ID: 948201627

View in Genome Browser
Species Human (GRCh38)
Location 2:236133582-236133604
Sequence GTGTGTAAGTGGAGGCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 263}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948201627_948201632 -7 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201632 2:236133598-236133620 TACACACCACTGACCAGACTGGG 0: 1
1: 0
2: 0
3: 11
4: 114
948201627_948201633 -4 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201633 2:236133601-236133623 ACACCACTGACCAGACTGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 144
948201627_948201640 16 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201640 2:236133621-236133643 CGGGGTCCCTCAGGGCTGCAAGG 0: 1
1: 0
2: 3
3: 23
4: 242
948201627_948201635 -2 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201635 2:236133603-236133625 ACCACTGACCAGACTGGGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 186
948201627_948201641 17 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201641 2:236133622-236133644 GGGGTCCCTCAGGGCTGCAAGGG 0: 1
1: 0
2: 1
3: 19
4: 197
948201627_948201639 8 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201639 2:236133613-236133635 AGACTGGGCGGGGTCCCTCAGGG 0: 1
1: 0
2: 1
3: 9
4: 169
948201627_948201638 7 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201638 2:236133612-236133634 CAGACTGGGCGGGGTCCCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 179
948201627_948201631 -8 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201631 2:236133597-236133619 TTACACACCACTGACCAGACTGG 0: 1
1: 0
2: 0
3: 4
4: 143
948201627_948201645 25 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201645 2:236133630-236133652 TCAGGGCTGCAAGGGATGCTGGG 0: 1
1: 0
2: 3
3: 23
4: 356
948201627_948201644 24 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201644 2:236133629-236133651 CTCAGGGCTGCAAGGGATGCTGG 0: 1
1: 0
2: 3
3: 27
4: 396
948201627_948201634 -3 Left 948201627 2:236133582-236133604 CCCTCATGCCTCCACTTACACAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 948201634 2:236133602-236133624 CACCACTGACCAGACTGGGCGGG 0: 1
1: 0
2: 0
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948201627 Original CRISPR GTGTGTAAGTGGAGGCATGA GGG (reversed) Intergenic
900839488 1:5036582-5036604 GTCTGTATCTGGAAGCATGAGGG - Intergenic
901124066 1:6917022-6917044 GTGTCTAAGCTGAGACATGAAGG + Intronic
901201863 1:7471726-7471748 GTGAGGTAGAGGAGGCATGAAGG + Intronic
903012282 1:20339677-20339699 ATGTGTAAGTGGAGGCAGGGAGG - Intronic
903380985 1:22896705-22896727 GTGTGTATGGTGAGGCCTGAGGG - Intronic
904676352 1:32201334-32201356 GGGTGGAAGTGGAGGGATGCCGG + Intronic
904858851 1:33520105-33520127 GTGTGCACGTGGAGGCAGGCGGG - Intronic
906140914 1:43532839-43532861 GTGTGGAAATGAAGGCAAGAGGG - Intronic
906561001 1:46756775-46756797 GCGTATAAATGGACGCATGAGGG + Intergenic
906574149 1:46872808-46872830 ATGTGACACTGGAGGCATGAGGG + Intergenic
906597817 1:47095087-47095109 ATGTGACACTGGAGGCATGAGGG - Intronic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
911276130 1:95861607-95861629 GTGTGGAGGTGGAGGCAGGTGGG + Intergenic
