ID: 948201337

View in Genome Browser
Species Human (GRCh38)
Location 2:236131465-236131487
Sequence GTGTATCCACAGATGGGTTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948201329_948201337 30 Left 948201329 2:236131412-236131434 CCAGTTTTCTGTTTCTGTAAATA 0: 1
1: 0
2: 13
3: 140
4: 1220
Right 948201337 2:236131465-236131487 GTGTATCCACAGATGGGTTTAGG 0: 1
1: 0
2: 0
3: 8
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948201337 Original CRISPR GTGTATCCACAGATGGGTTT AGG Exonic
900717524 1:4154515-4154537 GCGTTTCAACATATGGGTTTTGG + Intergenic
901114984 1:6836292-6836314 GAGAAACCACAGATGGGTTGGGG + Intronic
902114561 1:14110684-14110706 TTGTAGCCACAGATGGTTTGTGG - Intergenic
904410915 1:30324419-30324441 GTGTTTCCACTGATGGGCTGTGG + Intergenic
906440242 1:45836877-45836899 GTTTTTCCACAGATGGGTGGAGG + Intronic
910824965 1:91397073-91397095 GTTTTTCCACAGATGGTTTCGGG - Intronic
911747290 1:101453783-101453805 ACGTATCCCCATATGGGTTTGGG + Intergenic
912069093 1:105785672-105785694 GTGTATCTACGTATGTGTTTTGG - Intergenic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
914746292 1:150504025-150504047 GTGTAGCCATAGATGGGTGGTGG + Intronic
915814235 1:158949919-158949941 ATGTAGCCACAATTGGGTTTGGG + Intronic
915947123 1:160161480-160161502 GTGTGTCTAGAGATGGGGTTGGG - Intronic
918385571 1:184004173-184004195 GTTTATCCAAAGAAGGCTTTGGG + Intronic
921467121 1:215502218-215502240 GTGTAGCCAGAGAAGAGTTTGGG + Intergenic
922815114 1:228443313-228443335 GGGCTTCCACAGATGAGTTTGGG - Intergenic
1064716006 10:18177290-18177312 CTTTATCCACAGAGGGTTTTGGG + Intronic
1068785599 10:60969216-60969238 GTATCTGCACAGTTGGGTTTAGG - Intronic
1069605258 10:69735062-69735084 GTGGTTCCACAGTTGGTTTTAGG + Intergenic
1074875850 10:117612839-117612861 GTGATTACACAGATGGGCTTCGG + Intergenic
1078692775 11:13598444-13598466 GTGTATACACACATGGGGGTGGG + Intergenic
1080213468 11:29814904-29814926 GTGTATCCATAGTATGGTTTTGG + Intergenic
1085883994 11:80500576-80500598 TTGTATGCACTGTTGGGTTTTGG + Intergenic
1085996571 11:81923301-81923323 GTGGTTACACAGATGGGGTTAGG - Intergenic
1088875176 11:113929597-113929619 GGGTTTCAACATATGGGTTTTGG + Intronic
1088947992 11:114534270-114534292 GGTTATGTACAGATGGGTTTTGG - Intronic
1089726896 11:120489298-120489320 GTGTATAATCAGATGGGTTTTGG + Exonic
1095089109 12:38087640-38087662 GTGTATACACTCATGGGCTTGGG - Intergenic
1096623533 12:52879289-52879311 GTGTCTCCAAGGAAGGGTTTGGG + Intergenic
1097733159 12:63151780-63151802 CTGTATTCACAGCGGGGTTTGGG + Intergenic
1097811834 12:64027348-64027370 ATGTACCCACAGATAGGTTCAGG + Intronic
1099551529 12:84050866-84050888 GTGTTTCCACAGATGTCTCTTGG - Intergenic
1102104101 12:110305798-110305820 TTGTATCTATAGATGAGTTTGGG + Intronic
1103007545 12:117433883-117433905 GTGCATGCAAAGATGTGTTTAGG - Intronic
1103804428 12:123561280-123561302 TTGTTTCCCAAGATGGGTTTTGG - Intergenic
1104176523 12:126338341-126338363 CTGTATCCACTGATGGTTATCGG + Intergenic
1107112424 13:36712271-36712293 GTGTATATAAAGATGGGTGTGGG - Intergenic
1107826775 13:44335685-44335707 GTGTGTACACAGATGGGCTCTGG + Intergenic
1111415300 13:87933705-87933727 TTTTATCCACAGATGACTTTGGG + Intergenic
