intergenic
1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG + Intergenic
1026933402 7:74237862-74237884 TAGGGTGTCAGGCTGAGGCTGGG - Intronic
1027502964 7:78978475-78978497 GAGGGGTTCAGGAAGAGGGAGGG + Intronic
1029494616 7:100890171-100890193 TAGGGGGCCGGGCGGAGCGGAGG + Exonic
1029707049 7:102281734-102281756 TAGGGTGGCAAGGGGAGGGAAGG - Intronic
1032428121 7:131838150-131838172 CAGGGGGTGAGACGGACGGAGGG - Intergenic
1034272711 7:149811177-149811199 GTGGGGGACAGGGGGAGGGAGGG - Intergenic
1035171834 7:157021492-157021514 TTGGGGCTGAGGCGGAGGGCGGG - Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036989376 8:13575431-13575453 TAGGGGGTGGGGCCGAGGGGAGG + Intergenic
1037998416 8:23369803-23369825 TAGGGGGTCAGGCTGTGCGTTGG - Intronic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1039423894 8:37469452-37469474 TAGGGTGGAAGGCGGAAGGAGGG - Intergenic
1039921445 8:41896760-41896782 GAGGGAGGGAGGCGGAGGGAGGG - Exonic
1041163868 8:55072292-55072314 CAGGGGGTCAGGGGGGGGGGTGG + Intergenic
1042346949 8:67737191-67737213 GAGGGAGTCAGGAGGCGGGAGGG - Intronic
1042527346 8:69777394-69777416 GAGGAGGTCAGGCGGAAGGAGGG + Intronic
1043019361 8:74982286-74982308 TTGGGGGTAAGGAGGAGGGTTGG - Intergenic
1044014190 8:87030914-87030936 AAGGGGGGCAGGAGGAGGGGGGG - Intronic
1044430371 8:92101634-92101656 TTGGGGGAGAGGGGGAGGGAAGG + Intronic
1045508545 8:102795441-102795463 AGGGGGGTCAGGTGGAGGGAGGG + Intergenic
1046561259 8:115840444-115840466 TAGGGGGTCAGTGGAAGGAAAGG + Intergenic
1048020902 8:130538142-130538164 CAGGGGTTCAGCAGGAGGGAGGG - Intergenic
1048988734 8:139749148-139749170 CAGGGAGTCAGCAGGAGGGAGGG - Intronic
1049202032 8:141345033-141345055 TTGGGGGCCAGCCTGAGGGAAGG - Intergenic
1049718820 8:144106242-144106264 GTGAGGGTCAGGTGGAGGGAAGG + Intronic
1050388477 9:5113087-5113109 TACGGGGGCAGGGGGAGCGAGGG - Intronic
1051251885 9:15167903-15167925 TAAGGAGTTTGGCGGAGGGAGGG + Exonic
1052973826 9:34397903-34397925 GAGGGGGTCAGGAGCAGGGAGGG - Intergenic
1057673601 9:97118625-97118647 TAGGAGGCCTGGCGGAGGGGGGG + Intergenic
1057948747 9:99352883-99352905 AAGGGGGTGAGGTGGAGGGAGGG - Intergenic
1058537931 9:105981284-105981306 GCTGGGGTCAGGAGGAGGGAGGG - Intergenic
1058611159 9:106777114-106777136 TAGAGGATCAGGCTGAGTGATGG + Intergenic
1059678675 9:116565522-116565544 TGGGTGGGCAGGTGGAGGGAAGG - Intronic
1059758116 9:117312764-117312786 TAGGGGCTGAGGCCCAGGGAGGG - Intronic
1060302292 9:122381760-122381782 CAGGGGGTAGGGCAGAGGGAGGG + Intronic
1061266064 9:129505714-129505736 CAGGGGGTTGGGCGGAGGGCTGG - Intergenic
1062107617 9:134764314-134764336 TAGGGGGTCAGGGGGCGGCATGG + Intronic
1062466301 9:136683060-136683082 TAGGGGGTGGGGGGGAGGGGGGG + Intronic
1185463142 X:341500-341522 GAGGGGGGCAGGAGGAGGGCCGG - Intronic
1186214087 X:7280624-7280646 TTGGGGGTCAGGTGGAAGGATGG + Intronic
1186228009 X:7422205-7422227 CAGGGGGTAGGGTGGAGGGAGGG - Intergenic
1187915508 X:24149691-24149713 TGGTGGGGCGGGCGGAGGGAGGG - Intronic
1188826579 X:34842297-34842319 TTGGGGGGCAAGGGGAGGGAGGG + Intergenic
1190473318 X:50804458-50804480 TTGGGGGACAGACGGAGGGAGGG - Intronic
1191807489 X:65150481-65150503 TGGGGGGTCGGGGGCAGGGAAGG - Intergenic
1192213973 X:69145079-69145101 TGGGGGGTGAGGAGGAGGGAGGG + Intergenic
1192886824 X:75344322-75344344 TTGGGGGACAAGTGGAGGGAGGG - Intergenic
1194900867 X:99510153-99510175 TTGGGGGGCATGCGGAGGGAGGG - Intergenic
1195689227 X:107610231-107610253 TTGGGGGGCAGGGGCAGGGAAGG - Intergenic
1196742012 X:119033436-119033458 AAGGGGGTGAGCTGGAGGGATGG - Intergenic
1196765296 X:119236825-119236847 TAGGCGGGCAGGCGGAGAGCCGG + Intronic
1198051392 X:132956341-132956363 TAGGGGGGAAAGCGGGGGGAGGG + Intronic
1198788617 X:140317897-140317919 GAGGGAGTCAGGTGGAAGGAAGG + Intergenic
1198960322 X:142175592-142175614 TTGGGAGTCAGCCGGAGGGGAGG - Intergenic
1199411476 X:147528617-147528639 TGGGGGGGGAGGAGGAGGGAGGG - Intergenic
1199735548 X:150682883-150682905 CAGGGGTTCAGGGAGAGGGAGGG + Intergenic
1199795924 X:151196761-151196783 GTGGGGGTCAGGTGGGGGGATGG - Intergenic
1200179265 X:154140544-154140566 GAGGGGGTGAGGGGGTGGGATGG - Intergenic
1200287363 X:154836349-154836371 GAAGGGGTCAGGCAGATGGAAGG + Exonic