ID: 948213302

View in Genome Browser
Species Human (GRCh38)
Location 2:236210798-236210820
Sequence CCTGTGAAGGAGGCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 543}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948213291_948213302 21 Left 948213291 2:236210754-236210776 CCATGTAAACTGAGCGGTGAATC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG 0: 1
1: 0
2: 4
3: 48
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948213302 Original CRISPR CCTGTGAAGGAGGCAGTGGA GGG Intronic
900422113 1:2560157-2560179 CAGGTGATGGAGGCAGGGGAAGG + Intronic
900580524 1:3406359-3406381 CCTGTGGAGGAGGCTCAGGAGGG + Intronic
900741989 1:4336000-4336022 CCTGTAAAGGAGGGAGTGCTTGG + Intergenic
900806969 1:4773903-4773925 CCTGGCATGGAGGCATTGGATGG + Intronic
901536007 1:9883394-9883416 TCTATGAAGGAGGCAGAGCAGGG + Intronic
902149912 1:14434841-14434863 CCTCTGAAGGAAACAGTGGCTGG - Intergenic
903003751 1:20284722-20284744 CCAGAGAAGGTGGCAGTGGCAGG - Intergenic
903036547 1:20496684-20496706 CCGGAGCAGGAGGAAGTGGAGGG - Intergenic
903061505 1:20671892-20671914 GCCGTGAAGGAGGGAGGGGAGGG + Intronic
903128093 1:21261297-21261319 TCTTTGAAGGAGGCAAAGGAAGG - Intronic
903666886 1:25013536-25013558 GCTGTGAAGGTGGCAGTGGGAGG - Intergenic
904005093 1:27359416-27359438 CCTGTGAAGGTCTCAGTGCAAGG + Exonic
904716576 1:32472358-32472380 CCTGTGAGAGAGGCAGGGCAGGG - Intronic
904945338 1:34195057-34195079 CATGGGAAGGAGGCAAAGGAAGG + Intronic
905489935 1:38335399-38335421 CATGTGATGGTGGCAGTGGAAGG - Intergenic
906074637 1:43042979-43043001 CCTGTGAAAGAGGAAGGGGGAGG - Intergenic
906553316 1:46685227-46685249 CCTGGGAATGAGGCAGGGTATGG - Intronic
906634207 1:47397400-47397422 CCGGTGAGGGAGGCTGTAGAAGG - Intergenic
907245160 1:53103695-53103717 CCTGTGAGGCAGGCAGAGCAGGG + Intronic
907265411 1:53256960-53256982 CTTGTGAAGCAGGTTGTGGAAGG + Intronic
907282912 1:53362612-53362634 GCTGTGAGGGAGGCAGTGGGAGG - Intergenic
910047635 1:82937551-82937573 CCTATGAAGGAGAAAGTAGAGGG + Intergenic
911055568 1:93705574-93705596 CCTGAGAAGGGAGCAGTGGCTGG - Intronic
912490025 1:110057668-110057690 CCTGTGGAGGAGGCTGGGGCAGG + Intronic
913177226 1:116285994-116286016 CCAGGCAAGGAGGCAGTGGCGGG + Intergenic
913577991 1:120196832-120196854 TCTGGGAATGAGGCAGTGGGTGG + Intergenic
913630179 1:120701520-120701542 TCTGGGAATGAGGCAGTGGGTGG - Intergenic
914559907 1:148808252-148808274 TCTGGGAATGAGGCAGTGGGTGG + Intronic
914612926 1:149321963-149321985 TCTGGGAATGAGGCAGTGGGTGG - Intergenic
915210055 1:154301904-154301926 CCAGTGAGGGAGGCAGCGGTGGG + Intergenic
915286886 1:154858905-154858927 CCTGTGAGGAAGGCAGGGAAAGG - Intronic
915312054 1:155009805-155009827 CCTGGGAAGAAGGGAATGGATGG + Intronic
915710429 1:157892962-157892984 CTTGTGAAGGAGCCAGTCTAGGG - Intronic
915742009 1:158125894-158125916 CCTGTGAAGGGAGCAGTCAATGG - Intergenic
915954194 1:160209242-160209264 GCTCTGGAGGAGGCAGTGGCTGG - Intronic
916051557 1:161040014-161040036 CATGGGAAGGAGGCAGTAAAGGG + Intronic
917278966 1:173361100-173361122 CTTGTGAAGGAGGAAATGGGAGG + Intergenic
917525838 1:175787791-175787813 CCTGCGAATGAGGCAGGAGAAGG - Intergenic
917980101 1:180263814-180263836 CCTGTGGAGGAGGCTGCTGAAGG + Intronic
920353434 1:205352789-205352811 CCAGTGAAGGAGGGAGTGGCAGG + Intronic
920716336 1:208343812-208343834 CCTGGGAAGGAGGCACAGGATGG - Intergenic
921707901 1:218345460-218345482 CAAGTGAAAGAGGCAGGGGAGGG + Intergenic
922477311 1:225915541-225915563 CCTGAGAAGAGGGCAGTGCAGGG + Intronic
922823013 1:228497297-228497319 TCTGGGATGGAGGCAGTGGTTGG - Intergenic
922846396 1:228688344-228688366 CACATGAAAGAGGCAGTGGAAGG - Intergenic
922936912 1:229430347-229430369 CCTGGGAAGGAGGCAAGGGAGGG - Intergenic
923269986 1:232346817-232346839 CCTGGGAAAGAGGTAGTGGATGG + Intergenic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
924131037 1:240908583-240908605 CCTGGCAGGGAGGGAGTGGAAGG - Intronic
1062983327 10:1744075-1744097 CCTGAACAGGAGGCAGAGGAAGG + Intergenic
1063068982 10:2640173-2640195 CGTGAGAAGGAGCCAGTGGGAGG + Intergenic
1063505628 10:6595767-6595789 CCTTTGAAGGAGACACTGTAAGG + Intergenic
1063667614 10:8073571-8073593 CCTGGGAAGGAGACAGGAGAAGG + Intronic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1063905127 10:10773799-10773821 CATGTGAAGAAGGAAGAGGAGGG - Intergenic
1063975066 10:11408438-11408460 CATGAGAAGGATGCAGTGTAGGG + Intergenic
1064077106 10:12277927-12277949 ACTGGGAAGGCTGCAGTGGAAGG - Intergenic
1065199924 10:23302707-23302729 CCTGTCAAGGAGGAAGTTTAAGG - Intronic
1065271257 10:24036101-24036123 CCAGTGAAGGAGGCAGCTGTTGG - Intronic
1065727003 10:28677023-28677045 CCTGTGCAGGTGGCGGAGGAGGG - Intergenic
1068562757 10:58534330-58534352 CCTTTGAAAGAAGCAGTGGGCGG + Intronic
1068765033 10:60753478-60753500 CTGGAGCAGGAGGCAGTGGAAGG - Intergenic
1068901857 10:62278530-62278552 CCTATGAAGCAGACAGAGGAAGG - Intergenic
1070300211 10:75198135-75198157 CCAGTGTGGGAGGCAATGGAAGG - Intergenic
1070584224 10:77748936-77748958 CCTGTGAAGCAGCCAGGGCAAGG - Intergenic
1070688945 10:78510632-78510654 CCTGTGCAGGAGGCAGACGCTGG - Intergenic
1070730089 10:78821095-78821117 CGTGTGAAGAAGTCTGTGGAGGG - Intergenic