912759957 1:112357970-112357992 GTGAGGAAACGGAGGCATGAAGG - Intergenic
913144373 1:115975773-115975795 GTTAGGAGGTGGAGGCATGAGGG + Intergenic
915047011 1:153026270-153026292 GTGTGTATGTGTATGCATGTGGG + Intergenic
915244208 1:154544697-154544719 ATGTGAAAGTGGAGGTAGGAGGG - Intronic
915400761 1:155620041-155620063 GAGTGTTAGTGGAGGAATCATGG + Intergenic
915615320 1:157033326-157033348 GGGGGTATGCGGAGGCATGAAGG - Intronic
916675379 1:167060843-167060865 GTGTGTAGGTGTAGGAATGGTGG - Intronic
917215025 1:172669336-172669358 GTTCGTAAGTGGAAGAATGAAGG - Intergenic
918044444 1:180933283-180933305 GAGTGTAAGAGGAAGCAGGAAGG + Intronic
920687705 1:208121989-208122011 GTGTGCAGGTGGGGGTATGAGGG - Intronic
922481635 1:225943398-225943420 GTGTGTTTGAGGAGGCATGGGGG + Intergenic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
923995250 1:239486424-239486446 GTGTGTATGGGCAGGCATCAGGG - Intronic
1063184992 10:3642610-3642632 GTCTGAAATTGGAGACATGAGGG - Intergenic
1064264550 10:13814849-13814871 GGGGGTAAGTGGAGGCAGGGTGG + Intronic
1066105934 10:32157032-32157054 GTGTAGAATTGGAGGAATGAGGG + Intergenic
1068542897 10:58315100-58315122 GTGTGAAAGTGGATGTTTGATGG + Intergenic
1070092484 10:73301596-73301618 GGGTGGAAGAGGTGGCATGATGG + Intronic
1070547238 10:77462562-77462584 GTGTGTAAGTGCATGTGTGAGGG - Intronic
1073590829 10:104756178-104756200 GTGAGTAAGAGGATGCATGGTGG + Intronic
1074842117 10:117364904-117364926 GAGTGAAAGTGGGGGCAGGAGGG + Intronic
1074921728 10:118021067-118021089 GTGTGTATGTGTAGGCAGGGTGG - Intronic
1075199715 10:120392356-120392378 GTGGGGAAGTGGAGGCAACAGGG + Intergenic
1075973442 10:126674255-126674277 GTGTGAATGTGGTGGCATGGTGG - Intergenic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1079657484 11:23000930-23000952 GTGGGTAGGTGGAGGAATGACGG - Intergenic
1081628945 11:44674404-44674426 GTGTGTGAGTGGGGGTGTGAGGG + Intergenic
1084442027 11:69180034-69180056 GGGTGTAAGTGAAGGCATCAAGG + Intergenic
1084495080 11:69498721-69498743 GTGGGTAGGTGGAGGGATGGAGG + Intergenic
1084616811 11:70241907-70241929 GTGGGTAAGTGGATGGATGGAGG - Intergenic
1085014215 11:73162300-73162322 GTGGTTAACTGGAGGCAAGAAGG + Intergenic
1086725652 11:90180036-90180058 ATGTGTTAGTGTAGGAATGAAGG + Intronic
1089537176 11:119168209-119168231 GTGTGGAAGTGTAGGGATAAGGG + Intronic
1090345157 11:126063242-126063264 GAGCGTGAGTGCAGGCATGATGG - Exonic
1090761927 11:129845287-129845309 GTGTGTGTGTGTATGCATGAAGG + Intronic
1090761932 11:129845357-129845379 GTGTGTGTGTGTATGCATGAAGG + Intronic
1091087161 11:132732634-132732656 GTGTGTAAGGGGAGGCTTCAGGG + Intronic
1091196819 11:133738676-133738698 GTGTGTATGTGGGGACATGTGGG + Intergenic
1091196834 11:133738745-133738767 GTGTGTATGTGGGTGCATGTGGG + Intergenic
1092890972 12:12969024-12969046 CAGTGTGAGTGAAGGCATGAAGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1095039027 12:37422177-37422199 GTGTGTCACTGGAGGCATATGGG + Intergenic
1095658295 12:44697331-44697353 GTGTGTGAGTGGTGTTATGATGG - Intronic
1096370302 12:51063843-51063865 GTGCGGAAGGGGAGGCTTGAGGG + Exonic
1096556083 12:52404857-52404879 GTGAGGAAGGGGAGGAATGACGG - Intronic