1115147414 14:30241410-30241432 GAGCATACACAGATGGGGTTAGG - Intergenic
1115327107 14:32152202-32152224 GTTTTTCCACAGATGGGTGGGGG - Intronic
1118372530 14:65149737-65149759 AGGAATCCACAGAGGGGTTTAGG - Intergenic
1119679047 14:76578156-76578178 GTTTATTCTCATATGGGTTTAGG + Intergenic
1120092740 14:80352268-80352290 CTGTATCCATATCTGGGTTTTGG - Intronic
1121580860 14:95028629-95028651 TTTTATCTACAGATAGGTTTGGG + Intergenic
1121599769 14:95194675-95194697 GGGTTTCCACGTATGGGTTTAGG + Intronic
1123412524 15:20072408-20072430 GTGTTTACACATATGGGGTTTGG + Intergenic
1123507099 15:20953874-20953896 GTGTATAAACACATGGCTTTGGG - Intergenic
1123521866 15:21079521-21079543 GTGTTTACACATATGGGGTTTGG + Intergenic
1123564326 15:21527617-21527639 GTGTATAAACACATGGCTTTGGG - Intergenic
1123600579 15:21964900-21964922 GTGTATAAACACATGGCTTTGGG - Intergenic
1124912880 15:33939744-33939766 GTGTTTCAACAAATGAGTTTTGG - Intronic
1125181208 15:36882483-36882505 GTGTCTCCAAAGATGGGAATGGG + Intergenic
1125487870 15:40124893-40124915 GCCTGTCCACAGATGGGTCTGGG + Intergenic
1126568519 15:50125665-50125687 TTGCCCCCACAGATGGGTTTGGG - Intronic
1127003141 15:54533807-54533829 ATGTGTCCACAGTTGGGATTGGG + Intronic
1127247040 15:57188396-57188418 TTGAATCCACAGATTGCTTTGGG - Intronic
1130762771 15:86837741-86837763 GTGTATCCTCAAAATGGTTTTGG + Intronic
1202972687 15_KI270727v1_random:254725-254747 GTGTATAAACACATGGCTTTGGG - Intergenic
1133108340 16:3529071-3529093 TGGTATCCACAGGTGGGTTCTGG - Intronic
1134312972 16:13093032-13093054 GTATTTCCACAAATGGGTTTTGG - Intronic
1136100040 16:27987315-27987337 GTCTATGGTCAGATGGGTTTAGG + Intronic
1136991749 16:35156310-35156332 CTGAATCCACAGATTGCTTTGGG + Intergenic
1138282559 16:55783269-55783291 GTGTGTCCACAGTTGATTTTCGG - Intergenic
1140476354 16:75241173-75241195 GTGTTTACACATATGGGGTTTGG + Intronic
1142959435 17:3543300-3543322 GGGGAACCACAGAAGGGTTTGGG - Intronic
1144411915 17:15010009-15010031 GTGTATTCACAGGTGTGTTGGGG - Intergenic
1145726206 17:27127923-27127945 GTGTATCCAAAGAAGAGTGTTGG - Intergenic
1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG + Intronic
1148029003 17:44607289-44607311 CTTTATCCACAGATGGGCATTGG - Intergenic
1152769159 17:82156960-82156982 ATGAATCCACAGAAGGTTTTGGG - Intronic
1153991664 18:10406007-10406029 GTGAATCCAAAGCTGGTTTTTGG + Intergenic
1154227736 18:12523007-12523029 GTGATTCCTCTGATGGGTTTGGG + Intronic
1154408116 18:14115297-14115319 GGCTATCCAAAGATGGGGTTTGG + Intronic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1162245122 19:9393588-9393610 TTATATCCACAAATGTGTTTAGG + Intergenic
1163127637 19:15252885-15252907 GTGTGTGCACAGATGGGGTGGGG - Intronic
1164814619 19:31185709-31185731 GTGTAGAGACAGATGAGTTTTGG + Intergenic
1168217314 19:54935899-54935921 TTTTTTCCACAGACGGGTTTGGG - Intronic
926065748 2:9838385-9838407 GTGTCCCCACAGAAGGCTTTTGG + Intergenic
928437888 2:31267616-31267638 GAGTAGCCTCAGAAGGGTTTAGG + Exonic
929551994 2:42900052-42900074 GAGTATCATGAGATGGGTTTGGG + Intergenic
931197770 2:60069104-60069126 GTGTCTCCACAGATAGACTTGGG + Intergenic