1070741401 10:78905631-78905653 TCTGTGAAGGAGGCAGAGTGGGG + Intergenic
1070843812 10:79506293-79506315 CATGTGAAGGTGGTAGTTGAGGG + Intergenic
1070846337 10:79525109-79525131 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1070927460 10:80235197-80235219 CCTGTGTGGGAGACTGTGGAGGG + Intergenic
1071511410 10:86264719-86264741 GCTCTGAAGGAGGCAGGGGCTGG - Intronic
1071753834 10:88513105-88513127 CTTGTGGAGGAAGGAGTGGAGGG - Intronic
1072268851 10:93756035-93756057 TCTGTGGAGGAGGGAATGGAGGG - Intergenic
1072407913 10:95171657-95171679 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1075025881 10:118982698-118982720 CCCGTGAAGGAGGCAGACCAGGG + Intergenic
1075069510 10:119311449-119311471 CCTGAGATGGGGGCAGTGGGTGG + Intronic
1075253161 10:120900417-120900439 CGTGTGAAGAGGGCAATGGAAGG + Intronic
1075730682 10:124634430-124634452 CGTGGGAGGGACGCAGTGGAAGG + Intronic
1075980530 10:126735012-126735034 CCTGGGATATAGGCAGTGGATGG - Intergenic
1076402622 10:130193785-130193807 AGTGTGAGGGAGGCAGTGGAAGG - Intergenic
1076624988 10:131816256-131816278 CCTTTGAGAGAGGCAGTGGTGGG - Intergenic
1076668950 10:132108612-132108634 CAGGTGAATGAGGCAGGGGAGGG - Intronic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077922555 11:6652590-6652612 CCTGTGGAAGAGGAAGGGGATGG + Intronic
1079640205 11:22795623-22795645 CATTTGAAGGATGCAGTGGTAGG + Intronic
1080970569 11:37270484-37270506 CCTGTGAGGAAGTGAGTGGATGG + Intergenic
1081620944 11:44618907-44618929 CCTGTGATGCAGGCAGCAGAGGG - Intronic
1081689988 11:45071319-45071341 GCTGTGATGGAGGCAGTGATGGG - Intergenic
1081872080 11:46387813-46387835 GCTGGGAGGGAGGCAGTGCAGGG + Intergenic
1082178502 11:49089299-49089321 AGTGCCAAGGAGGCAGTGGAGGG + Intergenic
1082229553 11:49746295-49746317 CATGGGAAGGAGCCAGTGGGAGG - Intergenic
1083929356 11:65831883-65831905 CCAGTGAATGAGGCAGATGAAGG - Intronic
1083934327 11:65862475-65862497 CCTGTGAAGGAGGGAGCGGAGGG - Exonic
1083949336 11:65945455-65945477 CCTGTGGATGAGGCAGAGGCAGG + Exonic
1084404009 11:68960663-68960685 CCTGGGCAGGAGGCAGGGGTGGG + Intergenic
1084624828 11:70298290-70298312 CCTATGCAGGAGGCAGTAGTGGG + Intronic
1084953065 11:72677288-72677310 CCAGTGAGGGAGACAGAGGAGGG - Intergenic
1085384998 11:76152533-76152555 CCTGTGAAGGATTCAGAGGCTGG + Intergenic
1085856103 11:80177910-80177932 CCTGGGAGGGACCCAGTGGAAGG - Intergenic
1086282869 11:85210922-85210944 CCTGTGAAAGATGAAGGGGAGGG - Intronic
1086492041 11:87365247-87365269 CCTGTGAAGCACTGAGTGGAAGG + Intergenic
1086657106 11:89372179-89372201 GAGGGGAAGGAGGCAGTGGAGGG - Intronic
1087489861 11:98811317-98811339 CCTGTGAAGGATACTGTGGAAGG - Intergenic
1088020929 11:105118057-105118079 CCTGTGAGGGTGTCAGGGGAAGG + Intergenic
1088154980 11:106791528-106791550 CCTGTGAAGGAGACAGTCAGTGG + Intronic
1089361023 11:117886650-117886672 CCCGTGAAGGAGGAGGAGGAGGG + Intergenic
1089384662 11:118059890-118059912 CCTGTCACGGAGGGAGTGGGAGG - Intergenic
1090093892 11:123725057-123725079 CCTGTGAAGGGGGGTGTGAAGGG + Exonic
1091026572 11:132146981-132147003 CTTGTGAAGGATGCAGCTGAGGG - Intronic
1091030831 11:132186321-132186343 CAAGGGAAGCAGGCAGTGGATGG + Intronic
1091307065 11:134543050-134543072 CCTGGGAAGGAGGCAGAGAGGGG - Intergenic
1091512927 12:1148426-1148448 TCTGTGAAGGATGAAGAGGAAGG - Intronic
1091724392 12:2835329-2835351 CCTGGGAGGGATGCAGAGGAGGG - Intronic
1091964049 12:4723056-4723078 CTTATGAAGGAGGACGTGGAAGG - Intronic
1092061104 12:5551246-5551268 CGTGAGAAGGAGGCAGGGAAGGG + Intronic
1092843627 12:12565063-12565085 GCAGTGAAGAAGCCAGTGGAGGG + Intergenic
1094635905 12:32227068-32227090 ACTGTGAAGGAGGAGGTGGCTGG + Intronic
1095915115 12:47470431-47470453 CATGTGAAGGACCCAGTGGGAGG + Intergenic
1096183956 12:49566315-49566337 AGTGTCAAGGAGGCAGGGGAGGG - Intronic
1096371977 12:51076410-51076432 CGTGTGAAGCTGGCAGTGGTAGG + Exonic
1096966170 12:55629777-55629799 CCAATAAAGGAGGCAGTTGAGGG + Intergenic
1097046401 12:56190076-56190098 CCTGCGGAGGAAGCAGTTGAGGG - Intergenic
1097312523 12:58136170-58136192 CCTATTGAGGGGGCAGTGGAAGG - Intergenic
1098056330 12:66509790-66509812 CCTGTCACGGGGGCAGGGGAAGG + Intronic
1098483356 12:70991899-70991921 CCAGGGAAGGAGGCAGGGGAAGG - Intergenic
1099207914 12:79749144-79749166 CCTGTGATGGGGGAAGAGGAAGG + Intergenic
1099619859 12:84989126-84989148 CCTAGGAAGGATCCAGTGGAGGG + Intergenic
1100666198 12:96756090-96756112 TCTGTGAAGGAGACAGGGGAAGG + Intronic
1100923478 12:99516582-99516604 CCTGTCAGGGAGGCAGGGGGAGG + Intronic
1101755816 12:107619945-107619967 CCAGGGAAGGTGGCAGGGGAGGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102304340 12:111792956-111792978 CCTGTGAATGAGGCAGGGCACGG - Intronic
1102325724 12:111981682-111981704 CCTGGGAAAGAGGCTGGGGAAGG + Intronic
1102484469 12:113246636-113246658 CTTCTGGAGGAGGCAGTGGAGGG + Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103615197 12:122147471-122147493 CCTGGGATGGAGGCATTGGGTGG + Intergenic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1104388199 12:128369018-128369040 CCTGAGAAGGTGTGAGTGGATGG + Intronic
1104678192 12:130729837-130729859 CCTGGGAAGGTGGCCGTGGAGGG + Intergenic
1104789249 12:131471620-131471642 CCTGGGATGGAGGACGTGGATGG + Intergenic
