ID: 948216713

View in Genome Browser
Species Human (GRCh38)
Location 2:236237814-236237836
Sequence GTGCAGGGCGCCGCGGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948216705_948216713 -6 Left 948216705 2:236237797-236237819 CCCCCGAGGCAGGCCTCGTGCAG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG 0: 1
1: 0
2: 0
3: 31
4: 281
948216710_948216713 -9 Left 948216710 2:236237800-236237822 CCGAGGCAGGCCTCGTGCAGGGC 0: 1
1: 0
2: 2
3: 43
4: 268
Right 948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG 0: 1
1: 0
2: 0
3: 31
4: 281
948216706_948216713 -7 Left 948216706 2:236237798-236237820 CCCCGAGGCAGGCCTCGTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 146
Right 948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG 0: 1
1: 0
2: 0
3: 31
4: 281
948216708_948216713 -8 Left 948216708 2:236237799-236237821 CCCGAGGCAGGCCTCGTGCAGGG 0: 1
1: 0
2: 1
3: 19
4: 246
Right 948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG 0: 1
1: 0
2: 0
3: 31
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948216713 Original CRISPR GTGCAGGGCGCCGCGGCCGC CGG Exonic
900125542 1:1067499-1067521 GGGCAGGGCCTCGCGGGCGCAGG + Intergenic
900191836 1:1355394-1355416 GGGCAGGGGTCCGGGGCCGCGGG - Intronic
900435302 1:2628286-2628308 GTGCAGGGCGTCCCGGCCCGGGG - Intronic
900745253 1:4356450-4356472 GTGCAGGGCCCCCGGGCTGCAGG - Intergenic
901272289 1:7961753-7961775 GGCCGGGGCGCCGCGTCCGCAGG + Intronic
901426069 1:9182960-9182982 GGGCAGGGCGCCGGGCCGGCGGG - Intergenic
901597852 1:10399294-10399316 GGGCAGGGGGCCGGGCCCGCAGG - Intronic
902385560 1:16073602-16073624 GAGCCGGGCGCGGCGGCAGCAGG - Exonic
902559456 1:17267862-17267884 CTGCAGGGCCCTGCGTCCGCAGG - Exonic
902793384 1:18784417-18784439 GGGCTCGGCGCCGCGGCCGACGG + Intergenic
902821970 1:18949016-18949038 GTGCAGGGTGCTGGGGCCCCAGG - Intronic
903279018 1:22239503-22239525 GTGCAGGGCCAGGCAGCCGCTGG + Intergenic
903350091 1:22711723-22711745 ACGCTGAGCGCCGCGGCCGCGGG - Intronic
903724662 1:25431385-25431407 GGGCAGGGCGCGGCGGGCGCTGG + Intronic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
904941006 1:34164865-34164887 GTGGGGCGCGCGGCGGCCGCTGG + Intronic
905202153 1:36322603-36322625 GAGCCGGGCCCCGGGGCCGCGGG + Exonic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
906102612 1:43272806-43272828 GCGCCGAGCGCCGCGGCTGCTGG - Exonic
912514779 1:110210792-110210814 GCGCAGGGCGAGGCGGCAGCTGG - Intergenic
913942057 1:125118729-125118751 GGGCAAGGAGCCGCGGCAGCGGG - Intergenic
914386263 1:147172605-147172627 GTCCCGGGCGCCGAGGCTGCAGG - Intergenic
914755104 1:150557980-150558002 GTGCTGGGTGCCGGGGCCACAGG - Exonic
