ID: 948211008

View in Genome Browser
Species Human (GRCh38)
Location 2:236193190-236193212
Sequence CTCCCCCGGAGGACACCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948211008_948211018 28 Left 948211008 2:236193190-236193212 CCTGCCGGTGTCCTCCGGGGGAG 0: 1
1: 0
2: 1
3: 5
4: 75
Right 948211018 2:236193241-236193263 TGAGAGCACCGACAGGCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 113
948211008_948211015 0 Left 948211008 2:236193190-236193212 CCTGCCGGTGTCCTCCGGGGGAG 0: 1
1: 0
2: 1
3: 5
4: 75
Right 948211015 2:236193213-236193235 CTCTGGGCTGTAATATGCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 142
948211008_948211014 -1 Left 948211008 2:236193190-236193212 CCTGCCGGTGTCCTCCGGGGGAG 0: 1
1: 0
2: 1
3: 5
4: 75
Right 948211014 2:236193212-236193234 GCTCTGGGCTGTAATATGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 104
948211008_948211016 21 Left 948211008 2:236193190-236193212 CCTGCCGGTGTCCTCCGGGGGAG 0: 1
1: 0
2: 1
3: 5
4: 75
Right 948211016 2:236193234-236193256 GGAGCACTGAGAGCACCGACAGG 0: 1
1: 0
2: 0
3: 7
4: 111
948211008_948211017 27 Left 948211008 2:236193190-236193212 CCTGCCGGTGTCCTCCGGGGGAG 0: 1
1: 0
2: 1
3: 5
4: 75
Right 948211017 2:236193240-236193262 CTGAGAGCACCGACAGGCCCTGG 0: 1
1: 0
2: 1
3: 23
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948211008 Original CRISPR CTCCCCCGGAGGACACCGGC AGG (reversed) Intergenic
900156879 1:1206727-1206749 GTCCCCCGCAGGTCGCCGGCAGG + Intergenic
900659703 1:3776365-3776387 CTCCCACGGAGGAAAGCAGCCGG - Intergenic
900933623 1:5751961-5751983 CTCCCCCGCAGGATGCAGGCTGG - Intergenic
903324687 1:22563305-22563327 CTCCCCCGGCGGGCACCTTCGGG - Intergenic
903679917 1:25089724-25089746 TTCCCCATGAGGACACCGCCAGG + Intergenic
904341413 1:29837298-29837320 CTTCCCCGTAGGACATCGCCAGG - Intergenic
911144870 1:94542004-94542026 CTGCCCTGGAGGACGCAGGCGGG + Intergenic
916172182 1:162009714-162009736 CTGCCCTGGGGGACACCAGCTGG - Intronic
922576684 1:226665610-226665632 CTACCTCGGTGGTCACCGGCGGG + Intronic
1066364464 10:34763429-34763451 TTCCCCCAGAGGACACAGGTTGG - Intronic
1067362459 10:45594887-45594909 CTCCGCGGGAGGACACCGAGTGG + Intronic
1077154837 11:1086618-1086640 CTCCCACACAGGACACCTGCAGG - Intergenic
1081712677 11:45227397-45227419 CTCCCCGGGAGAATACCTGCAGG + Intronic
1083328966 11:61888334-61888356 CTCCACCTGAGGCCACCGCCCGG + Intronic
1083620143 11:64045200-64045222 CTCCTCCCGAGGGCACCAGCGGG - Intronic
1084459709 11:69289739-69289761 ATCCCCCGGAGACCACCTGCAGG + Intergenic
1091445014 12:540004-540026 CTCCCCCGGAGGAACACAGCAGG - Intronic
1102026881 12:109718685-109718707 CGCCCGCGGAGGTGACCGGCCGG - Intronic
1102096772 12:110247343-110247365 CTGCCCCAGAGGACAAAGGCTGG + Intergenic
1104607232 12:130199016-130199038 ATCCCACGGAGGAGACGGGCAGG + Intergenic
1109319658 13:60794652-60794674 CTCACTCAGAGGACACCTGCTGG + Intergenic
1110962087 13:81639462-81639484 CTGCCCAGGAGGACTCCGGAAGG - Intergenic
1112719241 13:102224240-102224262 CTCCCCCGTATTACATCGGCAGG + Intronic
1116114884 14:40635470-40635492 CTCCCTTGGAGGACACAAGCTGG - Intergenic
1118381671 14:65222618-65222640 CTCCCCCAGAGGCCCCTGGCTGG - Intergenic
1121427561 14:93863405-93863427 CTCCCCTGGAGGACAGCAACTGG - Intergenic
1122892315 14:104738521-104738543 CTCCCACGGAGGGGACTGGCAGG + Intronic
1202854862 14_GL000225v1_random:43808-43830 CGCCCCCGGAGGACTCCGCGTGG + Intergenic
1130310553 15:82750265-82750287 ATTCCCCGGAGGACATCCGCGGG + Intergenic
1132483993 16:180897-180919 GTCCCCGGGAGGGCCCCGGCGGG + Intronic