1104892476 12:132147259-132147281 CCTGGGAAGGGGGCAGTGCAGGG - Exonic
1104999581 12:132681218-132681240 CCTGGAACGGAGTCAGTGGACGG - Exonic
1106048636 13:26169199-26169221 TCTGTGAAGCAGGGAGGGGATGG - Intronic
1106199709 13:27526156-27526178 CCTGTCAAGGAGTCAGATGATGG - Intergenic
1107845302 13:44506475-44506497 CCTGTTGAGGGGGCAGGGGAGGG + Intronic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1109837920 13:67883172-67883194 GCTGGGAAGGGGGCAGAGGAAGG - Intergenic
1110858355 13:80321251-80321273 CCTGTTCAGGAGACAGTGAATGG - Intergenic
1111269022 13:85855317-85855339 CCTGTTGAGGAGACAGTGCAGGG - Intergenic
1112716686 13:102194426-102194448 CCTGTCAGGGGGGCAGTGGGAGG - Intronic
1112803722 13:103139201-103139223 GCTGTGAAGGGGGCATTGCATGG + Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1114527380 14:23375370-23375392 ACCGTGAGGGAGGCAGGGGAGGG - Intronic
1114764934 14:25360215-25360237 CCTGTGAAGAAGGTAGAGGAAGG + Intergenic
1116054011 14:39840246-39840268 CCTGTGAAGGACAAAGTGGGAGG - Intergenic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1117294705 14:54368713-54368735 CCTGGGAAGGGGCTAGTGGATGG + Intergenic
1117377222 14:55127972-55127994 CCTGTGAAGGACTCACTTGATGG - Intronic
1117571711 14:57055510-57055532 ACAGTGAAGGGGACAGTGGATGG + Intergenic
1117890244 14:60413492-60413514 CCTGTCATGGGGGCAGGGGAAGG - Intronic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1117974189 14:61281287-61281309 CCTGTGACGGAGGCAGAGGAGGG - Exonic
1118939253 14:70317418-70317440 TCTGTGAAGGAGGCAGTCCAAGG + Intergenic
1118939261 14:70317509-70317531 TCTGTGAAGCAGGCAGTCCAAGG + Intergenic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119150976 14:72358924-72358946 CTTGGGAAGGATGCAGTGGGAGG + Intronic
1119179313 14:72594255-72594277 GTGGTGGAGGAGGCAGTGGAAGG - Intergenic
1119207197 14:72803224-72803246 CCTGAGAGAGAGGCAGTGGCAGG - Intronic
1120243006 14:81972059-81972081 CCTGTGGAAGAGGCAGTATAAGG + Intergenic
1121210648 14:92206080-92206102 CAGGGGAAGGAAGCAGTGGAAGG - Intergenic
1121303451 14:92890089-92890111 CCAGAGCTGGAGGCAGTGGAGGG - Intergenic
1121420639 14:93810985-93811007 TCAGAGAAGGAGGCAGAGGATGG + Intergenic
1121700039 14:95945680-95945702 CCTGTGCAGGAGGGAGGGAAGGG - Intergenic
1122015964 14:98796854-98796876 TCTGTGAATCAGGCACTGGAGGG - Intergenic
1122930424 14:104930922-104930944 ACTGAGAAGTAGGCAGTGGTGGG - Exonic
1123100627 14:105796590-105796612 TCTGTGAAAGAGGCCATGGATGG + Intergenic
1123151495 14:106185965-106185987 CAGGTGAAGGAGGCTGGGGAGGG - Intergenic
1123416071 15:20096335-20096357 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1123525411 15:21103444-21103466 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1125687821 15:41573824-41573846 CCTGGGAAGGGGGCTCTGGAAGG + Intronic
1126152561 15:45536358-45536380 CCTGTGAAGGGGGCCATGCAGGG - Intergenic
1126400518 15:48264208-48264230 CCTGTAAAGGAGGAAAGGGATGG + Intronic
1127361376 15:58247601-58247623 CTGGTGAAGGAGGCCTTGGATGG + Intronic
1128219885 15:65961634-65961656 CCTGGGAAGGAAGAAGTGGCTGG - Intronic
1129467912 15:75734186-75734208 CCTCTGTGGCAGGCAGTGGAGGG - Intergenic
1129513651 15:76143141-76143163 CCTGAGAAGGCGGGAGGGGAAGG - Intronic
1129672086 15:77613098-77613120 CCTGTGAGGTAGGCAGGGCAGGG + Exonic
1129719348 15:77869545-77869567 CCTCTGTGGCAGGCAGTGGAGGG + Intergenic
1130333033 15:82935883-82935905 TCTGTGGGGGATGCAGTGGAAGG - Intronic
1131176121 15:90210836-90210858 TCTGTGGAGGAGTGAGTGGAAGG + Intronic
1131483628 15:92802586-92802608 CCTAAGAGGGAGGCAGAGGAAGG - Intronic
1131738113 15:95356362-95356384 TCTGTGGGAGAGGCAGTGGAAGG - Intergenic
1131861089 15:96653794-96653816 CAGATGAAGGAGGTAGTGGAGGG + Intergenic
1132221278 15:100107432-100107454 CCTGTGGAGGACACAGTTGAGGG + Intronic
1132252581 15:100345185-100345207 GCTGTGAAAGAGAAAGTGGAAGG - Intergenic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133754932 16:8755324-8755346 TCTGTGTAGGAGGCAGAGGTGGG + Intronic
1134424846 16:14130960-14130982 CATGGGAAGGACCCAGTGGAAGG - Intronic
1134520838 16:14918634-14918656 CAGGCGAAGGAGGCACTGGAGGG - Intronic
1134708508 16:16317285-16317307 CAGGCGAAGGAGGCACTGGAGGG - Intergenic
1134715723 16:16357318-16357340 CAGGCGAAGGAGGCACTGGAGGG - Intergenic
1134951094 16:18351360-18351382 CAGGCGAAGGAGGCACTGGAGGG + Intergenic
1134959034 16:18394841-18394863 CAGGCGAAGGAGGCACTGGAGGG + Intergenic
1135395455 16:22128272-22128294 GCTGTGAAGGAGGAACTGAAGGG + Intronic
1135547151 16:23374035-23374057 CCTGTGATGGAGGCTGGGGTGGG - Intronic
1135922554 16:26664120-26664142 CATGAGGAGGAGGCGGTGGAAGG + Intergenic
1136237143 16:28921536-28921558 ACTGGAAAGGAGGCAGTGGGTGG + Intronic
1137623923 16:49895604-49895626 CCTGTGGAGGAGGCAGGTCAGGG - Intergenic
1138256876 16:55572710-55572732 CCTTTGGAGGATGAAGTGGAAGG + Intronic
1138634840 16:58329996-58330018 CCTGTCGATGAGGCAGGGGAGGG - Intronic
1138654849 16:58485351-58485373 CCTGTGACGGAGGTGGTGGCGGG - Intronic
1139267946 16:65657215-65657237 CCTGTGAAGGAGGCAGATTCGGG - Intergenic
1139276853 16:65735877-65735899 CCTGGGAAGGACCCAGTGGGAGG - Intergenic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1139869154 16:70090124-70090146 CCTTTGAAATAGACAGTGGAAGG + Intergenic