1098115591 12:67173099-67173121 GTGTGTTAGTGGGGGGATGAAGG - Intergenic
1100266211 12:92978754-92978776 GTGTGTATGTGTTGGCATGAGGG - Intergenic
1101373517 12:104151605-104151627 GTGTGGAACTGGAGGCATACAGG - Intergenic
1103837056 12:123829969-123829991 GTGTGCCAGAGGAGGTATGAAGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1110900528 13:80817135-80817157 AATTGTAACTGGAGGCATGAAGG + Intergenic
1112407479 13:99134146-99134168 GTGTGTTTGTAGATGCATGAAGG + Intergenic
1116083705 14:40207282-40207304 GTGTGAAAGTGGTGGCCAGAAGG + Intergenic
1117079020 14:52132585-52132607 GTGAGGAAGTGGAGGTCTGAGGG + Intergenic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1120671828 14:87371471-87371493 CTGTGTGAGTGGAGTCTTGAAGG + Intergenic
1123114822 14:105889933-105889955 GTGTGTAAGTGGTGGCAGGAAGG + Intergenic
1123116996 14:105899342-105899364 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123871543 15:24579847-24579869 GTGTCTCAGTGGAGTAATGATGG + Intergenic
1124719723 15:32100804-32100826 CTGTGTGAGTGGTGCCATGAGGG - Intronic
1125698729 15:41661160-41661182 GTGTGTAAGTGCAGAAATGAGGG + Intronic
1126653887 15:50955633-50955655 GTGTGTCAGTGGAAGCCTGATGG - Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128248121 15:66146940-66146962 GTGAGCAAGTGGGGGCATTATGG - Intronic
1128868835 15:71136845-71136867 GTGTGTAAGGGGCGGCAGAATGG + Intronic
1129187910 15:73921748-73921770 GTGAGTGAGTGGATGAATGAAGG + Intergenic
1131051602 15:89351803-89351825 GTGTGTAAGCAGAACCATGAGGG - Intergenic
1131232588 15:90670529-90670551 TTGGGGAATTGGAGGCATGAGGG + Intergenic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1132286612 15:100668200-100668222 GTGGGAAAGTGGAGGACTGAGGG + Intergenic
1132817772 16:1841863-1841885 GTGTGGAAATGTAGGCATAAAGG + Exonic
1136998694 16:35208897-35208919 ATGTGGACGTGGAGGCATGAGGG + Intergenic
1139429952 16:66905637-66905659 GTGTGTAAGTGCGGGGATGTAGG + Intergenic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1145308087 17:21686438-21686460 GTGTGTCACCGGAGGCATGTGGG + Intergenic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1147212829 17:38882032-38882054 GTGTGTAACTGCACGCATGTGGG - Intronic
1147613252 17:41813431-41813453 GTTTGGAAGTGGGGGCAGGAGGG - Intronic
1149611143 17:57958332-57958354 GTCTGCAAGTGGAGCCATGAGGG - Intergenic
1149972894 17:61236735-61236757 TGTTGTAAGTGGAGGGATGATGG + Intronic
1151206443 17:72511583-72511605 GTGTGTAAGTGTACGTATGTGGG + Intergenic
1151411844 17:73935905-73935927 GTGTATAAGTGAATGCATGTGGG - Intergenic
1151751559 17:76041538-76041560 GTGTCAGAATGGAGGCATGAAGG - Intronic
1152724432 17:81938220-81938242 GCGTGGGAGTGGGGGCATGATGG - Intronic
1155035363 18:22021028-22021050 GTGTGCAAGGTGTGGCATGACGG + Intergenic
1156064597 18:33124991-33125013 GTGTGCAGGTGGAGGTAAGAGGG - Intronic
1157493415 18:48139171-48139193 GTGCGGGAGTGGAGGCAGGAGGG + Intronic
1158809572 18:61016568-61016590 GTGTGTAAGTGGATGCACACAGG + Intergenic
1160534102 18:79583102-79583124 GTGTGCATGTGGTGGCATGTAGG - Intergenic
1161316986 19:3621765-3621787 ATGTGTCAGTTGAGGCCTGACGG + Intronic
