ID: 948213851

View in Genome Browser
Species Human (GRCh38)
Location 2:236214589-236214611
Sequence GGAGGCGGACGCGCGCGACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948213851_948213860 13 Left 948213851 2:236214589-236214611 CCTCGTCGCGCGCGTCCGCCTCC 0: 1
1: 0
2: 1
3: 10
4: 145
Right 948213860 2:236214625-236214647 GCAGCAGCGCGCACAGGCGCAGG 0: 1
1: 1
2: 1
3: 24
4: 210
948213851_948213858 7 Left 948213851 2:236214589-236214611 CCTCGTCGCGCGCGTCCGCCTCC 0: 1
1: 0
2: 1
3: 10
4: 145
Right 948213858 2:236214619-236214641 GCCGCAGCAGCAGCGCGCACAGG 0: 1
1: 0
2: 0
3: 25
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948213851 Original CRISPR GGAGGCGGACGCGCGCGACG AGG (reversed) Exonic
900183898 1:1324259-1324281 GGAGGCGGCAGCGCGCGGCACGG + Intronic
901489449 1:9589164-9589186 GGGGGCGGCGGCGCGCGCCGGGG - Intronic
903829115 1:26164397-26164419 GGCGGCGGAGGCGCGCGGCCCGG - Intergenic
903907593 1:26697161-26697183 GGAGGCGGAGGCGCTGGAGGAGG - Exonic
906525247 1:46489848-46489870 GGAGGCGGCGGCGCGGGCCGGGG + Intergenic
908714265 1:67053657-67053679 GGCGGCTGACGCGCGCGGCCCGG - Intronic
914993100 1:152515472-152515494 GGAGGAGGAGGCGGGCGCCGGGG - Exonic
915393287 1:155562915-155562937 GGAGGCGCACGCGCGAGGGGTGG - Intergenic
917788860 1:178486930-178486952 GGAGGCGGAAGCGCGCGAGTAGG + Intergenic
918015936 1:180632413-180632435 GGAGGCGGCCGGCCGCGGCGGGG - Intronic
918487515 1:185045410-185045432 AGGGGCGGAGGCGCGGGACGAGG - Exonic
919075485 1:192808579-192808601 GGAGGAGGTCGCCCGCCACGAGG - Intergenic
920002375 1:202808480-202808502 GGCGGCGGAGGCGCACGGCGTGG - Exonic
922314902 1:224434220-224434242 GGAGGAGGACGAGGACGACGAGG + Exonic
923611995 1:235504157-235504179 GGAGGCGCAGGCGGGCGGCGGGG + Exonic
924624669 1:245688464-245688486 CGAGGCGGAGGCGCGCGGGGGGG + Exonic
1066022533 10:31318697-31318719 GGGGGCGGACACGCGAGGCGTGG + Intronic
1067091212 10:43266665-43266687 GGCGGGGGACGCGCGCGGGGAGG - Intronic
1067362418 10:45594714-45594736 GGCGGCGGCTGCGCGCGGCGTGG + Intronic
1067596999 10:47565933-47565955 GGAGGGGCGCGCGCGCGGCGAGG + Intergenic
1070708206 10:78656970-78656992 GGCGGCGGAGGGGGGCGACGGGG + Intergenic
1074121699 10:110498172-110498194 GGAGGCGGCGGCGCGCTGCGTGG + Exonic
1075693752 10:124418780-124418802 GGAGGCGGGCGGGCGCGGGGTGG - Intronic
1075768844 10:124916931-124916953 GGAGGCGGCCGCGGGCGCTGCGG - Intergenic
1076991800 11:279555-279577 GAGGGCGGACGCGCGCGACGTGG + Exonic
1076994508 11:291513-291535 GGAGGCCGACGGGGGTGACGGGG + Intronic
1077051533 11:568920-568942 GGGGGCGGGCCCGCGGGACGCGG - Intergenic
1077249922 11:1556583-1556605 GGAGGGGCGCGCGCGCGGCGAGG - Exonic
1078999446 11:16738913-16738935 GGAGGAGGACGCGCCTGAGGTGG + Intronic
1083683096 11:64360188-64360210 GAAGGCGGGCGGGCACGACGCGG + Exonic
1084086352 11:66857047-66857069 GCCGGCGGGCGCGCGCGCCGCGG - Intronic
1088462320 11:110093775-110093797 GGAGGCGGGCTCGGGCGCCGCGG + Intronic