1140333030 16:74076173-74076195 CCTGTGGGGGAGGCAGGGGGAGG + Intergenic
1140343072 16:74184464-74184486 CCTGGGGAGGAGGCAGAGGCAGG + Intergenic
1140386228 16:74542013-74542035 CCTTTGAAATAGACAGTGGAAGG - Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1140937470 16:79687547-79687569 GCTTTGAAGAAGGCAGTGAATGG + Intergenic
1141638883 16:85329808-85329830 CCTGGGAAGAAGGCTGGGGACGG + Intergenic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1141928005 16:87181904-87181926 CCTGTGAAGGGGGCCGGGGCCGG + Intronic
1142105454 16:88299990-88300012 GCTGTGATGGAGGCAGCGCACGG + Intergenic
1142271538 16:89092283-89092305 TCTGTGAGGGTGGCAGTGGGGGG - Intronic
1142360269 16:89622852-89622874 TCTGGGAAGGAGGAAGTGAATGG + Intronic
1142527856 17:557253-557275 CGTGAGAAGGAGGCAGAGGCTGG - Intronic
1143327378 17:6108345-6108367 CCAGGGAGGGAGGCAGTGGGTGG - Intronic
1143335222 17:6167080-6167102 CCTGGGATGGTGGCAGTGGATGG + Intergenic
1143388040 17:6543671-6543693 TCTGTGCAGGAAGCAGTGTAGGG - Intronic
1144056162 17:11542753-11542775 CATCTGAAGGAGGTAGAGGAAGG - Intronic
1145954005 17:28842308-28842330 CCTCTGAACCAGGCAGGGGAAGG - Intronic
1146412239 17:32596409-32596431 GAGGTGAAGGAGGCAGAGGATGG - Intronic
1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG + Intergenic
1147160570 17:38567384-38567406 TCTTTGGAGGAGGCAGTTGAGGG - Intronic
1148846387 17:50532512-50532534 CCTGTTGAAGAGGCAGGGGAAGG + Intergenic
1149168688 17:53783688-53783710 CCTGTCATGGAGTCAGGGGAGGG + Intergenic
1149608270 17:57940191-57940213 CCAGGGAAGGAGGCATGGGATGG - Intronic
1149993483 17:61395539-61395561 TGTGTAAAGGAGGGAGTGGAGGG + Intergenic
1150613754 17:66753371-66753393 CCAGTGGAGGAGTCAGTGGATGG + Intronic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151372901 17:73660240-73660262 CCACTGAAACAGGCAGTGGAGGG - Intergenic
1151666768 17:75549711-75549733 GGTGGGAAGGAGGCAGTGGTGGG - Intronic
1151786320 17:76276811-76276833 CGTGTGAAGGGGCCAGGGGAGGG - Intronic
1151847360 17:76666629-76666651 CCTGGGAAGGCTGAAGTGGAAGG - Intergenic
1151964781 17:77425637-77425659 ACAGAGAAAGAGGCAGTGGAGGG - Intronic
1152536165 17:80951381-80951403 ACTCTGAAGGAAGCACTGGAGGG - Intronic
1154021931 18:10670975-10670997 CCCGTGAAGACGCCAGTGGAAGG - Intronic
1154373158 18:13784762-13784784 GCTGAGGAGGAGGAAGTGGAGGG - Intergenic
1154489545 18:14909118-14909140 GCTGCATAGGAGGCAGTGGAGGG + Intergenic
1155109305 18:22698027-22698049 CCTGTGAAGGATAAAGGGGAGGG - Intergenic
1155132750 18:22954546-22954568 CCTGTGAAGGAAGCTGGGAATGG - Intronic
1155900083 18:31378452-31378474 CCTGTGCAGAAGGCAATGGGAGG - Intronic
1156271417 18:35536568-35536590 AATGTGAAGGAGACAGAGGAGGG - Intergenic
1156446794 18:37242652-37242674 TTAGGGAAGGAGGCAGTGGAGGG - Intergenic
1156501463 18:37562179-37562201 TCTGTGGAGGAGGGAGTGGGTGG - Intronic
1156986722 18:43358346-43358368 CCTATAGAGGAAGCAGTGGAAGG + Intergenic
1157069713 18:44391754-44391776 CCTGTGTAGTAGACAGAGGAGGG + Intergenic
1157301482 18:46482913-46482935 GCTGAGAAGGAGCCAGGGGAGGG - Intronic
1157532933 18:48437405-48437427 CCTGGGAAGGAAGAAATGGAGGG + Intergenic
1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG + Intronic
1159286961 18:66366460-66366482 CATGGGAGGGACGCAGTGGAAGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1159992246 18:74922346-74922368 CCTGGAAAGGAGGCAGAGCAAGG - Intronic
1160402235 18:78619516-78619538 GCTGTGATGGAGGAAGAGGAAGG - Intergenic
1160405560 18:78644115-78644137 CCTGTGGAGGAGGCTGGGAAGGG + Intergenic
1160836771 19:1128287-1128309 CCTGTGCCGGAGGCAGGGGCGGG + Intronic
1161850017 19:6733301-6733323 CCTGCGGAGGGGGCAGTGGTGGG + Exonic
1162176438 19:8833047-8833069 CCTGGGGAGGGGGCAGTGGGTGG + Intronic
1162548539 19:11345628-11345650 CCTGGGAAGGAGGCACCGGGTGG + Exonic
1162562368 19:11424076-11424098 CTTGGGAAGGAGGCCGGGGAGGG + Intronic
1162921592 19:13906378-13906400 CCGGGGAAGGAGGCAGGGCAAGG + Exonic
1162934599 19:13975429-13975451 ACTCTGAAGGTGGCAGGGGAGGG + Intronic
1163094923 19:15050242-15050264 ATTGTGAGGGAGGAAGTGGAAGG - Intronic
1163126530 19:15247198-15247220 CCAGTGAAGGAGGTAATGGAGGG + Intronic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1164589131 19:29496454-29496476 CCTGTCCAGGAGGCTGTGGAGGG + Intergenic
1164836840 19:31360659-31360681 AATGTGAAGGAAGCATTGGACGG - Intergenic
1165006206 19:32809386-32809408 CCTGTGCAGGAGGAAGCAGAGGG - Intronic
1165390033 19:35533592-35533614 CGGGTGAGGGAGGCAGCGGAGGG + Exonic
1165420688 19:35720676-35720698 CTTGGGCAGGAGGCGGTGGAGGG - Exonic
1165791307 19:38494330-38494352 CCTGGGAAGGAGACAATGCAAGG - Exonic
1165985365 19:39764055-39764077 CCTGTCAGGGGGGCAGGGGAAGG + Intergenic
1167672140 19:50859457-50859479 CCTGTGAGGGAGGCTGGGTAAGG - Intronic
1167752538 19:51389335-51389357 GCTGTGCAGGAGGCAGGAGAGGG + Exonic
1167768986 19:51502009-51502031 ACTGAGAGGGAGGCAGTGGGCGG - Intergenic
1168050224 19:53824255-53824277 CCTGTGAATGATGCAATGGAAGG - Exonic
925003567 2:425258-425280 CCTGGCAAGGAGCGAGTGGATGG - Intergenic
925009109 2:468485-468507 CCTGTGCAGGACGCAGCGGGGGG + Intergenic
925317142 2:2935275-2935297 GCTGAGGAGGAGGCAGAGGAGGG + Intergenic
925418166 2:3688188-3688210 GCGGTGAAGCAGGCATTGGAGGG - Intronic