915934818 1:160084278-160084300 CTCCAGGTCGCCGCGGCCGTAGG - Exonic
917790506 1:178496177-178496199 ATGCAGGGCGCCCCTCCCGCCGG + Intergenic
924527354 1:244864063-244864085 GAGCAGGAGGCCGCGGCCGGCGG - Exonic
1062893380 10:1083784-1083806 ATGCAGGGCAGCGCGGCCGTAGG - Intronic
1063298055 10:4826286-4826308 GTGCGGGGCGGCGGGGCGGCGGG + Exonic
1063429546 10:5977205-5977227 GTGCCGGGAGCCGGGGTCGCAGG - Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1065188707 10:23192355-23192377 GGCCAGAGCGCAGCGGCCGCGGG + Exonic
1067091247 10:43266745-43266767 GGGCAGGGCGCGGCGTGCGCGGG - Intronic
1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG + Exonic
1070032665 10:72692367-72692389 GGGCAGGCCGCCGGGGCAGCAGG + Intronic
1073063521 10:100745672-100745694 GCGCACGCCGCCGCGGCCGAAGG - Intronic
1073297634 10:102450751-102450773 GAGCTGGGCGCCGTGGCCGGAGG - Exonic
1073812437 10:107164961-107164983 GCGCCGGGACCCGCGGCCGCGGG - Intergenic
1075658485 10:124176993-124177015 GTGCAGGGCTCCTTGGCTGCAGG + Intergenic
1075991586 10:126843063-126843085 GTCCAGGGCGCCTTGGCCTCGGG + Intergenic
1076853299 10:133103481-133103503 GTGCAGGCCGCCGGGGCGGCGGG - Intronic
1077225620 11:1437940-1437962 GTGGAGGGAGCCCAGGCCGCCGG - Intronic
1077315472 11:1917642-1917664 GTGCAGGCCCTCGAGGCCGCTGG + Intergenic
1078679633 11:13463371-13463393 GTTGAGGGCGCGGCGGCCACGGG + Intergenic
1079090445 11:17476771-17476793 GGGCATGGCGGCGCGGGCGCGGG + Exonic
1081709774 11:45209236-45209258 GTGCAGGGCGCGGCTTCCCCAGG + Intronic
1081863503 11:46347445-46347467 GTGCCGCCAGCCGCGGCCGCAGG - Intronic
1083428693 11:62602539-62602561 GTGCTGGGCGCTGGGGGCGCGGG - Exonic
1084086984 11:66859330-66859352 GTGCAGGCCTCCCCGGCAGCAGG + Intronic
1084156790 11:67317676-67317698 CTGCCGGGCGCTGCGGGCGCAGG - Intergenic
1084171175 11:67401685-67401707 GGCCAGGGCGCGGCGGACGCGGG + Intronic
1084263241 11:67991886-67991908 GTGCGGGGCGAGGCGGCCGCGGG - Intronic
1084284251 11:68121282-68121304 GGGCAGGGGGCCGCGGCGGTTGG + Intronic
1084892568 11:72243856-72243878 GGGCAGGGCGGCCCTGCCGCGGG + Exonic
1085773221 11:79342861-79342883 CTGCAGGGCGCCAGGGACGCAGG - Intronic
1087977212 11:104564995-104565017 GAGCAGGGGGCAGCGCCCGCCGG + Intergenic
1088279449 11:108121641-108121663 GAGCAGGGGGCTGCGGCTGCGGG - Exonic
1094041715 12:26126122-26126144 GCGCCGAGCGCCGCGGCTGCAGG - Intronic
1095476245 12:42589792-42589814 GCGCCGGGCCCCGCGGCCGAGGG - Intronic
1095689127 12:45068126-45068148 CTGCAGGGCGCGGAGGCCTCAGG + Intergenic
1096792755 12:54055089-54055111 GTGCTGGGCGCAGCGCCGGCCGG - Exonic
1097225760 12:57476071-57476093 GTGCAGGACGTTGCGGCGGCTGG + Exonic
