ID: 948205793

View in Genome Browser
Species Human (GRCh38)
Location 2:236162267-236162289
Sequence GAGCAGGGAGTGGCCCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948205793_948205800 19 Left 948205793 2:236162267-236162289 CCTGGGGGGGCCACTCCCTGCTC No data
Right 948205800 2:236162309-236162331 ATCTGTGAAAGAACCACCCAGGG No data
948205793_948205799 18 Left 948205793 2:236162267-236162289 CCTGGGGGGGCCACTCCCTGCTC No data
Right 948205799 2:236162308-236162330 CATCTGTGAAAGAACCACCCAGG No data
948205793_948205802 21 Left 948205793 2:236162267-236162289 CCTGGGGGGGCCACTCCCTGCTC No data
Right 948205802 2:236162311-236162333 CTGTGAAAGAACCACCCAGGGGG No data
948205793_948205797 -5 Left 948205793 2:236162267-236162289 CCTGGGGGGGCCACTCCCTGCTC No data
Right 948205797 2:236162285-236162307 TGCTCTCCATTTAGCTGACAAGG No data
948205793_948205801 20 Left 948205793 2:236162267-236162289 CCTGGGGGGGCCACTCCCTGCTC No data
Right 948205801 2:236162310-236162332 TCTGTGAAAGAACCACCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948205793 Original CRISPR GAGCAGGGAGTGGCCCCCCC AGG (reversed) Intergenic
No off target data available for this crispr