927491834 2:23526045-23526067 CCTCTCAAGGAAGCAGAGGAGGG - Intronic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927911323 2:26901948-26901970 CCTCTGAAAGAGGCTGTGGCAGG + Intronic
928148376 2:28804052-28804074 CCTGAGAAGGAGGATGTGCAGGG + Intronic
928243415 2:29606198-29606220 TCTGTGAGGGAGACAGGGGAGGG - Intronic
929050346 2:37831205-37831227 CCAGGGAAGAAGGCGGTGGAAGG - Intergenic
929549550 2:42880628-42880650 CCTGGGATGGAGGCAGGGTACGG + Intergenic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
931571465 2:63673308-63673330 CCTGTGAAGGATAAAGTGGTAGG + Intronic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
931852280 2:66263711-66263733 ACTGTAAAGAAGTCAGTGGATGG - Intergenic
932353118 2:71047727-71047749 CCTCCGAAGGAGGCAAGGGAAGG + Intergenic
933214321 2:79610693-79610715 CCTGTGAAGAAGGGATGGGATGG + Intronic
933774647 2:85764803-85764825 CCTGTGCTAGGGGCAGTGGAAGG + Intronic
934581430 2:95444048-95444070 AGTGCCAAGGAGGCAGTGGAGGG - Intergenic
934598020 2:95632666-95632688 AGTGCCAAGGAGGCAGTGGAGGG + Intergenic
934883830 2:98007377-98007399 CCTGAGAAGGGGGCTGTGGCTGG + Intergenic
936096412 2:109533514-109533536 CCTGAGGAGGAGGCTGCGGATGG + Intergenic
936475676 2:112837714-112837736 CCTGTCAAAGAGGCAAAGGAGGG - Intergenic
937219926 2:120336906-120336928 GCTCTGAAGGAGGCAGGAGAGGG - Intergenic
937243919 2:120480100-120480122 CCAGTGAAAGAGCCAGTTGAGGG - Intergenic
937774153 2:125755928-125755950 CTTGTGCAGGAGGCAGAGAAGGG + Intergenic
940988488 2:160074017-160074039 ACTAGGAAGGAGACAGTGGAAGG + Intergenic
941008242 2:160269627-160269649 CCTGTGAGGCAGGCAGTGCCTGG + Intronic
941432301 2:165427079-165427101 CCTGGGAAGGAGGTGGGGGATGG + Intergenic
942901450 2:181124756-181124778 TCTGTGAAGGAGGAAGTAGGGGG - Intergenic
944414972 2:199471309-199471331 CCTGGGAAGGAGCCAGGGGTAGG - Intergenic
944490985 2:200257681-200257703 CCTGTGCAGGCAGCTGTGGATGG + Intergenic
944678679 2:202055986-202056008 CCTGTGAAGGAAGATGAGGAAGG + Intergenic
945049605 2:205810705-205810727 GCTGTATAGGAGGCAATGGATGG + Intergenic
946189835 2:218002427-218002449 CTTGAGGAGGAGGCAGTGGTGGG - Intronic
946324442 2:218977460-218977482 CCTGTGAAGGAGTCAATAAAGGG - Intergenic
947169791 2:227299487-227299509 CCTGGGAAGGACCCAGTGGGAGG - Intronic
947969197 2:234307836-234307858 CCTGAGAAGCAGGCAATGAAAGG - Intergenic
948143752 2:235693106-235693128 CTTGGGAAGGAGGCTCTGGAAGG + Intronic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948296282 2:236863050-236863072 CCTGAGAAGAAGGCAGGGCAGGG - Intergenic
948389252 2:237600317-237600339 GCTGTGAAGGAGTCTGTGTATGG - Intronic
948717733 2:239876057-239876079 CCTGCGGAGGAGGCAGGGAAGGG + Intergenic
948847509 2:240690236-240690258 CCTGGGAAGAGGTCAGTGGATGG + Intergenic
948964405 2:241365920-241365942 CCTATGAGGGAGGAAGTGAAAGG - Intronic
1169410793 20:5368142-5368164 ACTGAGAAGGAGTCAGTAGATGG + Intergenic
1169756460 20:9048295-9048317 CCTGTCAAGGGGCCAGTGGGAGG + Intergenic
1170116573 20:12866364-12866386 CCTCTGATGGTGTCAGTGGAGGG + Intergenic
1170187204 20:13604062-13604084 ACTGGGTAGGAGTCAGTGGATGG - Intronic
1170292455 20:14785724-14785746 CCTGAGAAGGAGGCAGACCAGGG + Intronic
1170614577 20:17938381-17938403 CATGGGAAGCAGGCCGTGGAAGG + Intergenic
1171046206 20:21810843-21810865 CTTGGGAAGGTGGCAGTGGATGG - Intergenic
1172327875 20:34051187-34051209 TCTGTGAGGGAAGCAGTGTAAGG + Intronic
1172797299 20:37549631-37549653 GCTGGCAAGGAGGCAGAGGAAGG - Intergenic
1173329076 20:42059234-42059256 CCTGTGAGGAAGGCAGAGCAGGG - Intergenic
1173731677 20:45333246-45333268 CCTGTGAAAGAGCCAGGGGGTGG - Intronic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1173851641 20:46222328-46222350 GCTGTGAGAGGGGCAGTGGAGGG - Intronic
1174049978 20:47760706-47760728 CCTGGGAAGGAGGCATTGAGCGG - Intronic
1174160222 20:48545315-48545337 CCTGTGATGGGGGCACTGGAGGG - Intergenic
1174479033 20:50818063-50818085 CTTTCAAAGGAGGCAGTGGAAGG + Intronic
1175007480 20:55700818-55700840 CATGTGTAGGAGGTAATGGAAGG - Intergenic
1175303016 20:57956314-57956336 CCTGGGAAGGAGACTGTGGCAGG - Intergenic
1175442460 20:59001406-59001428 CCTGTGGAAGAGGGAGTGGAGGG + Intronic
1177696351 21:24578058-24578080 CTTGTTAAGGAGGCAGGGGGAGG + Intergenic
1178255985 21:31052998-31053020 CATCTGAGAGAGGCAGTGGAAGG + Intergenic
1178680507 21:34669554-34669576 GCTGTGAAGGAGGCAGGAGGCGG + Exonic
1179106859 21:38408805-38408827 CATGTGTAGGAGGAAGGGGAGGG + Intronic
1179360696 21:40705699-40705721 CCTGGGAGGGACCCAGTGGAAGG - Intronic
1179712439 21:43271148-43271170 CCTGCGGAGGAGGATGTGGAGGG + Intergenic
1180200366 21:46220489-46220511 CAGGCGAAGGAGGCAGTGCATGG + Intronic
1180674933 22:17580706-17580728 CCTGCGGAGGAGCCAGAGGACGG + Intronic
1180745221 22:18083903-18083925 CCTCTGAAGTTGGCAGTGGAAGG + Intronic
1182286918 22:29254156-29254178 GCCGTGAAGGGGGCAGGGGAGGG - Intronic
1182418541 22:30236987-30237009 CCTGTGCAGAAGGCTGTGGCTGG + Intergenic
1182431538 22:30301836-30301858 CCTAGAAAGGAGGCAGAGGAAGG + Intronic
1182543619 22:31059665-31059687 CCTGAGAAGGAGGATCTGGATGG + Intergenic
1182715860 22:32355904-32355926 GCTGTGCAGGAAGCAGTGCAAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182799645 22:33021233-33021255 CCTGTGAAGTAGGAAGGGCAGGG - Intronic