1164758458 19:30708546-30708568 GTGGGAAACTGGAAGCATGAAGG + Intronic
1167618050 19:50547030-50547052 GTGTATAAGTGGGGGAAGGATGG + Intronic
1167773828 19:51541901-51541923 GTGTGTGAGCAAAGGCATGAAGG - Intergenic
925715876 2:6783903-6783925 GTGAGAAAGAGGAAGCATGAGGG + Intergenic
925817786 2:7770059-7770081 GAGTGTAAGTGAAGGCAGAAGGG + Intergenic
928153679 2:28856517-28856539 GTCTGTAAATGCAGTCATGAGGG - Intronic
928197593 2:29226661-29226683 ATGTTTAAGTGGAGGCAGGATGG + Intronic
931463621 2:62468557-62468579 GTGTGTATGTGGGTGCATGTGGG + Intergenic
932450514 2:71807744-71807766 GGGTATAAGTGGAAGGATGAAGG + Intergenic
932884784 2:75539860-75539882 GTGGGTAATTGAAGGCATAAAGG + Intronic
935205707 2:100895097-100895119 GTGTGTGTGTGTACGCATGATGG - Intronic
936977275 2:118232570-118232592 GTGTGTCAGGGCAGGCATGGGGG - Intergenic
937977387 2:127589888-127589910 GTGTGTGAGTGGATGGGTGAAGG + Intronic
938823479 2:134981677-134981699 GTGTTTCAGTGGAGCCAAGATGG + Intronic
939097467 2:137851020-137851042 GTGTGTGTGAGGAGGCAGGACGG + Intergenic
940973302 2:159917302-159917324 GAGAGGAAGAGGAGGCATGAAGG + Intergenic
941166890 2:162092192-162092214 GTGTGTAGGTGGCGGGATGTTGG - Intergenic
941438268 2:165499365-165499387 GTGTGCAAGTGAATGCAGGAAGG + Intronic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
943780157 2:191814613-191814635 GTGTGGAAATGGAGCCACGATGG - Intergenic
943952324 2:194146805-194146827 GGGTGTCAGTGGAGGCAGAAGGG + Intergenic
944838191 2:203600409-203600431 GTGTGAAAGTGGAGGAACCAGGG + Intergenic
944863747 2:203840465-203840487 GTGTGTGTGTTGATGCATGAGGG + Intergenic
946414529 2:219533126-219533148 TTGGGTAAGTGGAGGCAGCAGGG + Intronic
947245724 2:228046063-228046085 GTGTGTAGGGGGTGGGATGAAGG - Intronic
948201627 2:236133582-236133604 GTGTGTAAGTGGAGGCATGAGGG - Intergenic
948361135 2:237421525-237421547 TTGAGTAAGTGAAGGAATGAAGG - Exonic
948599731 2:239101378-239101400 GTGAGTGAGTGAACGCATGAAGG + Intronic
1170841012 20:19924492-19924514 GTGTGAAGGTGGGGGTATGAAGG - Intronic
1171113966 20:22508588-22508610 GTGAGTGAATGGAAGCATGAAGG - Intergenic
1171355974 20:24545612-24545634 ATGAGTAAGAGGAGGCTTGAGGG + Intronic
1172877598 20:38175335-38175357 CTGTGAAAGTGGAGTCATCAGGG + Intergenic
1175681094 20:60989471-60989493 GTGTGTGTGTGGAGTAATGAAGG + Intergenic
1178786324 21:35657029-35657051 GTGTGTATTTGGAGGGATGGAGG - Intronic
1179088579 21:38242607-38242629 GTGTGTCAGGAGAGGCACGAGGG - Intronic
1179142707 21:38741046-38741068 GTGTGGAATTAGAGGCCTGATGG - Intergenic
1181049429 22:20231588-20231610 GGGTGTAAGTGGAGGAGGGAGGG - Intergenic
1181116410 22:20634876-20634898 GTGTGTGAGTGAATGAATGAAGG - Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1183872203 22:40748493-40748515 CTGTGTAAGAGGGGGCCTGAAGG - Intergenic
1184284251 22:43459434-43459456 GTGCGTAAGAGGAGCCATAAAGG - Intronic
1184648216 22:45907657-45907679 GTGAGTGAGTGAAGGAATGAAGG - Intergenic
1184895283 22:47403069-47403091 GTGTGACAGAGGAGGCAGGAGGG + Intergenic
1185213041 22:49582792-49582814 GTATGTCAGTGGAGGCAACACGG - Intronic
949663344 3:6307524-6307546 GTCTATAAATGGATGCATGAGGG - Intergenic
949734341 3:7154198-7154220 GTGAGTTATTGGAGGCATTAGGG - Intronic
