ID: 948206081

View in Genome Browser
Species Human (GRCh38)
Location 2:236163565-236163587
Sequence GGGGCACTCCAGGATCTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948206072_948206081 2 Left 948206072 2:236163540-236163562 CCTGTTATGGTGGAAGGGGATAT 0: 1
1: 0
2: 0
3: 18
4: 312
Right 948206081 2:236163565-236163587 GGGGCACTCCAGGATCTGCGGGG 0: 1
1: 1
2: 2
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948206081 Original CRISPR GGGGCACTCCAGGATCTGCG GGG Intergenic
900110417 1:1003131-1003153 AGCCCACTCCAGGATCTCCGGGG + Intergenic
900246996 1:1640937-1640959 GGGGCACGCCAGGGTCTGGGAGG - Intronic
900258218 1:1708069-1708091 GGGGCACGCCAGGGTCTGGGAGG - Intronic
903135986 1:21309545-21309567 GAGGCCCTTCAGGATCTGCCCGG + Intronic
905651204 1:39658195-39658217 GGGGCACTGCAGGCTCTTCCCGG - Intergenic
907569557 1:55470356-55470378 TGAGCACTCCAGGATCTCCTTGG + Intergenic
908921645 1:69201460-69201482 AGGGAACTCCAGGATTTGAGAGG + Intergenic
911864718 1:103003221-103003243 GGGGAACTCCAGGAGCTCCAGGG - Exonic
914929104 1:151914153-151914175 GCGGCACTCCAGGAGCTGAAAGG - Intergenic
914985995 1:152457657-152457679 CTGGCACTCCAGAGTCTGCGAGG + Intergenic
919736400 1:200954953-200954975 TGGGGACTCCAGGCTCTGCTGGG - Intergenic
919915068 1:202134019-202134041 GGGGCCTTTCAGGATCTGGGAGG - Exonic
922764514 1:228150183-228150205 GGGCCACCCCACCATCTGCGTGG - Intronic
1067784756 10:49237341-49237363 GGTGCACACCAGCATCTGCTAGG + Intergenic
1068408629 10:56625921-56625943 GGGGCACTACAGGAGGTGCTTGG - Intergenic
1069638376 10:69939586-69939608 GGAACACTCCAGGATATGCCTGG - Intronic
1069859180 10:71459842-71459864 GTGGCTCTCCAGGGTCTGCAGGG + Intronic
1070285095 10:75077195-75077217 GGGGCACTCCAGAATTAGCATGG + Intergenic
1073116973 10:101096790-101096812 GGGGCACTCCAGAATCCCAGCGG - Intronic
1073139511 10:101238129-101238151 AGGTCACTCCAGGCCCTGCGAGG - Intergenic
1076012582 10:127002583-127002605 GGAGAACTCCAGGAGCTGGGGGG - Intronic
1077309400 11:1881782-1881804 GGGGCATTTCAGGCTCTGCTTGG - Intronic
1077330595 11:1982359-1982381 GGGGCACTCCAGGGTCGGGAAGG + Intronic
1078363841 11:10691045-10691067 GGGGCAGTCCAGGCTCTGTGAGG + Intronic
1084087386 11:66860801-66860823 ATGGCACTTCAGGGTCTGCGGGG + Intronic
1084565063 11:69923989-69924011 GGGCCTCTCCTGGATCTGCTTGG - Intergenic
1084653246 11:70501131-70501153 GGGGCACTACTGGTTCTGGGTGG + Intronic
1085357256 11:75849944-75849966 GGGGCTCTCCAGGGGCTGCAAGG - Intronic
1088649868 11:111948115-111948137 GGGACAGTCCAGGAACTGGGAGG - Intronic
1091355193 11:134932389-134932411 GGTGGTCTCCAGGATCTGGGAGG + Intergenic
1202813573 11_KI270721v1_random:37538-37560 GGGGCACTCCAGGGTCGGGAAGG + Intergenic
1094835795 12:34321465-34321487 CAGGGACTCCAGGATCTCCGAGG + Intergenic
1102004487 12:109580611-109580633 GGGGCATTCCAGAATCTTCCAGG + Intronic
1102047232 12:109837074-109837096 GGGGCAGTCCAGGAGCTACGTGG - Intergenic
1102350932 12:112191521-112191543 GGGGCAGTGCAGGATGTGAGGGG - Intronic