1092045941 12:5431977-5431999 GGGCGCGGGCGCGCGCGGCGCGG + Intergenic
1094536070 12:31324120-31324142 GGAGGTGGCGGCGAGCGACGCGG - Intronic
1096459576 12:51814716-51814738 GGAGGCGCCCGAGCCCGACGTGG - Intergenic
1099393735 12:82112274-82112296 GGAGGGTGAAGCGCGGGACGAGG + Intergenic
1103563256 12:121803623-121803645 GGAGGCGGGCGCGCGGGGCCCGG - Intergenic
1104865310 12:131950043-131950065 GAGGGCGGAGGCGCGGGACGGGG + Intronic
1106776718 13:33016459-33016481 GGCGGCGGCCGCGGGCGGCGCGG - Exonic
1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG + Intergenic
1108396608 13:49996853-49996875 GCAGGCGGAGGCGGGCGACGGGG + Intronic
1112507104 13:99981812-99981834 GGAGGCGGCGGCGCGGGAGGAGG - Exonic
1113120237 13:106917571-106917593 GGAGGAGGACGCGCGGGGCCGGG + Intergenic
1113949972 13:114066405-114066427 GGAGGCGGCCGGGCGAGAGGAGG + Intronic
1117353577 14:54902919-54902941 GGAGGCCGAGGGGCGCGGCGAGG - Intergenic
1118030314 14:61812502-61812524 GGAGGGGGACGGACGCGGCGAGG + Intergenic
1122065993 14:99174885-99174907 GGACGCGGGCGCGGGCGGCGCGG - Exonic
1122558311 14:102593020-102593042 GGAGGCGGCGGCGCCCGAGGCGG - Exonic
1122917543 14:104865836-104865858 GGAGGCGGCCGGGCCCGGCGGGG - Intronic
1124652423 15:31483728-31483750 GGCGTCGGGCGCGCGGGACGAGG - Exonic
1124922304 15:34038886-34038908 GGAGGCGGACGCCGGGGCCGTGG - Exonic
1125180672 15:36878610-36878632 GGAGGCGGGCGCGGGCGGCGGGG + Intergenic
1127868145 15:63048360-63048382 GCAGGCGGGCGCGCGCGGCTGGG - Intronic
1127884763 15:63189547-63189569 GGAGGGGGCCGCGGGCGAGGGGG - Exonic
1130224661 15:82047368-82047390 GGAGGGGGATGCGCGCGGAGAGG - Intergenic
1133219938 16:4315694-4315716 CGAGGAGGACGCGCGCGGCTCGG + Intronic
1136724830 16:32349064-32349086 GGAGTCGGACGGGCCCGGCGGGG - Intergenic
1136843155 16:33555104-33555126 GGAGTCGGACGGGCCCGGCGGGG - Intergenic
1142005982 16:87689820-87689842 GGCGGCGGGCGCGGGCGGCGGGG - Exonic
1203001600 16_KI270728v1_random:168691-168713 GGAGTCGGACGGGCCCGGCGGGG + Intergenic
1203133203 16_KI270728v1_random:1705097-1705119 GGAGTCGGACGGGCCCGGCGGGG + Intergenic
1203153320 16_KI270728v1_random:1855402-1855424 GGAGTCGGACGGGCCCGGCGGGG - Intergenic
1143109440 17:4545085-4545107 CGAGGAGGAGGAGCGCGACGGGG - Exonic
1143183522 17:4998002-4998024 GGCGGCGGACTCGCGCCCCGGGG - Exonic
1143590741 17:7884908-7884930 GGAGGTGGAGGCGGCCGACGAGG + Exonic
1147006315 17:37406831-37406853 GGCGGCGGGCGCGCGGCACGCGG + Intergenic
1147994562 17:44353801-44353823 GGGGGCGGAGGTGGGCGACGAGG - Exonic
1148445256 17:47733568-47733590 GGAGCCGGGCGCGCAGGACGCGG + Exonic
1151797095 17:76353631-76353653 CGGGGCGGGCGCGCGGGACGCGG + Exonic
1152544122 17:80992206-80992228 AGAGGCGGACGCGCGGGCCCCGG - Intronic
1153051819 18:907745-907767 GGCGGCGGCGGCGCGCGGCGCGG - Exonic
1154303848 18:13217345-13217367 GGCGGTGGGCGCGCGCCACGCGG + Intergenic
1157610380 18:48951764-48951786 GGAGGCTCCCGGGCGCGACGAGG - Intergenic