1097269656 12:57766175-57766197 GTGCAGGGCGCCGCGCACTTCGG - Exonic
1102025965 12:109714482-109714504 GCGAAAGGGGCCGCGGCCGCCGG + Exonic
1103518257 12:121521226-121521248 TTGCTGGGCGCCGCTGCCCCAGG - Intronic
1104947595 12:132423549-132423571 GGGCAGGGAGCAGCGGCCCCGGG + Intergenic
1104989595 12:132618428-132618450 GTGGGGGGCGCCGCGGAGGCCGG + Intergenic
1110573065 13:77026937-77026959 GCGCGGGGGGCCGCGGCTGCGGG - Exonic
1110630110 13:77697884-77697906 CCCGAGGGCGCCGCGGCCGCCGG - Intronic
1110705970 13:78602240-78602262 GTCGTGGGCGCCGCCGCCGCCGG + Exonic
1117302233 14:54441156-54441178 GTCCGGGCCGCCACGGCCGCCGG - Intronic
1117424496 14:55580457-55580479 GGGCGGGGGGGCGCGGCCGCGGG + Intronic
1117647182 14:57865301-57865323 GTGCGGGGCGCTGGGGACGCAGG - Intronic
1117912584 14:60649247-60649269 AGGCAGGGGGCGGCGGCCGCAGG + Exonic
1118265947 14:64294957-64294979 GAGAAGGGCGCCGTGGCCGGAGG - Intronic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1119387870 14:74269147-74269169 GTGCAAGGCGCCGTGGCCCAGGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122543295 14:102509481-102509503 GAGGAGGGGGCGGCGGCCGCGGG + Intronic
1122577499 14:102751362-102751384 GTGCAGGGTGCAGCGCCCGCCGG + Intergenic
1122779156 14:104136365-104136387 GTGCGGGGCGCGGCGGCGGCGGG + Intergenic
1122788234 14:104173709-104173731 GTGCAGGCGGCTGCGGCCTCCGG - Exonic
1123787446 15:23687338-23687360 GGGCAGGGCGGGGCGGCGGCGGG + Intergenic
1124426893 15:29570429-29570451 GGGCTAGGCGCTGCGGCCGCCGG - Intronic
1124427050 15:29570954-29570976 GCGCAGCGCGGCGCGGCCGGCGG - Intergenic
1124652374 15:31483498-31483520 GCGCAGGGCGCCGAAGCCGTTGG + Exonic
1126406931 15:48331646-48331668 GTGCTGCGCGGCGCGGCCGAGGG - Exonic
1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG + Intergenic
1127763473 15:62164087-62164109 GCGCAGTGCCCGGCGGCCGCAGG + Exonic
1129116388 15:73367681-73367703 GTGGAGGGAGGCGCGGCTGCCGG - Exonic
1129385891 15:75195964-75195986 GCCCAGGGCGCCGAGGCCGGGGG + Intronic
1131517603 15:93089306-93089328 GGGCCGGGCGCCCGGGCCGCGGG + Intergenic
1132314493 15:100880029-100880051 GCGCAGGGGCCCGCGGCCGTCGG - Intronic
1132389668 15:101429023-101429045 GTGCAGGAAGCCTCGGCCACTGG - Intronic
1132815900 16:1826469-1826491 GTGGAGGCCGCGGCGGACGCAGG + Intronic
1132869291 16:2108560-2108582 GCGCTGGGCGCCCCGGCCGCTGG + Exonic
1132893245 16:2214821-2214843 GGGGAGGGCGCCGCGGCGGGCGG - Intergenic
1132926070 16:2429647-2429669 GCGCAGGGAGCCCCGGCGGCCGG + Intronic
1133055169 16:3142177-3142199 GAGCAGGGTGCCGGGGCCGATGG - Exonic
1133219958 16:4315760-4315782 AGGGAGGGCGGCGCGGCCGCGGG - Intronic
1134718123 16:16367038-16367060 GCGCCGGGCACCCCGGCCGCTGG - Intergenic
