ID: 948207242

View in Genome Browser
Species Human (GRCh38)
Location 2:236168662-236168684
Sequence CCTTGTCGAGGCCACCTCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948207236_948207242 5 Left 948207236 2:236168634-236168656 CCAAGGCTCGGACCTTGGGGCCC 0: 1
1: 0
2: 2
3: 9
4: 200
Right 948207242 2:236168662-236168684 CCTTGTCGAGGCCACCTCGAAGG 0: 1
1: 0
2: 1
3: 11
4: 42
948207234_948207242 8 Left 948207234 2:236168631-236168653 CCTCCAAGGCTCGGACCTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 948207242 2:236168662-236168684 CCTTGTCGAGGCCACCTCGAAGG 0: 1
1: 0
2: 1
3: 11
4: 42
948207237_948207242 -7 Left 948207237 2:236168646-236168668 CCTTGGGGCCCTGCAGCCTTGTC 0: 1
1: 0
2: 3
3: 38
4: 549
Right 948207242 2:236168662-236168684 CCTTGTCGAGGCCACCTCGAAGG 0: 1
1: 0
2: 1
3: 11
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948207242 Original CRISPR CCTTGTCGAGGCCACCTCGA AGG Intergenic
900001797 1:18522-18544 CCTTGTAGAGGCCCCCTGGATGG - Intergenic
900021517 1:189045-189067 CCTTGTAGAGGCCCCCTGGATGG - Intergenic
902056725 1:13606883-13606905 CCCTGTCCAGGCCACCTCGATGG + Intronic
922349870 1:224726533-224726555 CCTTAACAAGGCCACCTCAAAGG - Intronic
1070923994 10:80205968-80205990 CCCTGTCGAGGTCACCTTGACGG - Intergenic
1079394800 11:20052398-20052420 CCTTGCCAAGGCCCCCTCTAAGG - Intronic
1089105983 11:116005452-116005474 CCTTGTAGACTCCACCTCTAGGG + Intergenic
1091374877 12:18627-18649 CCTTGTAGAGGCCCCCTGGATGG - Intergenic
1092837056 12:12500518-12500540 CCTTGTTGAGGACATCTCGCTGG + Exonic
1114765246 14:25363154-25363176 CCTTGACCAGGCCACCTGAATGG - Intergenic
1121580500 14:95026151-95026173 CCTTGTCCAGCCCAGGTCGATGG + Intergenic
1132451712 15:101972418-101972440 CCTTGTAGAGGCCCCCTGGATGG + Intergenic
1132455180 16:18211-18233 CCTTGTAGAGGCCCCCTGGATGG - Intronic
1132641535 16:980678-980700 CCGGGCCGAGGCCACCTCGCGGG + Intronic
1132686384 16:1163877-1163899 CTATGTGGCGGCCACCTCGAAGG + Intronic
1132915489 16:2341404-2341426 CCTTGTCGGGGTCACCTGGCGGG + Intergenic
1143655410 17:8290875-8290897 CCTTGTGCAGGCCACATCAAAGG + Exonic
1158544260 18:58382271-58382293 CCTGGCAGAGGCCACCTCCAGGG - Intronic
1158806324 18:60978006-60978028 TCTTGTCAAGACCACCTCCAAGG + Intergenic
1160633549 19:60130-60152 CCTTGTAGAGGCCCCCTGGATGG - Intergenic
1165134852 19:33661438-33661460 CCTTGTGGAGGTCACCTTTATGG + Intronic
1167492899 19:49802165-49802187 CCTTCTCGCGGCCACCCCCAGGG + Intronic
927508851 2:23631809-23631831 CCTTGACGAGGCCACTTCTGAGG - Intronic
927810036 2:26175555-26175577 CCTTGTCAAGGGGACCTCGAAGG - Intronic
927810061 2:26175633-26175655 CCTTGTTCAGGGGACCTCGAAGG - Intronic
936567923 2:113594885-113594907 CCTTGTAGAGGCCCCCTGGATGG + Intergenic
937090138 2:119200786-119200808 CCTAGACGAGGTCACCTAGAAGG + Intergenic
938670045 2:133577908-133577930 CCTTTTCTAAGCCACCTGGAAGG - Intergenic
947472499 2:230412109-230412131 CCTTTCCGAGGCCACCTAGCCGG - Intergenic
947856693 2:233328902-233328924 CCTTGTCCTGTCCACCTCCATGG + Intronic
948207242 2:236168662-236168684 CCTTGTCGAGGCCACCTCGAAGG + Intergenic
1170612890 20:17928886-17928908 CCTTGGCGAGGCTGCCTCTACGG + Intergenic
1171966890 20:31537280-31537302 ACTTGTGGTGGCCACCACGAGGG + Intronic
1172759211 20:37310202-37310224 CCTTGTTGAGTCCACATGGATGG + Intronic
1173339291 20:42139293-42139315 CCTTGACGATACCACCTTGATGG - Intronic
1183459835 22:37943100-37943122 CCTTGTCTCGGGCACCTGGAGGG - Intronic
954707649 3:52489552-52489574 CCTCATCCAGGCCACCTCGGAGG + Exonic
959498083 3:107074270-107074292 CCCTGTTGAGGCCACCAAGAAGG + Intergenic
967121058 3:186383314-186383336 CCTTGCTGAGGCCACCGGGAGGG + Intergenic
979164895 4:117516553-117516575 CATTGGCGAGGCCACCTAGTGGG + Intergenic
985875117 5:2588424-2588446 CCTTGGGGAGGCCATCCCGATGG + Intergenic
988778281 5:34496651-34496673 CCTTGAAGAGCCCACCTAGAAGG + Intergenic
1005589545 6:27310304-27310326 CCTGGTCAAGGCCACCTCTGTGG - Exonic
1016796101 6:148119188-148119210 CCTTGTCTATGCCACGTGGAAGG - Intergenic
1018177915 6:161194749-161194771 CCTTGTCGAGGACACATGCAAGG - Intronic
1025854880 7:65268032-65268054 CCTTGTCAAGGTACCCTCGAGGG + Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1035641148 8:1186097-1186119 CCTTGGCGAGGCCACCGAGTGGG - Intergenic
1038188428 8:25296599-25296621 CCTTTTGGAGGCCACCTCATGGG - Exonic
1049884605 9:18635-18657 CCTTGTAGAGGCCCCCTGGATGG - Intergenic
1054454637 9:65423603-65423625 CCTCGTCTAGGCCACCTGCAGGG - Intergenic
1056927351 9:90846253-90846275 CCTTGACCAGACCCCCTCGAGGG - Intronic
1059828668 9:118065546-118065568 CCTTGTAGAGGTCACCTCCTTGG + Intergenic
1062337534 9:136078857-136078879 CCTTGTCCAGGCGACCTTGTGGG + Intronic
1200401199 X:156021516-156021538 CCTTGTAGAGGCCCCCTGGATGG + Intergenic