1133248243 16:4463373-4463395 CTCCCACAGAGGAGCCCGGCAGG + Intronic
1142140817 16:88471984-88472006 CTCCCCGGTAGGAGCCCGGCAGG + Intronic
1146132577 17:30291767-30291789 CTCCTCCAGAGGACCGCGGCGGG + Intronic
1148565078 17:48627768-48627790 CTCCCCCGGGGCCCACCGACTGG + Intronic
1152209857 17:78997318-78997340 CCCCCACAAAGGACACCGGCTGG - Exonic
1152938930 17:83155508-83155530 CCCCGCCGGAGGGCACAGGCAGG - Intergenic
1158545068 18:58389212-58389234 CTCAGGTGGAGGACACCGGCTGG - Intronic
1160228161 18:77027431-77027453 CTGCCCAGGGGGACACCAGCAGG - Intronic
1161039348 19:2101728-2101750 CTCCCCCGGACGCAACCGTCAGG + Exonic
1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG + Intronic
1161241043 19:3224397-3224419 CTCCCGCGGAGGGCATCGGCCGG - Intergenic
1162646356 19:12052987-12053009 CTTCCCTGGAGGACAGTGGCAGG + Intergenic
1166039162 19:40191710-40191732 CCCCACCGGCGGACCCCGGCGGG + Intergenic
1168146019 19:54420530-54420552 CTCCACTGCGGGACACCGGCCGG + Intronic
928371239 2:30741696-30741718 GTCCCCCGGATGACACTGGGTGG + Intronic
929603534 2:43219752-43219774 CTCCCCAGGAGGAGCCCTGCAGG - Intergenic
934553789 2:95277096-95277118 CGCCCCAGGAGGACACCCGCTGG - Intronic
934992780 2:98933160-98933182 CTCACCCTGGGGACACCAGCTGG + Intronic
937808465 2:126172765-126172787 GTCTCCTGGAGGACACGGGCAGG + Intergenic
940792378 2:158042746-158042768 CTCCCAAGGAGGACACTGGGTGG + Intronic
948211008 2:236193190-236193212 CTCCCCCGGAGGACACCGGCAGG - Intergenic
948420974 2:237859770-237859792 CTCCCCTAGAGGACACCGGCTGG - Intronic
948478930 2:238238798-238238820 CACCCCCGCAGGACTCTGGCTGG + Exonic
1178545726 21:33491658-33491680 TTACCCCGGAGGACCCAGGCAGG + Intronic
1180000123 21:44991737-44991759 CTCCCCCGGAAGACACACGCTGG - Intergenic
1181631989 22:24156286-24156308 CCCCCGCGGAGGAAATCGGCCGG + Intronic
1184759998 22:46538438-46538460 CTCCTACGGAGGACAGCGGGGGG + Intergenic
950822424 3:15775387-15775409 ATTCCCCGGAGGACACCAGCTGG + Intronic
968405943 4:338964-338986 CTCCCCGGGAGGAGACCTGGAGG - Intronic
968410713 4:387288-387310 CTCCCTCGGAGGAGACCTGGAGG - Intergenic
976719813 4:88158799-88158821 CTCCCCAGGCGGCCACCCGCCGG - Exonic
986693535 5:10333127-10333149 CTCACCCGGAGGCCGCCTGCAGG + Intergenic
989368340 5:40680162-40680184 CTCCCGCAGACGAGACCGGCGGG + Exonic
992124532 5:73626622-73626644 GTCTCCCGAAGGACACTGGCGGG - Intronic
1002029249 5:176416117-176416139 CGCACCCGGGGGACCCCGGCCGG - Intronic
1006904122 6:37521613-37521635 CTCCCCTGAAGGACAACAGCAGG - Intergenic
1018825269 6:167404104-167404126 CTCTCCTGGGGGACATCGGCAGG + Intergenic
1019590100 7:1826583-1826605 CTCCCCCGAGGGACGCCGGAGGG - Intronic
1023418017 7:39950336-39950358 CTCCCCCGCAGGTCAGCGCCCGG + Exonic
1034956729 7:155339635-155339657 CAGCCCAGGAGGACTCCGGCCGG - Intergenic
1035593846 8:838843-838865 CTCCCCAGGAAGTCACCAGCAGG - Intergenic
1038423099 8:27446118-27446140 CTGCTCTGGAGGACACCAGCTGG + Intronic
1049555071 8:143277602-143277624 CTGTCCCGGAGGGCACAGGCAGG - Intergenic
1049563337 8:143324423-143324445 GTCCCCCTGAGGACGCCGGCAGG - Intronic
1050340281 9:4630486-4630508 CTCCCCCAGAGAACACCACCTGG + Intronic
1057014912 9:91642853-91642875 CTGCCCCGGAGAACATGGGCAGG - Intronic
1061178065 9:129009220-129009242 CTCCCCCGGAGGGGCCAGGCTGG + Exonic
1061836568 9:133333577-133333599 CTCTCCCAGAGCACACCTGCTGG + Intronic
1061856321 9:133443648-133443670 CTCCTCCTGAGGCCTCCGGCGGG + Intronic
1185467072 X:361506-361528 CTTCCCCAGAGGACGCCCGCAGG - Exonic
1191258088 X:58288468-58288490 CTCCCCAGGAGGACAGGGACTGG + Intergenic
1200908420 Y:8509374-8509396 CCCCCACAGAGGACACAGGCTGG - Intergenic