1134956629 16:18385121-18385143 GCGCCGGGCGCCCCGGCCGCTGG + Intergenic
1136221896 16:28834562-28834584 ATGCAGGCCGCCGCGGCTGCTGG + Exonic
1136409044 16:30065883-30065905 GTGCAGGGTGCGGCGGCAGAGGG - Intronic
1136418296 16:30116768-30116790 GTGAAGGGCTCCTCGGCCACTGG + Exonic
1137036811 16:35575157-35575179 GTGCAGGGCCCGGCGCCGGCGGG + Intergenic
1137267973 16:46884353-46884375 GGGCCGGGCGGCGCGGGCGCCGG + Intergenic
1137926602 16:52546987-52547009 GGGCCGGGCGCCGGGGGCGCGGG + Exonic
1140221505 16:73047803-73047825 GCGCATGGCGGCGCGGCCCCCGG - Exonic
1141642400 16:85348914-85348936 GGGCAGGGCGCCGCAGCTGGGGG - Intergenic
1142120248 16:88383407-88383429 GGGCCGGGCGCCGCGAGCGCTGG - Intergenic
1142206624 16:88785842-88785864 TGGCAGGGCGCCGCGGCAGCAGG - Intergenic
1142419985 16:89964137-89964159 GTGCAGGGCGTCACGGCTGCTGG + Intronic
1142523176 17:519238-519260 GTGCGGGGAGCCGCTGGCGCAGG + Exonic
1143830304 17:9645685-9645707 GCGCAGGGAGCGGCGGCGGCGGG - Exonic
1145878143 17:28335348-28335370 CTGCAGCGCGCTGCCGCCGCGGG - Exonic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146914824 17:36671886-36671908 GTGCAGGGCGCCGTGGAGGCAGG + Intergenic
1147907595 17:43833049-43833071 GAGCTGGGCGCCGCGGCGGGAGG - Intronic
1148807887 17:50273360-50273382 GTGCTGGAGGCGGCGGCCGCAGG + Intronic
1149800806 17:59565695-59565717 GGGCAGGGCGCCAAGGCGGCAGG + Exonic
1150002698 17:61451754-61451776 GCCCAGGGGGCCGCGGGCGCTGG - Intergenic
1151555226 17:74843202-74843224 GCGCAGGGCTCCGCAGCCCCCGG - Exonic
1151707759 17:75779586-75779608 GCGCCGCGCGCCGCGGCCGTTGG - Intronic
1152433026 17:80260282-80260304 GTGCTGGGCGCCGGGGCGGGGGG + Intergenic
1152469123 17:80481289-80481311 GTGCAGGGCACAGCATCCGCAGG + Intergenic
1152596369 17:81239589-81239611 GTGCAGGCCTCCACGGCCCCGGG + Exonic
1154367859 18:13727218-13727240 GAGCAGGCCGCCAGGGCCGCCGG - Intronic
1156788111 18:40939806-40939828 CTGCAGGGGGCCGTGGCCGGTGG - Intergenic
1157338167 18:46756514-46756536 CTACCGGGCGCCGCGGGCGCGGG + Exonic
1157464293 18:47930773-47930795 GTGCGTGGCGCCGCGGCGGCCGG - Intronic
1160740854 19:685274-685296 GTGCAGGGCGTGGGGGCTGCTGG - Intergenic
1160788701 19:913052-913074 GGGCGGGGCGCGGCGGGCGCCGG - Intronic
1160791910 19:927091-927113 GTGCAAGGCCCCGGGCCCGCGGG - Intronic
1160807874 19:1000589-1000611 GGCCAGGGCGGCGCGGGCGCGGG - Exonic
1160810389 19:1010648-1010670 GAGCTGGGCGCCGCTGCCACAGG + Exonic
1161257934 19:3320204-3320226 GTGCAGGGCACTGTGGCCTCCGG + Intergenic
1161539155 19:4839291-4839313 GTCCAGGGCCTCGCGGGCGCTGG + Exonic
1162907070 19:13830454-13830476 GTGCTGGACGCGGCGGCCGGCGG + Exonic