949934747 3:9108051-9108073 GTGTGTTAGTGGAGGACTGTAGG + Intronic
951175027 3:19589112-19589134 GGGTGTATGAGGAGGCAAGATGG - Intergenic
951755969 3:26091681-26091703 GTGTTTATCTGGAGGCTTGAAGG + Intergenic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
954381687 3:50222209-50222231 GTGTGTATGTGTATGCATGGGGG - Intergenic
955833908 3:63032754-63032776 GTGAGTGAGTGGGTGCATGAAGG - Intergenic
956057739 3:65318362-65318384 ATGCTTAAATGGAGGCATGAGGG + Intergenic
960044159 3:113180052-113180074 GGGTGTAAGTGAAAACATGAAGG + Intergenic
962403918 3:135083958-135083980 GTGTGTTTGTGGTGGCAGGATGG + Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
963635672 3:147792370-147792392 GTGTGTATGTGTAGCCATCAGGG - Intergenic
965729853 3:171760269-171760291 ATGTGTAATTGAAGGCATTAAGG - Intronic
967374755 3:188788413-188788435 ATGTCTAAATGGAGGCCTGAAGG - Intronic
967765461 3:193274473-193274495 GTGTGGAAGTGGTAGAATGAAGG - Intronic
967785425 3:193488609-193488631 TTGTTTAAATGGAGTCATGAGGG + Intronic
968194459 3:196695087-196695109 GTGTGTGAGTGTGGGCATGCGGG - Intronic
968433297 4:572112-572134 GTGTGCAAGTGGGGACAGGACGG + Intergenic
969190360 4:5513303-5513325 GTCTGTGATGGGAGGCATGAAGG + Intergenic
970025770 4:11622516-11622538 ATGTGTATGTGTATGCATGATGG - Intergenic
970134894 4:12911868-12911890 GTGAGTAAATGGAGGCATAGAGG - Intergenic
970402972 4:15735558-15735580 GTGTGTGAGGGGAGCCGTGAGGG + Intronic
970612254 4:17736734-17736756 GGGAGTAAGTGCAGGCAAGAGGG - Intronic
972693266 4:41420181-41420203 GTGTGTCAGTGGTGGCAGGTGGG + Intronic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
976198323 4:82555548-82555570 CTGTGTAAGAGGAGGCCTGATGG - Intronic
976997678 4:91455817-91455839 GTGTGTATGTGGAGGAATGGGGG + Intronic
978713594 4:111815090-111815112 GTGTGTAACTGGCGGCATCTAGG - Intergenic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
979834951 4:125354681-125354703 GTGTGGAAATGGAAGAATGAAGG + Intronic
982609407 4:157554507-157554529 TTGTGAAAGAGAAGGCATGAAGG + Intergenic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
985874263 5:2583472-2583494 GCATTTTAGTGGAGGCATGATGG - Intergenic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
987722462 5:21655988-21656010 GGTTGTAAGTGCAGACATGAAGG + Intergenic
990049850 5:51484185-51484207 GTTTATAAATGGATGCATGAAGG + Intergenic
990388360 5:55291475-55291497 GTGCATAAGTGGAGGGATGGTGG - Intronic
994130810 5:96225380-96225402 GTGTGTAAATGGGGGCATACAGG + Intergenic
995217039 5:109607148-109607170 ATGTGTAACTGGAGTCCTGAAGG + Intergenic
995636669 5:114201251-114201273 GTGGGTTAGTGGAGGGATAAAGG - Intergenic
995782913 5:115796956-115796978 GTGTGTTTGTGGAGGATTGAGGG + Intergenic
996685639 5:126277528-126277550 GTGTGTAAGTTTAGAGATGAGGG + Intergenic
996876286 5:128243718-128243740 GTGAGTAAGTAGATGGATGATGG + Intergenic
996965187 5:129299689-129299711 GTGTGTTGGTGTATGCATGATGG - Intergenic
997060344 5:130493654-130493676 GTGTGTGTGTGGAGGCTTTAGGG - Intergenic
997600175 5:135133775-135133797 GTGTGTGAGTGAATGAATGAAGG + Intronic
998027035 5:138826506-138826528 GGATGTAAGTGGAGTCAGGAGGG + Intronic