1183092731 22:35534223-35534245 CCTGTGAAGCATGCAGGGCAGGG - Intergenic
1183130709 22:35832481-35832503 GCTGGGAAGGAGGCAGGGGATGG + Intronic
1183230471 22:36578832-36578854 CCTGTGCTGGAGGGGGTGGATGG + Intronic
1183313929 22:37127033-37127055 CCAGTGGAGGGGGCAGTGGGAGG + Exonic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183780049 22:39993850-39993872 CCCGTGAAAGAGGCAGAGCACGG - Intergenic
1184258596 22:43301635-43301657 GCTCTGAAGGAAGCAGGGGAGGG - Intronic
1184261918 22:43322483-43322505 GATGTTAAGGAAGCAGTGGAAGG - Intronic
1184632068 22:45789558-45789580 CCTGGGAAGGCGCCAGTGAAGGG + Intronic
1184851733 22:47124980-47125002 CCTGTAAAGGAGGGAGGGGCAGG + Intronic
1184894531 22:47399473-47399495 CCAGTGGAGGGGGCAGTGGAAGG - Intergenic
1185156040 22:49194100-49194122 CCTGAGAAGGAGGCATAGGAAGG + Intergenic
1185338581 22:50281742-50281764 CCTGGGGAGGCGGCAGTGGTCGG + Exonic
1185359023 22:50394049-50394071 CCTGTGCAGGCAGCAGTGCATGG + Exonic
949112609 3:280710-280732 TCTGAGAAGGAGTCAGTGAAGGG + Intronic
949394745 3:3602759-3602781 CCTGTGGAGGAAGGAGTGGCAGG + Intergenic
950223356 3:11213588-11213610 CCTGTGATGGAAGAGGTGGAAGG + Intronic
950296777 3:11838790-11838812 TCTGTGAAGGTGGGAGTGGGGGG + Intronic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
950849105 3:16045161-16045183 CAGGTGAAGAAGGCAGTGGCTGG + Intergenic
951229077 3:20155828-20155850 TCTGTGTAGGGGGTAGTGGAGGG + Intergenic
952316992 3:32239684-32239706 CCTGGGAAGGAGGCAGGGCATGG + Intronic
954412743 3:50378097-50378119 CCTGGGGAGGGGGCAGTGGTGGG + Exonic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
955950970 3:64241729-64241751 CCTGTGAAGGAAGCAGAAGAGGG - Intronic
956465064 3:69511818-69511840 CCTGTGCAGGATACAGTGCAGGG - Intronic
957294284 3:78316677-78316699 CATGGGAAGGACCCAGTGGAAGG - Intergenic
957336047 3:78830667-78830689 CGTGGGAGGGAGCCAGTGGAAGG - Intronic
958191983 3:90195432-90195454 TCTGTGAAGGAGCCTATGGAGGG + Intergenic
960155219 3:114291812-114291834 TCTGTGCAGGAGGCTCTGGAGGG + Intronic
960636231 3:119787421-119787443 CCTGTGAGGAAGGCAGGGCAGGG - Intronic
961047964 3:123722280-123722302 CCTGTGGAGGAAGCACAGGAAGG + Exonic
961677853 3:128578457-128578479 CCTGGGGAGGAGTCTGTGGAGGG - Intergenic
961796713 3:129414374-129414396 GCCCTGGAGGAGGCAGTGGAGGG - Intronic
961879274 3:130049297-130049319 CCTTTGAAGGATGAAGTGGGTGG + Intergenic
962284610 3:134075588-134075610 CCTGGGAAGGCCGCCGTGGATGG - Intronic
962391711 3:134977900-134977922 CCTGTGAAGGAGAGAATGGAAGG + Intronic
962604683 3:137023692-137023714 CATGCCAAGGAGGCAGTGCAAGG - Intergenic
962848932 3:139293492-139293514 TATGTGAAGCAGGCTGTGGAGGG - Intronic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
964092674 3:152894734-152894756 CCTGTGAAGGATGAAGGGAAAGG - Intergenic
964276113 3:155010638-155010660 CCTGTGAAGGAGAGAGGGAATGG - Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
965657057 3:170998614-170998636 CCTGTAAAAGAGGCAGGGCAAGG + Intronic
965660645 3:171038467-171038489 CCTATGAAGGAGGCACTGTTAGG - Intergenic
966605508 3:181817864-181817886 CCTGTGAAAGAAGCAAAGGAAGG - Intergenic
967078108 3:186023532-186023554 CCTGAGAAGGTGGAAGTGGGTGG + Intergenic
967310076 3:188097511-188097533 CCTGTGAAATAGGCAGGGCAAGG - Intergenic
967386481 3:188916593-188916615 CCTGGGGAGCAGGCAGTGGGGGG + Intergenic
967806238 3:193716791-193716813 ACTGGGAAGCAGGCAGTAGATGG - Intergenic
968680598 4:1916210-1916232 GCAGTGAAGGAGGCAGTATACGG - Intronic
969210230 4:5681639-5681661 TCTGTGAAGGAGGCAGACGCTGG - Intronic
969323040 4:6424609-6424631 CCTCTGGAGGAGGCATTGGCTGG - Intronic
969721040 4:8893249-8893271 CCCGGGAAGGGGGCAGTGGTGGG - Intergenic
969777615 4:9369521-9369543 CCTGTGAAGAAATAAGTGGAAGG + Intergenic
970289085 4:14552140-14552162 CGTGTGTGGGAGGCAGTGGATGG + Intergenic
970775443 4:19669005-19669027 CCTGGGAAGGTGTCAGGGGAGGG + Intergenic
971092127 4:23357984-23358006 TCCTTGAAGGAGGCAGTGCACGG + Intergenic
971255157 4:25007831-25007853 CCTGCAAAGGAGGAAGTGCATGG + Intronic
971357406 4:25907491-25907513 TGAGTGAAGGAGGCAGTGAAAGG - Intronic
971648496 4:29239579-29239601 ACTGAGAAGGTGGAAGTGGAAGG - Intergenic
971764188 4:30808014-30808036 CTGGTGTAGGAGGCAGGGGAGGG + Intronic
975392810 4:73838910-73838932 GCTGTGAAGGAGTAACTGGAAGG - Intronic
976337567 4:83908324-83908346 ACTGTTAAGGAGGCATTGAAAGG + Intergenic
976496430 4:85735058-85735080 CCTGAAAAGGTGGGAGTGGAAGG - Intronic
977096791 4:92756093-92756115 CCTGGGAAGGATGCAGGGGTGGG - Intronic
980854482 4:138423351-138423373 ACTGTGGAGGTGGCAGTGCAGGG + Intergenic
980874749 4:138650133-138650155 CCTTTGAAGTAGGAAGTAGACGG - Intergenic
981573603 4:146179150-146179172 CCTGAGTAGGAGTCAGGGGAGGG + Intronic
981588295 4:146328162-146328184 CCTGTGCAGGTGGCAGTAGCAGG - Intronic
981661611 4:147173983-147174005 CCTGTGAAGGAGGTGATGAATGG + Intergenic
982267891 4:153556687-153556709 CCTGTGGAGGTGGAAGAGGAGGG + Intronic
983130789 4:164016650-164016672 GCTGGGAAGGATGCTGTGGAGGG + Intronic
983701113 4:170595117-170595139 CTTGTGTAGAAGACAGTGGAAGG + Intergenic
984324398 4:178233681-178233703 CCTGTGGTGGAGGGAGGGGAGGG - Intergenic