1104990127 12:132620034-132620056 GGGGCCCTCCAAGACCTGCGAGG + Exonic
1106592585 13:31110450-31110472 GGGGCACTCCAGGTGCGGGGTGG - Intergenic
1112504704 13:99968909-99968931 GGGGCGCTCGGGGCTCTGCGGGG - Intronic
1113695586 13:112343228-112343250 GGGGCAGGCCGGGGTCTGCGGGG + Intergenic
1122393244 14:101404978-101405000 CGGGCACTCCAGGGTCCGAGAGG - Intergenic
1122425620 14:101603582-101603604 GGGGCACTCCGGGGCCTGGGAGG + Intergenic
1123044660 14:105505438-105505460 TGCACACTCCAGGATCTGCAAGG - Intergenic
1124139763 15:27067194-27067216 GTGGCACTCCAGGAGCCGAGTGG + Intronic
1124971014 15:34489807-34489829 GGGGCCCTCCATATTCTGCGGGG + Intergenic
1125608453 15:40955590-40955612 CCGGCAGGCCAGGATCTGCGTGG - Exonic
1125674484 15:41494878-41494900 GCGGCGCTCCAGGCTCTGCTCGG + Intronic
1125727014 15:41873330-41873352 GGGGCACTGTGGGATCTGGGTGG + Intronic
1127931363 15:63599675-63599697 GGGGCAGTCACGGAGCTGCGGGG + Intronic
1132152865 15:99474971-99474993 GGGGCACTCCAGGCTCTGCGGGG - Intergenic
1133023441 16:2976921-2976943 GGGAGAATCCAGGTTCTGCGTGG + Exonic
1133050998 16:3117336-3117358 GGGACACCCAAGGGTCTGCGGGG - Intronic
1133061132 16:3175188-3175210 GAGGGACTGCAGGAACTGCGAGG - Intergenic
1134626218 16:15724668-15724690 GTGGCGCTCCAGGTTCTGCTTGG + Exonic
1135150635 16:20002321-20002343 GGGGCACCCAGGGATCTGCCAGG + Intergenic
1136534865 16:30893571-30893593 GGTGCGCCCCAGGATCTGCAGGG - Intronic
1137586363 16:49666121-49666143 GGGGCCAGCCAGGATCTGGGGGG - Intronic
1141463810 16:84194262-84194284 GAGGCACTCAAGGGTGTGCGCGG + Intronic
1142727862 17:1829813-1829835 GGGGCGCGCCAGGAGCTGCGCGG - Exonic
1143322367 17:6076409-6076431 GGTGCACTCCAGGGACTGTGGGG + Intronic
1147188036 17:38723083-38723105 GGGAAACTCCAGGGTCTGAGTGG + Intronic
1147421588 17:40324531-40324553 GGGGCAGTCCAGGTTCTAGGAGG - Intronic
1147759250 17:42787185-42787207 TGGGAACTCCAGGATATGGGAGG - Intronic
1147786105 17:42979956-42979978 TGGGCGCTCCAGGTTCTGTGAGG - Intronic
1147999803 17:44380949-44380971 GGGGCTGTCCAGGACCTGGGAGG + Exonic
1148494213 17:48042915-48042937 GGTGCACTTCAGGATGTGTGGGG - Intergenic
1149568984 17:57658929-57658951 GGGGCACTGCAGGGTCTAGGAGG + Intronic
1152210504 17:79000695-79000717 GGGGAACTGCAGGCTCTGCCAGG - Intronic
1153337089 18:3936035-3936057 GGGGCATTCCAGCCTCTGCTGGG + Intronic
1155864058 18:30942264-30942286 GGATCACTCCAGGATCTGGCTGG - Intergenic
1156468567 18:37363137-37363159 GGTGCACTACAGGGTCTGCTGGG + Intronic
1157499719 18:48181131-48181153 GGGTGACTCCAGGATCTCAGTGG - Intronic
1157698048 18:49739301-49739323 GTGGCACTCCTGGGTCTGCCTGG - Intergenic
1157766062 18:50298491-50298513 GGGGCACAGCAGGAGTTGCGGGG - Intergenic
1157766637 18:50302477-50302499 GGGGCACAGCAGGAGCTGCGGGG - Intergenic
1157865203 18:51177056-51177078 GTGGCACTCTTGGCTCTGCGTGG - Exonic
1159995638 18:74961351-74961373 GGGGCCCTACATGATCTGCTAGG - Intronic
1161068086 19:2248141-2248163 GGTGGACTCCAGGAGCTGGGGGG - Exonic
1161068214 19:2248438-2248460 GGTGCACCCCAGGATTTGAGGGG - Exonic