999513636 5:152278600-152278622 ATGAATAAATGGAGGCATGAAGG - Intergenic
999747354 5:154602660-154602682 GAGTGTATGTGGAGGCAGTAGGG - Intergenic
1000279116 5:159766990-159767012 GTGAGGAAGTGGAGACATAAGGG - Intergenic
1000932867 5:167272937-167272959 GTGTGTAAATGGATGCAATAAGG - Intergenic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1001996536 5:176164921-176164943 CTTTGGAGGTGGAGGCATGAGGG - Intergenic
1002394947 5:178945472-178945494 GTGTGTATGTGGAGGGATATGGG + Intronic
1002625102 5:180521178-180521200 GTGTGAAAGAGGAGGAAAGAGGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003691810 6:8362271-8362293 GTCTGTAAGTGGAAGTGTGATGG - Intergenic
1005282135 6:24285349-24285371 GTGTGTCAGGGGAGGCCTCATGG - Intronic
1005715753 6:28546179-28546201 GTGATTAAGAGGGGGCATGAGGG - Intergenic
1008355814 6:50551963-50551985 GTGAGGAAGTGGAGGCATATAGG - Intergenic
1010364942 6:75040240-75040262 GTGTGTTTGTGGGGGGATGAAGG - Intergenic
1010461538 6:76119456-76119478 GTGAGTAAGTTGAGGAAAGATGG + Intergenic
1010942404 6:81934138-81934160 TTGTGTAAGTGGACAGATGAAGG - Intergenic
1010977588 6:82333241-82333263 GTGTGGCAGTGGAGGGGTGAGGG - Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1014964666 6:127732529-127732551 GTGATTAGGTTGAGGCATGAAGG - Intronic
1015039060 6:128694341-128694363 GTGGGTAAGTGAAGTCAAGAGGG - Intergenic
1015509148 6:134020314-134020336 TTGTGTAAATAGAGGTATGAAGG - Intronic
1015688838 6:135897294-135897316 GTGTGTAGGCGGAGGAAGGAGGG + Intronic
1017036318 6:150270332-150270354 CTGTGTAAGGGGAGGCATGCTGG + Intergenic
1017047360 6:150359872-150359894 GCATTTAAGTGGAGGCATGATGG - Intergenic
1017410284 6:154160954-154160976 GGGTGTAAGGGGATCCATGAGGG - Intronic
1017889503 6:158627058-158627080 GTGTGTCAGTGAAGGTGTGAGGG - Intronic
1019358137 7:591511-591533 GTGTGTAGGTGCTGGCAAGATGG - Intronic
1020287629 7:6697316-6697338 GTGTGTTAGTGGAGGCAGTGAGG - Intronic
1020435409 7:8157344-8157366 GAGTGTAATTGGGGGCATAATGG - Intronic
1021634950 7:22682816-22682838 GGGTGCAAGGGGAGGCAAGAAGG + Intergenic
1021780754 7:24103400-24103422 GTGTGAGAGTGGTGGAATGATGG + Intergenic
1022685318 7:32591110-32591132 GAGTCTAAGTTGAGGCCTGAGGG + Intergenic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1024145603 7:46513535-46513557 GTGAGGATGTGGAGGAATGAGGG - Intergenic
1024230101 7:47357412-47357434 GTGTGTAAAAGGAGGCAGGGTGG + Intronic
1025285086 7:57654242-57654264 GTGTGTCACTGGAGGCATATGGG + Intergenic
1025922656 7:65927934-65927956 GGGTGAAAGGGGAGGCAGGAAGG + Intronic
1025964855 7:66259515-66259537 ATGTGTAATTGGAGTCCTGAAGG - Intronic
1026939821 7:74281136-74281158 GTGTGCCACTGGATGCATGAAGG - Intergenic
1028720973 7:94031162-94031184 GTGTGCAACTGGAAGGATGAAGG - Intergenic
1028744107 7:94307987-94308009 GTGTGTGGGTGGGGGCATGGAGG + Intergenic
1029168126 7:98610420-98610442 GTGTGTAAGCAGAGCCGTGAAGG + Intergenic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031936311 7:127738866-127738888 GTATTCAAGTGGAGGCAGGAAGG - Intronic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032494149 7:132348418-132348440 GTTTGTGAGTGAATGCATGAAGG + Intronic