1162935425 19:13979363-13979385 GTGCAGGCCCCTGAGGCCGCAGG - Intronic
1163602637 19:18258090-18258112 CTCCAGGGCCCCGCGGACGCTGG - Exonic
1163767189 19:19170261-19170283 GATCAGGGGCCCGCGGCCGCAGG + Intronic
1165160219 19:33811589-33811611 CTGGAGGGCTCCGCGGACGCCGG - Intronic
1165242878 19:34481782-34481804 GAGCAGGGCGCCGCGTCCCCCGG + Exonic
1165924837 19:39320626-39320648 GGGCAGGGCGCCGCACACGCCGG + Intergenic
1166092519 19:40519538-40519560 CTGCAGGGCGCCGCCGGCCCGGG - Exonic
1166883019 19:45940398-45940420 GTCCTGGCCGCCGTGGCCGCCGG - Exonic
1168445032 19:56404308-56404330 GGGCAGGCCGCAGGGGCCGCTGG - Intronic
1202669624 1_KI270709v1_random:39474-39496 GGGCAAGGAGCCGCGGCTGCGGG - Intergenic
926090495 2:10045738-10045760 GGTCAGGGCGCCGCGGCCACTGG + Intronic
926155000 2:10448603-10448625 GGGCGGGGCGAGGCGGCCGCAGG - Intergenic
928094179 2:28393800-28393822 CTGCTGGCCGCCGCCGCCGCTGG - Exonic
929775392 2:44928363-44928385 GGGCAGGGCGGAGCGGCGGCCGG - Intergenic
933751130 2:85602620-85602642 GAGCAGGGTGCGGCGGCGGCGGG - Intronic
937950995 2:127387898-127387920 GACGAGGGTGCCGCGGCCGCTGG - Intronic
939085724 2:137716111-137716133 GAGCAGGGGGCGGCGCCCGCTGG - Intergenic
939969616 2:148644818-148644840 GTGGAGGCGGCCGCGGGCGCGGG + Intronic
940300894 2:152175711-152175733 GTCTAGGGAGCCGCGGCCGCGGG - Exonic
944154047 2:196592852-196592874 CCGCAGGGCGCCGGGGCCGCGGG - Intronic
944412849 2:199459319-199459341 CTGCCGGCGGCCGCGGCCGCGGG - Intronic
945080881 2:206085539-206085561 GGGCAGGGCGCGGCTGCCGTGGG + Intronic
947724210 2:232387452-232387474 CTCCATGGCGCCGAGGCCGCCGG + Intergenic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
948467433 2:238159062-238159084 CTGCTGGCCGCCGCCGCCGCGGG + Exonic
1168998073 20:2147250-2147272 GTGCAGGGCGAGGAGGCCGTAGG - Exonic
1169191454 20:3661129-3661151 GCGCAGGGCCCGGCGGCAGCGGG + Exonic
1170150304 20:13221083-13221105 GTGCGGGGCGGCGCGGCAGGCGG + Intergenic
1170460604 20:16573507-16573529 GTGCAGAGGGGCGGGGCCGCGGG + Intergenic
1170639382 20:18138159-18138181 GTGCAGGGCCGCGCCACCGCGGG - Intronic
1170999320 20:21396996-21397018 ATGCGGGGCGGCGCGGCCACCGG - Exonic
1171123708 20:22584899-22584921 GTGCGGGGCGCCGCGGCGGTGGG - Intronic
1173166239 20:40688968-40688990 GCGCAGCGGGCCGGGGCCGCCGG + Exonic
1173684010 20:44910118-44910140 GGGCAGGGGGCCGGGGCTGCGGG - Exonic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1173831163 20:46089632-46089654 GTGCGGGGCGCGGCCGCCTCCGG - Intronic
1173909153 20:46651367-46651389 GTGGAGCGCGCGGCGGCTGCTGG - Exonic
1174204248 20:48827766-48827788 GAGCTGGGCGCCGCGGCGCCAGG + Exonic
1175429129 20:58890319-58890341 GAGGAGGGCGCCGCCGCCGGGGG + Intronic