984716495 4:182930411-182930433 CCTGTGAAGAAAGCAGTGCAAGG - Intergenic
984810402 4:183791201-183791223 CCTGTGGAAGCTGCAGTGGATGG + Intergenic
985010222 4:185574194-185574216 CCTGGGAAGGAAGCGGAGGAGGG + Intergenic
985027897 4:185757325-185757347 TATGTGAAGGAGGCAGAGCAGGG + Intronic
985045058 4:185932233-185932255 GCTACGAAGGGGGCAGTGGAGGG + Intronic
985679933 5:1250564-1250586 CCTGGGAAGGATGCTGTGCAGGG - Intergenic
985693553 5:1326969-1326991 CCTGTGGAGGAGGAGCTGGATGG - Intronic
985855538 5:2421722-2421744 CCTGTGGAAGAGGGAGTGGTGGG - Intergenic
986103032 5:4631318-4631340 CCTGGGAATGAGGCAGAGAAAGG + Intergenic
987934294 5:24443918-24443940 AATGTGCAAGAGGCAGTGGAAGG + Intergenic
988283672 5:29184143-29184165 CCTGGGAGGGACCCAGTGGAAGG - Intergenic
988539202 5:32094080-32094102 CCTGAGAAGGAGGGAGGGGTTGG + Intronic
988727898 5:33942133-33942155 CCTGTGACTGAGGCAGTGCTGGG - Intergenic
989128381 5:38079209-38079231 CCCATGAAGGAGGCAGGGGCTGG - Intergenic
995033129 5:107502176-107502198 GAAGGGAAGGAGGCAGTGGATGG - Intronic
995731058 5:115242718-115242740 CTTGGGGAGGAGGCAGAGGAGGG + Intronic
996388019 5:122929154-122929176 CCTCTGAAGGAGGCTGGAGAGGG - Intronic
996467873 5:123824687-123824709 CATGGGAAGGATCCAGTGGAAGG + Intergenic
996734744 5:126748294-126748316 CCTGTGTAGGTGGAAGTGGTTGG + Intergenic
996978444 5:129461296-129461318 CCTTTGGAGGAGCCCGTGGAGGG + Exonic
997142555 5:131398048-131398070 ACTGTGAAGGACACAGTAGAGGG + Intronic
997343062 5:133161692-133161714 CATGAGAAGGAGGCAGAGGGAGG + Intergenic
998022163 5:138778830-138778852 TCTCTGAAGAAGGCAGTGGTTGG + Intronic
999070552 5:148739311-148739333 CCTGTGAAGTAGGCAGTGCAGGG + Intergenic
999150764 5:149424457-149424479 CATGTGAAGGAGGCAGGGGTTGG + Intergenic
999244918 5:150148981-150149003 CCTGGGAAGGAGGCAGCAGGAGG + Intronic
999287396 5:150402349-150402371 CCTGAGCAGGGGGCAGGGGAGGG - Intronic
999448942 5:151664238-151664260 GCAGGGAAGGAGGCAGGGGAGGG + Intronic
999482693 5:151963362-151963384 CCTGTGAAGAAGTCAGGGCAGGG + Intergenic
1001963416 5:175894216-175894238 GCTGTGAGGAAGGGAGTGGAGGG + Intergenic
1002018059 5:176341575-176341597 ACAGTGGAGAAGGCAGTGGATGG + Intronic
1002178130 5:177414070-177414092 CCTAAGAAGGAGCTAGTGGAAGG - Intronic
1002350904 5:178582957-178582979 CCTGGGAAGAAGGGAGTGAAAGG - Intronic
1003314871 6:5003451-5003473 GCTGGGGAGGAGGCAGTGGTGGG + Intronic
1003557401 6:7152640-7152662 CCAGAGAATGAGGCACTGGAGGG + Intronic
1004145305 6:13060470-13060492 AATGTGAAAGAGGCAGTAGAAGG + Intronic
1005186981 6:23173576-23173598 TCTGAGAAGGAGGCACTGGCTGG - Intergenic
1006612217 6:35301008-35301030 CCAGTCAAGGAGGAAGTGGTAGG - Intronic
1006992909 6:38230660-38230682 CCGGTGAAGGAAGCAGAGGTTGG - Intronic
1007406854 6:41640299-41640321 TCTTGGAAGGAGGTAGTGGAGGG - Intronic
1007734743 6:43973504-43973526 CGGGTGAAGGAGGAAGTGGTAGG - Intergenic
1008094095 6:47321227-47321249 CTTGTAAAGAAGGAAGTGGAGGG - Intergenic
1008381665 6:50844618-50844640 CCGGTGGAGGTGGCAGGGGAGGG + Exonic
1008393811 6:50983846-50983868 CCTTGGGAGGATGCAGTGGAAGG + Intergenic
1009194185 6:60664805-60664827 CCTGGGGAAGAGGCAGAGGAAGG + Intergenic
1009334412 6:62468821-62468843 CCTGGGAAGGACCCAGTGGGAGG + Intergenic
1009339387 6:62534368-62534390 CCTGTGAAGGAGAAAGGAGAAGG - Intergenic
1009706301 6:67256606-67256628 CCTGTGAGAGGGGCAGTGGGAGG - Intergenic
1011587762 6:88945082-88945104 CCTGAGAAGGAGGCAGGGGTTGG - Intronic
1012013878 6:93829892-93829914 CCTGGGAAGGACCCAGTGGGAGG + Intergenic
1013630806 6:111984229-111984251 GCTGAGGAGGAGGCAGTAGATGG + Intergenic
1014800092 6:125769259-125769281 CCTGGGAAGTAGGCAGTAGATGG - Intergenic
1016215608 6:141598486-141598508 ACTTTGATGTAGGCAGTGGAAGG + Intergenic
1016251216 6:142045250-142045272 GCAGGGAAGGGGGCAGTGGAGGG - Intergenic
1017153305 6:151300582-151300604 CCTGTGGAGAAGGAAGTGGATGG + Intronic
1017482232 6:154869025-154869047 CCTGTGAAGGTGGCTGTAAAAGG + Intronic
1018645287 6:165942457-165942479 CCAGAGAAGGAGGCTGTCGAGGG + Intronic
1019606165 7:1911304-1911326 CCTGAGGAGGAGGGAGAGGAGGG - Intronic
1019624301 7:2008301-2008323 TCTGTGATGGAGGCAGTGGGTGG + Intronic
1020871790 7:13639680-13639702 CCAGTGAGTGAGACAGTGGAGGG + Intergenic
1020899619 7:13989248-13989270 CAGGTGAAGGAGGCGGTGTAGGG - Exonic
1021092198 7:16496812-16496834 CATGGGAAGGACCCAGTGGAAGG - Intronic
1023054865 7:36283332-36283354 CAGGTGAGGGAGGCAGAGGAAGG + Intronic
1023850969 7:44150123-44150145 CCTGTGCAGGAGGTAGTGACAGG - Intronic
1024816807 7:53281003-53281025 CCTATGGAGGAGACAGGGGAAGG + Intergenic
1024837487 7:53539433-53539455 CATGTGAGGGTGGTAGTGGAGGG + Intergenic
1026106111 7:67422068-67422090 CCTGGGAAGGCTGCAGTGGGAGG + Intergenic
1026224916 7:68431829-68431851 CCTGTGTAGCAGGCAGTAAAGGG - Intergenic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026428337 7:70318708-70318730 GCTGTAGAGGAGGCAGAGGAGGG + Intronic
1027661680 7:80995555-80995577 CCTGAGAAAGAGGCTATGGAAGG + Intergenic
1028510546 7:91620718-91620740 CCTGTGACGCAGGGAGTGGTGGG - Intergenic
1030352085 7:108500955-108500977 CCTCAGATGGTGGCAGTGGAAGG - Intronic
1030676432 7:112390596-112390618 CCTGAGAAGTAAGCAGTGCAGGG - Intergenic
1032885036 7:136128375-136128397 CCTTTGAAGGAGTGAATGGAAGG + Intergenic