931322448 2:61184241-61184263 GTGTTGGCATAGATGGGTTTGGG + Intronic
932143056 2:69296585-69296607 GTGTGTCCACACATGAGTGTAGG - Intergenic
936920332 2:117682125-117682147 GTGATTCCACAGATGGATCTGGG + Intergenic
937205079 2:120231169-120231191 GTGTTTTCACAGATGCCTTTAGG + Intergenic
939201615 2:139042771-139042793 GAGTTTCCACACATGAGTTTTGG - Intergenic
939254301 2:139722560-139722582 GTAAATGCACAGATGGGCTTAGG - Intergenic
944671155 2:201995666-201995688 ATGTTTCCTAAGATGGGTTTGGG - Intergenic
946164542 2:217856057-217856079 TGGGATCCACAGATGGTTTTTGG - Intronic
946190288 2:218004162-218004184 GTGTGTCCACAGGAGGGTGTGGG - Intergenic
948201337 2:236131465-236131487 GTGTATCCACAGATGGGTTTAGG + Exonic
1170666083 20:18387302-18387324 ATGTATCCACAGTTCAGTTTTGG + Intronic
1171793059 20:29546176-29546198 GAGTCTTCACAAATGGGTTTAGG + Intergenic
1172030164 20:31976262-31976284 GTGGTTCCACATGTGGGTTTGGG - Intronic
1172578819 20:36030771-36030793 GTGGGTCCACAGAGGTGTTTGGG + Intergenic
1174556584 20:51399957-51399979 GAGGATCCAGAGATTGGTTTTGG - Intronic
1176105194 20:63382527-63382549 GTTTACCCACACATGGGTCTAGG - Intergenic
1176310925 21:5148434-5148456 GGGTATCCACAGATGAGCTCTGG - Intronic
1178631262 21:34263466-34263488 GGGAATCCATTGATGGGTTTGGG - Intergenic
1179846130 21:44113601-44113623 GGGTATCCACAGATGAGCTCTGG + Intronic
1181107951 22:20585788-20585810 GTCTATCCACAGCGGGCTTTGGG - Exonic
1181712204 22:24697676-24697698 GTGTGTCCTCAGAAGGGGTTTGG - Intergenic
1184078631 22:42201383-42201405 GTGTATCCACAGAATGATTCAGG - Intronic
1184521746 22:44998629-44998651 GTGTACCCAGAGCTGGGATTCGG - Intronic
1184887495 22:47355338-47355360 GAGTAGCCACAGATGGCATTTGG + Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
956618449 3:71196838-71196860 GTGCAGGCACAAATGGGTTTGGG + Intronic
958131170 3:89426096-89426118 ATGTATACCCAGATGTGTTTTGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961115437 3:124325256-124325278 GGGTACCCACAGATGCCTTTTGG + Intronic
962774049 3:138641811-138641833 ATGAATCTACAGATGGTTTTGGG + Intergenic
965273908 3:166655639-166655661 GTGTATCCATTCATGTGTTTTGG - Intergenic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG + Intronic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
971198177 4:24488964-24488986 GTGCATCCAGAGATGGGCCTGGG - Intergenic
975398219 4:73902802-73902824 GGCTATTCACAGATGGGCTTAGG - Intergenic
975728462 4:77315397-77315419 GTGTAAACACAGTTGGGCTTGGG + Intronic
976122876 4:81802073-81802095 ATTTATTCACAGATAGGTTTAGG - Intronic
976355591 4:84113506-84113528 TTGGATCCACAGATTGGTTTGGG + Intergenic
976653707 4:87464377-87464399 ATGTTTCCAGAGATAGGTTTGGG - Intergenic
977020698 4:91755593-91755615 GAGTATCAACAGATGAATTTGGG - Intergenic
978222447 4:106293097-106293119 GTTTATTCACAAATGGGTTGCGG - Intronic
980658160 4:135816761-135816783 TTGAATCTACAGATTGGTTTGGG - Intergenic
982993468 4:162310029-162310051 GTCTATCATCAAATGGGTTTTGG + Intergenic
985859628 5:2460653-2460675 GAGTACCCAGAGAAGGGTTTCGG + Intergenic
986263136 5:6166612-6166634 GTGTATCTTCACCTGGGTTTGGG + Intergenic
988062479 5:26190380-26190402 ATCTATCCATAGATGGGGTTGGG + Intergenic