1176194520 20:63831121-63831143 AGGGCGGGCGCCGCGGCCGCCGG + Intronic
1177188065 21:17819437-17819459 GGGGAGGGTGGCGCGGCCGCGGG + Intergenic
1177338098 21:19759970-19759992 GTGCAGCGCGCCACAGCCACTGG + Intergenic
1179585792 21:42373395-42373417 GTGCAGGGAGCAGGGGCCCCAGG + Intronic
1179888247 21:44323675-44323697 GAGCAGGGCTGGGCGGCCGCCGG + Intronic
1180043492 21:45292332-45292354 GTGCCGGGCGCCGCAGCAGGGGG + Intergenic
1180736821 22:18023766-18023788 GTGCAGGGCCCCTCTGCCGCAGG + Intronic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1181026685 22:20131323-20131345 GTGGAGGGCCCGGCGCCCGCTGG + Intronic
1181026791 22:20131641-20131663 GGGCAGGACCCCGCGGCCTCGGG - Intronic
1182094079 22:27614525-27614547 GTCACGGGCGCCGCGCCCGCGGG + Intergenic
1182472308 22:30556067-30556089 GAGCAGGACGCTGCGGCCTCCGG + Exonic
1183077554 22:35436535-35436557 GTGCAGGGTGCAGTGGGCGCTGG - Intergenic
1183219961 22:36506298-36506320 GTGCTGGGCGCTGGGCCCGCGGG - Exonic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1184118907 22:42437867-42437889 GTGCAGGGCGTGGCGGCTGCAGG + Intergenic
1184276555 22:43412173-43412195 GGGCGGGGCGCGGCGGGCGCGGG + Intronic
1184479115 22:44736882-44736904 GCGGAGGGCGCGGCGGCCGGCGG + Exonic
1185025145 22:48404687-48404709 CTGCAGGGCGCTGGGGCCTCTGG + Intergenic
1185040292 22:48500556-48500578 GTGGAAGGCGCCGGGCCCGCAGG + Intronic
1185056274 22:48580052-48580074 GTACACCGTGCCGCGGCCGCTGG - Intronic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
1185342523 22:50298061-50298083 GGGCAGGGCGGCGGGGCAGCCGG - Intronic
950316389 3:12004933-12004955 GTGCCGGGCGCCGCCGCCCTCGG + Intronic
952816559 3:37452318-37452340 GAGCAGGGCGCCGAGCGCGCGGG - Exonic
954882638 3:53846173-53846195 GCGCGGGGCGCCGGCGCCGCCGG - Exonic
954912526 3:54121840-54121862 CTGTCGGGCGCCGCGGCCGGAGG + Intergenic
956414661 3:69013507-69013529 GCGCAGAGCGCTGCGGCGGCGGG + Intronic
957078680 3:75619828-75619850 GTGTGGGGCGAGGCGGCCGCGGG - Intergenic
960896760 3:122514425-122514447 CTGCGGGGCGCCGAGGCAGCGGG - Intronic
961067015 3:123884247-123884269 CGGCGGGGCGCCCCGGCCGCAGG + Intronic
962677082 3:137765172-137765194 GAGTAGGGCGCCGAGGCCGGCGG - Exonic
962738864 3:138348665-138348687 CCGCCGGGCCCCGCGGCCGCCGG - Intronic
962808998 3:138946169-138946191 GTGGCGGGCGCCGGGGCCGACGG - Exonic
966182237 3:177197669-177197691 GGGAGGGGCGCCGCGGACGCCGG + Intergenic
968025998 3:195442963-195442985 GCGAAGGGCGCCTCGCCCGCTGG + Exonic
968199463 3:196739969-196739991 GCGCAGGACTCCGCCGCCGCTGG + Exonic
968230781 3:197003433-197003455 GCCCCGGGCGCCGGGGCCGCTGG + Exonic
968512957 4:1003348-1003370 GGGCGGGGCGCCGCGGCCACCGG - Exonic