1033002548 7:137523017-137523039 CCTGTAAAGGAGGAAAAGGAAGG + Intronic
1033807294 7:144969393-144969415 CCTTTAAAGGAGCCACTGGAAGG - Intergenic
1035050787 7:155998087-155998109 GCTGTGCAGGAGCCCGTGGACGG + Intergenic
1035115080 7:156517422-156517444 GCTGTGAAGGAGGCTGTGTGAGG + Intergenic
1035115102 7:156517528-156517550 GCTGTGAAGGAGGCTGTGTGAGG + Intergenic
1035245481 7:157559957-157559979 CCTGTGTTGGAGGGAGGGGAGGG + Intronic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1035819731 8:2578628-2578650 ACTGGGAAGCTGGCAGTGGATGG + Intergenic
1036001118 8:4606056-4606078 CCTGAGAAGGATGCGGTGGTGGG + Intronic
1036678351 8:10852750-10852772 CCCGTGCAGGAGGAGGTGGATGG + Intergenic
1037179901 8:15992719-15992741 GCTGTGATGGTGGCAGTGGGTGG + Intergenic
1037952607 8:23028693-23028715 CCTGAGAAGGTGTCAGGGGAAGG + Intronic
1037963455 8:23116529-23116551 CCTGAGAAGGTGTCAGGGGAAGG - Intronic
1037974670 8:23200851-23200873 CCTGAGAAGGCGTCAGGGGAAGG + Intronic
1038124941 8:24663248-24663270 ACTGAGAAGGAAGGAGTGGAAGG + Intergenic
1038265929 8:26040101-26040123 GCTGTGAAGGAGGTAGTGGCAGG + Exonic
1038307348 8:26416853-26416875 CCTGGGAAGGAGGCAGTCAAGGG - Intronic
1038475081 8:27860323-27860345 CCTGCGAAGGATGCTGAGGACGG + Intergenic
1039446703 8:37638856-37638878 CCAGAGAAAGAGGGAGTGGAGGG + Intergenic
1040444284 8:47477925-47477947 GCTGGGAAGGAGGAATTGGAGGG + Intronic
1041408019 8:57521901-57521923 CCAGTGAAAGAGGCAGACGAGGG - Intergenic
1041894912 8:62913012-62913034 CCCGTGAAAGAGGATGTGGATGG - Intronic
1042194960 8:66223905-66223927 CCTGTGAAGGATAAAGGGGAGGG + Intergenic
1043809472 8:84718651-84718673 GCTGTGAAGGAGGCTGAGGCAGG + Intronic
1044648815 8:94473609-94473631 CCTGTGAAGGAGATAGAGAAGGG + Intronic
1045687078 8:104723183-104723205 CTTGTGAAAGAGACAGTGCAGGG - Intronic
1045892094 8:107169334-107169356 ATTTTGAAGGAGGTAGTGGAAGG + Intergenic
1047030755 8:120877823-120877845 CATGTAATGGAGGCAGGGGAGGG - Intergenic
1049203299 8:141352053-141352075 CAGGTGCAGGAGGGAGTGGAGGG - Intergenic
1049353049 8:142174502-142174524 CCTGAGAAGCAGGCAGCAGAGGG - Intergenic
1049622345 8:143604331-143604353 CCTGGGAACCAGGCAGGGGAGGG + Exonic
1049681685 8:143921542-143921564 GCTGTGAAGGAGGGTGTGGTGGG - Exonic
1052804726 9:33002583-33002605 GCTGTGTAGGGGTCAGTGGATGG - Intronic
1053503695 9:38621992-38622014 CCGGCGCAGGCGGCAGTGGAAGG + Intergenic
1053637875 9:40033341-40033363 AGTGTGAAGGGGTCAGTGGATGG - Intergenic
1053768206 9:41431880-41431902 AGTGTGAAGGGGTCAGTGGATGG + Intergenic
1054546875 9:66343384-66343406 AGTGTGAAGGGGTCAGTGGATGG + Intergenic
1054785591 9:69207037-69207059 CCTGGGCAGGAGGCAGAGTATGG - Intronic
1054871758 9:70053597-70053619 GCAGTGAAGGAGGTATTGGAAGG + Intronic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1055552498 9:77444644-77444666 GCTGTGAAGAAGACACTGGAAGG - Intronic
1055819846 9:80248498-80248520 CCTGGAAAGGACACAGTGGATGG + Intergenic
1057152442 9:92807905-92807927 CCGGTGCAGGCGTCAGTGGAAGG - Intergenic
1057802474 9:98198621-98198643 CCTGTGAAGTGGGCAGTGGGAGG + Intergenic
1058091623 9:100812475-100812497 CCTATGAAAGAGGCAGTAGTAGG + Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1059081219 9:111252501-111252523 CCTGGGAGGGACCCAGTGGAAGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060130824 9:121097375-121097397 CCTGTAAAGGAGGCAGTATAGGG - Intronic
1060493773 9:124103150-124103172 CCAGTGAAGGAAGCAGGGGCTGG - Intergenic
1061044465 9:128157358-128157380 CCTGTGAGTGCTGCAGTGGAGGG - Intergenic
1061667945 9:132171118-132171140 TCTGAGCAGGAGCCAGTGGAAGG + Intronic
1061802496 9:133120229-133120251 CCTGTGATGGATGGAGGGGAGGG - Intronic
1062200711 9:135301328-135301350 CAGGTGCAGGAGGCGGTGGAGGG - Intergenic
1062713361 9:137988795-137988817 CCTTTGGAGGAGGCTGAGGAGGG + Intronic
1203773596 EBV:61262-61284 GCAGGGAAGAAGGCAGTGGACGG - Intergenic
1187247664 X:17567544-17567566 CCTGTCTAGGAGGAAATGGATGG + Intronic
1190066111 X:47242810-47242832 CCAGTGAACGAGGCAGAGGCAGG - Intronic
1190276526 X:48902902-48902924 CCGGTGAAAGAGTCAGGGGATGG - Intronic
1190436405 X:50429930-50429952 CCTCTGAAGCAGGTAGTGAAAGG + Intronic
1190624954 X:52328145-52328167 CATGTGAAGTAGCCATTGGATGG + Intergenic
1190895427 X:54613803-54613825 CCTGTGGAGGTGGCAGGGGCAGG + Intergenic
1192016747 X:67339478-67339500 CCCTTGAAGGAGGCTATGGATGG - Intergenic
1192163642 X:68808815-68808837 ACTGTGAAGGAGGCAGAGAGAGG - Intergenic
1192427009 X:71086159-71086181 CATGTAAAGGAGTGAGTGGATGG - Intergenic
1192587619 X:72331898-72331920 ACTGTAAAGGAGGTAGAGGAGGG - Intronic
1193525865 X:82588097-82588119 CCTATGAAGGAGGCAGAGCAAGG - Intergenic
1193649860 X:84117881-84117903 CCTGTTTTGGGGGCAGTGGAGGG - Intronic
1194054815 X:89118311-89118333 CATGGGAAGGACCCAGTGGAAGG - Intergenic
1195674823 X:107499995-107500017 CATGTTAAAGAGGCGGTGGAAGG + Intergenic
1196654366 X:118201645-118201667 CCAGAGAATGAGGCAGGGGATGG - Intergenic
1199414529 X:147565932-147565954 CCTGTGAAAGATGCAGTAGGTGG + Intergenic
1199860929 X:151800006-151800028 CCAGTGAAGGTGGAAGAGGAAGG - Intergenic
1200010227 X:153114813-153114835 CAGGTGAAGGGCGCAGTGGAAGG + Intergenic
1200029373 X:153285109-153285131 CAGGTGAAGGGCGCAGTGGAAGG - Intergenic