993371830 5:87102230-87102252 GAGTATCCAGTTATGGGTTTTGG + Intergenic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
994933903 5:106226711-106226733 CTATTGCCACAGATGGGTTTTGG - Intergenic
998210054 5:140189061-140189083 CAGTATCCACAGATTTGTTTTGG + Intronic
998905729 5:146902687-146902709 GGGGAACCACAGATGGCTTTTGG - Intronic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
999374128 5:151074953-151074975 TTGTTTGCAGAGATGGGTTTTGG + Intronic
1001018537 5:168163252-168163274 TTGGAGCCACAGCTGGGTTTGGG - Intronic
1003971815 6:11307417-11307439 GGGTAACCACACATGGGTTCAGG - Intronic
1010711096 6:79175468-79175490 TTGAATCCATAGATGGCTTTTGG - Intergenic
1011217720 6:85022802-85022824 GTGGGTCTACAGATAGGTTTTGG - Intergenic
1012481812 6:99675959-99675981 GGTGATCGACAGATGGGTTTTGG + Intergenic
1014199135 6:118589352-118589374 GAATATCCTCAGATGGCTTTCGG + Intronic
1018707493 6:166473642-166473664 GTATATCCACAGATAGCTTTAGG + Intronic
1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG + Intronic
1018861983 6:167717636-167717658 GTGTATCCAGAGCTGAGTGTAGG - Intergenic
1029024439 7:97401170-97401192 GGGTATCCACAGGAGGTTTTAGG + Intergenic
1031858301 7:126948382-126948404 ATGTACACACAGATGTGTTTGGG + Intronic
1033575251 7:142675506-142675528 GTGTATCACCATATAGGTTTAGG + Intergenic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1035317336 7:158004353-158004375 GTGTGTCCACAGCTGGGTGGTGG + Intronic
1037393928 8:18422498-18422520 GTGCATGAACAGTTGGGTTTTGG - Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1039359798 8:36863692-36863714 GTATATCAACATATGGGTTCAGG + Intronic
1041565273 8:59270313-59270335 GTGTACCGAAAGCTGGGTTTTGG - Intergenic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1048695586 8:137024372-137024394 GTGTCTCGAAAGATGGGTTTGGG + Intergenic
1049182213 8:141228835-141228857 GCACATCCAGAGATGGGTTTGGG - Intronic
1050766072 9:9135395-9135417 GTGTATACACACATCGATTTGGG - Intronic
1055107712 9:72529516-72529538 GTGTATATACATATGTGTTTAGG + Intronic
1055773756 9:79745570-79745592 CTGTCTCCACGGATGAGTTTGGG - Intergenic
1059819778 9:117958872-117958894 GTGGATCCCAAGATAGGTTTAGG - Intergenic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1062389771 9:136329318-136329340 GTGTAGCCACAGCCCGGTTTGGG + Intronic
1186695836 X:12030912-12030934 ATGCCTCCACAGGTGGGTTTGGG + Intergenic
1187530461 X:20091808-20091830 GTCTATCTACAGATTGTTTTTGG - Intronic
1195228326 X:102820863-102820885 GGGTTTCCACATATGAGTTTTGG + Intergenic
1195656522 X:107336647-107336669 GTGACTCCACAGTTGGGGTTTGG + Intergenic
1195960398 X:110380098-110380120 GTGTTTCAACAGATGGGAATGGG + Intronic
1198055204 X:132987360-132987382 TTGGATCCACAGCAGGGTTTGGG + Intergenic
1198510813 X:137349723-137349745 ATGTATCCAGGAATGGGTTTCGG - Intergenic
1198798383 X:140424267-140424289 GAGTATAGACAGATGGGTTTTGG - Intergenic
1199191237 X:144974012-144974034 GGGTATCCAGAGAAGAGTTTAGG - Intergenic
1200021893 X:153218744-153218766 GGGCTTCCACAGATGGATTTTGG + Intergenic
1201769611 Y:17606960-17606982 CTGCATGCACAGATGTGTTTGGG + Intergenic
1201831943 Y:18299025-18299047 CTGCATGCACAGATGTGTTTGGG - Intergenic