968583304 4:1404744-1404766 GAGCAGGCCGCGGCTGCCGCTGG - Intronic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
968965317 4:3766469-3766491 CTGCTGGGCGCCGCGGTCCCCGG + Exonic
969021761 4:4143796-4143818 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
969379111 4:6782810-6782832 CTGCCGGGCGGCGCGGCGGCCGG - Exonic
969563999 4:7966941-7966963 GTGCCGGGCGCCGAGGCCAGGGG - Exonic
969732107 4:8963619-8963641 GTGCGGGGCAAGGCGGCCGCGGG + Intergenic
969791702 4:9497704-9497726 GTGCGGGGCGAGGCGGCCGCGGG + Intergenic
971424823 4:26505195-26505217 GGGCAGGGGGCCGGGGCAGCGGG + Intergenic
975779057 4:77819920-77819942 GCGCCGGCGGCCGCGGCCGCGGG - Intergenic
977809846 4:101346553-101346575 GGGAAGGGCGCCGCGGGGGCGGG + Intronic
983398495 4:167233915-167233937 GAGGCGGGGGCCGCGGCCGCCGG - Intronic
985523706 5:391327-391349 GCGCAGGGCGAGGCGGGCGCAGG + Intronic
985523734 5:391425-391447 GGGCAGGGCGAGGCGGGCGCAGG + Intronic
985523749 5:391474-391496 GGGCAGGGCGAGGCGGGCGCAGG + Intronic
985523873 5:391923-391945 GTGCAGGGCGAGGCAGGCGCAGG + Intronic
985523910 5:392078-392100 GTGCAGGGCGAGGCAGGCGCAGG + Intronic
985523998 5:392429-392451 GTGCAGGGCGAGGCAGGCGCAGG + Intronic
985678997 5:1246295-1246317 CTGCAGGACGCCCAGGCCGCGGG - Intergenic
987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG + Exonic
989475770 5:41870741-41870763 GTTCAGGGCCCTCCGGCCGCGGG + Intergenic
992769604 5:80035214-80035236 GAGCAGCGAGCCGGGGCCGCAGG - Intronic
994072885 5:95621074-95621096 GACCAGGGCGCTGCAGCCGCGGG - Exonic
997304918 5:132830073-132830095 GCGCAGGCCCCGGCGGCCGCAGG + Intronic
998849344 5:146338819-146338841 GTGGAGGGGGCGGCCGCCGCGGG + Intronic
999126194 5:149247876-149247898 GTGCAGGGCTTCCCGGCTGCTGG - Exonic
1002006359 5:176238181-176238203 GTGCGAGACGCCGAGGCCGCGGG - Intergenic
1002220018 5:177672455-177672477 GTGCGAGACGCCGAGGCCGCGGG + Intergenic
1002581006 5:180209348-180209370 GTTCAGGCCTCCGCGGCGGCTGG + Intergenic
1002638330 5:180618985-180619007 CTGCGGGGCGCCGCGGGCGGCGG - Intronic
1003087108 6:3068876-3068898 GTGGAGGCCGGGGCGGCCGCGGG + Intronic
1003325086 6:5085185-5085207 GGGCGGGGAGGCGCGGCCGCTGG - Exonic
1006725412 6:36196549-36196571 GTGCCTGGCGCGGCGGCGGCCGG - Intergenic
1007644363 6:43369165-43369187 CCTCAGGGCACCGCGGCCGCCGG - Exonic
1011734243 6:90296347-90296369 GGGAAGGGAGCCCCGGCCGCCGG - Intronic
1015773461 6:136791967-136791989 GTGGAGAGCGCCGCTGCCCCTGG - Exonic
1015965645 6:138693290-138693312 GCGCTGGGCGCGGCAGCCGCGGG - Intergenic
1018942601 6:168319455-168319477 CCGCAGGGCGCGGCGGGCGCGGG + Exonic
1019230235 6:170554391-170554413 GTGGCGGGCGCCTGGGCCGCCGG + Exonic