1157613936 18:48975960-48975982 GGCGGCGGGCGCGCGCGCAGCGG + Intergenic
1158730514 18:60017622-60017644 GGAGGCGGCGGCCAGCGACGCGG - Intergenic
1160690390 19:458612-458634 GGAGGCGGACGCGGGTTCCGGGG + Intronic
1160896987 19:1407717-1407739 GGAGGCGGGAGCGAGCGAGGAGG + Exonic
1160904284 19:1445272-1445294 GGAGGCGGCTGCGCGGGTCGAGG - Intergenic
1161210411 19:3062566-3062588 GGGGGGGGACGCGCGCGCCCGGG + Intronic
1161397853 19:4054299-4054321 GGACGGGGACGGGCCCGACGTGG - Exonic
1161582915 19:5090620-5090642 GGGGGCGCACGCGCGCAGCGGGG - Intronic
1161779180 19:6279813-6279835 GGCGGCGGCGGCGAGCGACGCGG - Exonic
1162398407 19:10430959-10430981 GGCGGCGAACGCGGGCGGCGGGG - Intronic
1163442402 19:17328623-17328645 GGAGGAGGACGAGGACGACGAGG - Exonic
1163793278 19:19320798-19320820 GGAAGCAGGCGCGCGAGACGGGG - Exonic
1165427889 19:35755780-35755802 GGAGGTGCACGCGCGCCACGAGG - Exonic
1167347360 19:48954971-48954993 GGAGGCAGACGGGCGGGAGGAGG + Intronic
1168411290 19:56141649-56141671 GGAGGGGGAGGGGCGGGACGGGG + Intronic
1168536096 19:57172065-57172087 GGGGGCGGGGGCGCGCGAGGGGG + Intergenic
926581432 2:14634959-14634981 GGCGGCGGACGCGCGTGGCGGGG - Exonic
930700793 2:54456584-54456606 GGCGGCGGACGGGCGGGAGGAGG + Intronic
931291963 2:60881441-60881463 GGGGGCGGTCGCGCGCGCGGCGG + Intergenic
931881505 2:66575534-66575556 GGAGGCGGAGGCGCGGGAGTGGG + Intergenic
932621760 2:73269055-73269077 TGAGGGGGACGCGGGCGAAGCGG + Exonic
935463055 2:103361895-103361917 GGAGGCGGAGGCGGGAGAGGGGG - Intergenic
937221974 2:120346907-120346929 GGAGGGGGACGCGCGCCCAGAGG - Intronic
938258355 2:129877772-129877794 GGGGGCGGGCGCGCGTGTCGGGG + Intergenic
938258369 2:129877811-129877833 GGGGGCGGGCGCGCGTGTCGGGG + Intergenic
939618584 2:144389825-144389847 GGAGGCGGAGGAGCGGGAAGCGG - Exonic
939969618 2:148644820-148644842 GGAGGCGGCCGCGGGCGCGGGGG + Intronic
948213851 2:236214589-236214611 GGAGGCGGACGCGCGCGACGAGG - Exonic
948916181 2:241035981-241036003 GGGGGCGGAGGCGCGTCACGGGG + Intronic
949014590 2:241702213-241702235 GGGCGCGGCCGGGCGCGACGGGG + Intronic
1168800882 20:642572-642594 GGCGGCGGACGCGCGGGGTGAGG + Intergenic
1170578538 20:17681737-17681759 GGCGGCAGACGGGCGCGACGTGG - Intronic
1173807465 20:45935087-45935109 GGGGGCGGGAGCGCGCGGCGGGG + Intronic
1174017692 20:47502038-47502060 GGAGGCGGTGGCGGGCGAGGGGG + Intronic
1175429141 20:58890366-58890388 GGACACGGACTCGAGCGACGAGG + Intronic
1175994169 20:62804961-62804983 GGACGCGGACGCAGGGGACGAGG + Exonic
1177166823 21:17612815-17612837 GGAGCCGCACGCGCCGGACGAGG - Exonic
1182586300 22:31346023-31346045 GCAGGCGCGCGCGCGCGCCGCGG + Exonic
950345283 3:12287775-12287797 GGGGGCGGCGGCGCGCGACTGGG - Intronic
952867069 3:37861661-37861683 GGGGGCGGCCGCGCGCGCGGGGG - Intergenic
955060246 3:55487212-55487234 GGGCGCGGACGCGCGCGAGCCGG + Exonic
961446237 3:126983035-126983057 GGCGGCGCATGCGCGCGGCGCGG + Intergenic