1035164977 7:156981618-156981640 GTGTTTCTGTGGGGGCATGAGGG + Intergenic
1035332665 7:158106463-158106485 GTGTGTGTGTGGAGGCAGGGAGG - Intronic
1037382570 8:18302995-18303017 GTGTGTAAGTGGATCCATGCAGG + Intergenic
1040651618 8:49455523-49455545 GTGTGTAAGTAGAGGAAGTAGGG - Intergenic
1044734037 8:95259347-95259369 GTGAGAAAGTGGAGGCAGGAAGG + Intronic
1045743532 8:105389048-105389070 GTGTGTGTGTGTAGGCATGAGGG + Intronic
1046035112 8:108831418-108831440 GAGTGTAAGAAGGGGCATGATGG - Intergenic
1046962592 8:120126144-120126166 CTGTGTAATAGGAGGCCTGAGGG - Intronic
1047679011 8:127234738-127234760 GTGTGTTGTTGGAGCCATGAGGG - Intergenic
1048533513 8:135272136-135272158 GGGTGCAGGAGGAGGCATGAGGG - Intergenic
1049101805 8:140585247-140585269 GGGTCTAGGTGGAGGCTTGAAGG + Exonic
1049500271 8:142959472-142959494 GTGTGGAGGTGGAGGCGCGAGGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051569549 9:18540479-18540501 GTTTGGAAGGTGAGGCATGAAGG + Intronic
1051660735 9:19423973-19423995 GTGGGTAAGTGGAGTCATTTGGG + Exonic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1051982014 9:23031686-23031708 GTGTGTATGTAGTGGAATGATGG - Intergenic
1052214762 9:25952097-25952119 GTGGGTAAGGGGTGGCATCAGGG + Intergenic
1052978144 9:34427149-34427171 GTGTGTCAGCTGAGGCCTGAAGG - Intronic
1053784978 9:41647002-41647024 GTGTGTCACTGGAGGCATACGGG + Intergenic
1056827533 9:89887067-89887089 GTGTGTAAGTGTTGGCCTGGGGG + Intergenic
1056966692 9:91168451-91168473 GTGTGTAAGAGAAATCATGAAGG + Intergenic
1058090672 9:100802214-100802236 GTGAGTATCTGGAGGGATGAAGG + Intergenic
1058533354 9:105929174-105929196 GTGTGTAAGTGGATAGAAGAAGG + Intergenic
1059954268 9:119499666-119499688 GTGTGTAGGTGTGGGGATGATGG + Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061166493 9:128925734-128925756 GGGTGGAAGAGGAGGCAGGAGGG - Intronic
1061846718 9:133392448-133392470 GTGGGTAAGTGGATGGATGATGG + Intronic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1185896249 X:3861680-3861702 GTGTGTGAGTGTAACCATGAGGG + Intergenic
1185901368 X:3900106-3900128 GTGTGTGAGTGTAACCATGAGGG + Intergenic
1186518557 X:10185814-10185836 GTGTGGAAATGGAGGCAGCAGGG + Intronic
1186630109 X:11339512-11339534 GTGAGGAAATGGAGGTATGATGG - Intronic
1188789670 X:34392880-34392902 GTGTGTCAGTGCAGCCAGGATGG - Intergenic
1189608914 X:42710625-42710647 GTGTGGCAGTGGAGGTATGGGGG + Intergenic
1190641875 X:52488021-52488043 ATGTGAACGTTGAGGCATGAGGG - Intergenic
1190645797 X:52524845-52524867 ATGTGAACGTTGAGGCATGAGGG + Intergenic
1190658617 X:52634818-52634840 GTGTGTCAATGGAGACATTAAGG + Intergenic
1193598851 X:83483287-83483309 ATGTGTTTGTGGAGGTATGAGGG + Intergenic
1194663077 X:96647661-96647683 GGGTATAAGTGGAGACATGAAGG - Intergenic
1195474118 X:105264592-105264614 GCGTATTAGTGGAGGCAGGATGG + Intronic
1197047072 X:122010371-122010393 GAGTGGAAGTGGAGGAATGTAGG + Intergenic
1200423060 Y:2992916-2992938 GTGTCTCAGTGGTGGAATGAGGG + Intergenic
1201365709 Y:13204483-13204505 GTGCATAAATGCAGGCATGAGGG - Intergenic
1201753737 Y:17464227-17464249 GTGTGTGAGTGCAGAGATGATGG + Intergenic
1201847816 Y:18441758-18441780 GTGTGTGAGTGCAGAGATGATGG - Intergenic