1161382245 19:3971481-3971503 GGTCCACTCCAGGAGCTGCCAGG - Intergenic
1162532124 19:11242080-11242102 GGGGAACTCCAGAATCTCCTTGG + Exonic
1163681493 19:18684739-18684761 GGGGCAGGCCAGGTTCTGCCAGG + Intronic
1163785654 19:19273557-19273579 GGGGCACGCCAGGACCTCCAGGG - Intergenic
1163830052 19:19543291-19543313 GGGGCCCACCTGGAGCTGCGGGG + Exonic
1165845042 19:38812753-38812775 GGGGCCCCCCAGGATCAGAGTGG + Intronic
1167509702 19:49889547-49889569 GGGGGGCTCCAGGATGGGCGTGG + Intergenic
926330689 2:11822807-11822829 GAGGGACTCCAGCATCTGAGAGG + Intronic
927790121 2:26003065-26003087 AGGGCACTCCAGCTTCTGCCAGG + Intergenic
929920964 2:46171280-46171302 GGGGCACCCCAGGAGATGCCTGG - Intronic
937152150 2:119693239-119693261 GGGGCACCCCAGGGTCTCCAGGG - Intergenic
938548881 2:132361294-132361316 AAGGCACTGCAGGATCTGGGTGG + Intergenic
940974327 2:159926645-159926667 GGGGCTCTCCAGGAAATGGGTGG + Intergenic
947837813 2:233188118-233188140 GGGGGACTCCAGGATCAGAGAGG - Intronic
948206081 2:236163565-236163587 GGGGCACTCCAGGATCTGCGGGG + Intergenic
948593989 2:239067885-239067907 GAGGCTCTCCAGGATCCTCGGGG + Intronic
948628401 2:239284676-239284698 TGGGGCCTCCAGGATCTGCAGGG + Intronic
1172179792 20:32995674-32995696 GGGGAAATCCAGGACCTCCGAGG - Exonic
1172277121 20:33685936-33685958 GGCGCCCTCCCGGGTCTGCGCGG + Intronic
1172387057 20:34541433-34541455 GGGGCCCTCCAGGATTTCTGGGG - Intergenic
1176672706 21:9749868-9749890 GCGGCATTCCAGGGTCTGCTGGG - Intergenic
1178497844 21:33101935-33101957 GGGACGCTCCAGGCTCTGCGGGG + Intergenic
1179942459 21:44648989-44649011 GGGGCACCCCGGGACCTGGGAGG - Intronic
1183591447 22:38781436-38781458 AGGGCCCTCCAGGAGCTGGGAGG - Intronic
1184271286 22:43385741-43385763 GGGGACCTCTAGGGTCTGCGAGG - Intergenic
1184940327 22:47760220-47760242 GGGGGCCTCCAGGAGTTGCGGGG + Intergenic
950560206 3:13716907-13716929 GGGGAACTGCAGGACCTGGGAGG + Intergenic
952888115 3:38024303-38024325 AGAGCACTCCGAGATCTGCGGGG - Intronic
954125468 3:48525468-48525490 GGGGCTCTGCAGGGGCTGCGTGG - Intronic
954129026 3:48550368-48550390 GGGCCACTCCAGGAGCTGTGTGG - Intronic
960141100 3:114152672-114152694 GGGGCTCTCCAGGCTCTGTGGGG + Intronic
968426320 4:525879-525901 GGGGCACGCCAGCATCGGGGTGG + Intronic
968744391 4:2352238-2352260 GGAGCACACCTGGATCTGCGGGG + Intronic
973816019 4:54619746-54619768 GGGGCACTCCTGAAGCTGTGTGG - Intergenic
976517867 4:85992068-85992090 GTGGAACTCCAGAATCTGCTTGG + Intronic
980671459 4:136012876-136012898 GGAGCACTCAAGGATGTGCAGGG - Intergenic
980972078 4:139576328-139576350 GGAGCTCTCCAGGCTCTGTGAGG - Intronic
981110788 4:140930919-140930941 GTTGCACTCCTGGATCTGCTGGG + Intronic
982383099 4:154770794-154770816 GGGACATTCCAGCATCTGCAGGG - Intergenic
985402008 4:189601957-189601979 GCGGCATTCCAGGGTCTGCTGGG + Intergenic
985549245 5:524730-524752 CGGGCATCCCAGGAGCTGCGCGG - Intergenic
985671736 5:1210312-1210334 GGGCTACTCCAGAATCTGAGGGG - Intronic
985943267 5:3155838-3155860 GGGGCACTCGAGGCTATGTGGGG + Intergenic