962129868 3:132660718-132660740 GGAGGCAGGCGCGGGGGACGAGG + Exonic
964358511 3:155871150-155871172 GGAGGCGGGGGCCAGCGACGCGG - Intronic
967849414 3:194070959-194070981 GAAGGCGGCCGCGCGCAACGGGG + Intergenic
968640620 4:1712661-1712683 AGATTCGGCCGCGCGCGACGCGG + Intergenic
968815185 4:2818265-2818287 GGAGGCGGGCGCCCGGGACGAGG + Exonic
969344757 4:6563707-6563729 GGGGGCGGGGGCGCGCGGCGAGG + Intergenic
983656502 4:170090041-170090063 GGACGGGGAGGCGCGCGCCGCGG - Intronic
996785133 5:127229619-127229641 GGAGGCGAGCGCGAGCGACCAGG + Intergenic
997303449 5:132822918-132822940 GGAGGCGGATGCGCTCGTCCAGG + Exonic
1002567575 5:180120337-180120359 GGAGGCGGCCCCATGCGACGTGG - Intronic
1002888169 6:1313417-1313439 GGCGGCGGGCGCGGGCGGCGGGG - Exonic
1003049443 6:2766150-2766172 GGACGCGGACGCGGACGGCGAGG + Exonic
1005826164 6:29632849-29632871 GGAGCCGGGCCCGCGCGCCGAGG - Exonic
1010781153 6:79947342-79947364 GGAGGCGGTGGCGGCCGACGGGG + Exonic
1012457585 6:99424845-99424867 GGAGGCGGGGGCTCGCGACCTGG - Intronic
1013793632 6:113860240-113860262 GGAGGCGGCAGCGGGCGAGGAGG + Exonic
1014272555 6:119349881-119349903 GGAGGGGGATGCGCGGGGCGGGG + Intergenic
1016936154 6:149450826-149450848 CGAGGGGGACGCGCGCGCCCGGG - Exonic
1017672005 6:156777800-156777822 GGAGGCGGGGGCGCGCGGCGCGG + Intergenic
1017877663 6:158537267-158537289 GGAGGCGACCGCGCGCGCTGCGG + Intronic
1017877697 6:158537373-158537395 GGGGGCGGATGGGCGCGGCGGGG + Intronic
1018876573 6:167827017-167827039 GGAGGCGGAGGCGGCCGGCGGGG + Exonic
1024520877 7:50303822-50303844 GGAGGGGGACGCGCGCCGCCGGG - Intergenic
1030033533 7:105389129-105389151 GGAGGCGGAGGCCCGGGCCGCGG - Intronic
1032194029 7:129779704-129779726 GGAGGCGGAGGCGGGCGCCCGGG - Intergenic
1035153341 7:156893012-156893034 GCACGCGGACGCGGGCGGCGCGG - Exonic
1035282548 7:157787055-157787077 GGAGGCGGACGCGGGTGCGGCGG + Intronic
1035282566 7:157787100-157787122 GGAGGCGGACGCGGGTGCGGCGG + Intronic
1035282584 7:157787145-157787167 GGAGGCGGACGCGGGTGCGGCGG + Intronic
1036811232 8:11868449-11868471 GGAGGCGGTCCCGCGAGGCGGGG - Intronic
1040055916 8:43056608-43056630 GGGGCCGGAAGCGCGCGCCGCGG - Intronic
1041686841 8:60652278-60652300 TGAGGCGGGCGCGCGCCGCGCGG - Intergenic
1049452505 8:142669798-142669820 GCAGGCGGGCGCGCGGGGCGGGG - Intronic
1049759801 8:144326795-144326817 TGAGGCCGACGGGCCCGACGCGG - Exonic
1056659800 9:88535352-88535374 GGAGGCGGCGGCGAGCGCCGCGG - Exonic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1061095826 9:128456373-128456395 GGAGGGGGACGAGCGCAACGCGG - Intronic
1061196706 9:129110707-129110729 GGAGGAGGACTCGCGAGGCGGGG + Exonic
1061208537 9:129177737-129177759 GGACGCGGAGGCGCGCGAGCCGG - Exonic
1061610036 9:131740017-131740039 GGCGGCGGGCGCGCGGGAGGCGG - Intronic
1062081707 9:134627571-134627593 GGAGGGTGACGTGCGGGACGGGG + Intergenic
1062574496 9:137200051-137200073 GCAGGCGGGCGCCCGCGCCGCGG + Exonic