987393904 5:17402835-17402857 GGTCCACTCCAGGACCTGCCAGG + Intergenic
997222176 5:132178517-132178539 GGGATACTCCAGGGTGTGCGTGG + Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
999262747 5:150247689-150247711 GGGGCACTCCAATATCTGACAGG + Intronic
1001595653 5:172897095-172897117 GGGGCATTCCAGGATGTTCTGGG + Intronic
1002323595 5:178390381-178390403 GGTGCACTCCAGGCTCAGTGTGG + Intronic
1002520913 5:179792957-179792979 GGGGCACTCCAGGCAGGGCGAGG + Intronic
1005856894 6:29869618-29869640 GGTGCCCTCCAGGATCTTCTGGG + Intergenic
1005940347 6:30555853-30555875 GGGACCCTCCCGGATGTGCGTGG + Intronic
1011431457 6:87291515-87291537 GGAGCAGTCCAGGATCTTCTAGG - Intronic
1013072032 6:106738048-106738070 GGGTCAATCCAGGATTTGTGGGG - Intergenic
1013385469 6:109625473-109625495 GGGGCACTGCAGGAGGTGAGCGG + Intronic
1013612218 6:111806091-111806113 GGGGCACCCTAGGAACTGCGTGG - Intronic
1018950669 6:168376933-168376955 GGGGCCCTCCAGGAAGTGGGGGG - Intergenic
1019017530 6:168890774-168890796 GGGGCACTGCAGGCTCCCCGAGG - Intergenic
1019697120 7:2452111-2452133 GGGGGACTCAAGGAGCTGAGTGG + Intergenic
1024061642 7:45703004-45703026 GGGGCACATCAGGAGCTGCCTGG + Intronic
1026130511 7:67616843-67616865 GTGGCCTTCCAGGATCTGGGAGG - Intergenic
1027180988 7:75939138-75939160 GCTGCACTCCAGGAACTGTGTGG - Intronic
1029472747 7:100764966-100764988 GGGCCACACCAGGAGCTGGGAGG - Intronic
1029737518 7:102472901-102472923 GGGCCACTTCAGGATCTGGTGGG - Exonic
1032238169 7:130141832-130141854 GTGGCTCTCCGGGATATGCGGGG + Intergenic
1034342834 7:150369049-150369071 GGGACGCTGCTGGATCTGCGGGG + Intronic
1038176843 8:25187944-25187966 GGCACAGTCCAGGAACTGCGAGG - Intronic
1039448176 8:37648978-37649000 GGTGCCCTCCGGGCTCTGCGTGG + Intergenic
1049222166 8:141433138-141433160 GGGGCTCTCCAGGAGCTGTGTGG + Intergenic
1049691846 8:143965001-143965023 GGGGCACACCAGGGTGGGCGGGG - Intronic
1049720311 8:144112540-144112562 GTGGCTCTCCAGGAGCTGGGAGG - Intronic
1053312435 9:37027978-37028000 GGGACTCTCCAGGCACTGCGTGG - Intronic
1057438853 9:95067143-95067165 GTGGCACACCAGGATGTGAGAGG + Intronic
1060785939 9:126451644-126451666 GAGGCACTGCAGGAACTCCGTGG + Intronic
1061973301 9:134056083-134056105 GGGGCGCCCCAGGCTCTGCTTGG + Intronic
1186836457 X:13443258-13443280 GGGGCAGGCCAGGATCTCCATGG - Intergenic
1187265814 X:17732115-17732137 GGGGCTCTTCAGGATCTCAGTGG - Exonic
1189412360 X:40783941-40783963 GGGCCAGGCCAGGATCTGTGTGG - Intergenic
1190790543 X:53696072-53696094 GAGGCCCTCCAGGCTGTGCGCGG + Intergenic
1194290415 X:92064943-92064965 GGTGCACTCCAGGATCTGAGGGG + Intronic
1196828468 X:119758723-119758745 GGCGCACCGCAGGCTCTGCGAGG - Exonic
1198088761 X:133306639-133306661 GGTGCACTCAAGGATCTGAGGGG - Intronic
1199650634 X:149944109-149944131 GGGACACTCCATGATCTCTGGGG - Intergenic
1200607928 Y:5289542-5289564 GGTGCACTCCAGGATCTGAGGGG + Intronic
1200922887 Y:8628824-8628846 GGAGCACTCCATGTTCTGGGTGG + Intergenic
1201486440 Y:14499589-14499611 GGGGCACCCCAGCATGTGTGGGG + Intergenic