1019559868 7:1650697-1650719 CTGCAGGGCTCTGCGGCAGCGGG - Intergenic
1020017900 7:4842189-4842211 GTGCAGGGCGCCGGGGCAATGGG + Intronic
1020105793 7:5421718-5421740 GCGCAGCGCGCCACCGCCGCCGG - Intronic
1020309179 7:6855826-6855848 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
1021998332 7:26201613-26201635 GGGCCGCGCGCCGCGCCCGCTGG - Intronic
1022103813 7:27184615-27184637 GCGGAGGTCGCCGTGGCCGCCGG + Exonic
1023831459 7:44040928-44040950 GTGCGGGGCGCAGCGGCAGCGGG - Intergenic
1025261773 7:57424988-57425010 GGGCAGGGCGCCGCCTCGGCGGG - Intergenic
1025320142 7:58087058-58087080 GGGCAAGGAGCCGCGGCGGCGGG - Intergenic
1027218892 7:76201818-76201840 GCGGAGGGCGCTGCGGGCGCGGG + Intergenic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1034128892 7:148698511-148698533 GTGCCGGGGGCAGGGGCCGCAGG + Intronic
1034217979 7:149422466-149422488 GGTGAGGGCGCCGCGGCCTCCGG + Intergenic
1034455502 7:151167818-151167840 GAGCCGGGCGCGGCGGCGGCGGG - Intronic
1034470506 7:151252022-151252044 CTGCAGGACTCCGCGGCGGCCGG + Intronic
1034911672 7:155002987-155003009 GCGCCGGGCGCCGCGGGGGCCGG - Exonic
1034997487 7:155587292-155587314 CCGCAGGGCGACGCGGCTGCGGG - Intergenic
1035254643 7:157618563-157618585 GTGAAGAGCGCAGCGGCCGCAGG + Exonic
1036708029 8:11059603-11059625 GAGCAGGGCGCTGGGGGCGCGGG + Intronic
1036815832 8:11902376-11902398 GCGCCGGGCCCCGCAGCCGCTGG - Intergenic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1039627794 8:39072614-39072636 GTGCAGAGCCCTGTGGCCGCAGG - Intronic
1041511484 8:58659268-58659290 GTGCAGGTCCCGGCGGCCGCGGG - Exonic
1045305040 8:100951368-100951390 GCGCTGGGCGCTGCGGCGGCGGG - Intronic
1049602943 8:143516334-143516356 GAGCAGGGCCACGGGGCCGCTGG + Intronic
1049615762 8:143575246-143575268 GTGCAGGGCTCCTGGGCCCCTGG + Exonic
1049668242 8:143858381-143858403 GTGGAGGAGGCCGTGGCCGCGGG - Exonic
1049668658 8:143859980-143860002 GTGGAGGAGGCCGTGGCCGCGGG - Exonic
1049669073 8:143861582-143861604 GTGGAGGAGGCCGTGGCCGCGGG - Exonic
1049669488 8:143863184-143863206 GTGGAGGAGGCCGTGGCCGCGGG - Exonic
1049669898 8:143864777-143864799 GTGGAGGAGGCCGTGGCCGCGGG - Exonic
1049670315 8:143866385-143866407 GTGGAGGAGGCCGTGGCCGCGGG - Exonic
1049708172 8:144052250-144052272 GTGGCGGGCGGCGCGGGCGCGGG - Exonic
1049799870 8:144512781-144512803 GAGCAGGGCTCAGCGGACGCGGG + Intronic
1049844201 8:144792215-144792237 GTGGTGGGCGCGGCGGCCTCGGG - Intronic
1050537764 9:6645394-6645416 GTGCTGGGCGCCGCGGAGCCGGG - Exonic
1053229997 9:36400531-36400553 GTACTGGCCGCCGCGGCCGTTGG - Intronic
1053434853 9:38068062-38068084 GTGGAGAGCGCCGCGGGCGGTGG - Exonic
1057436862 9:95048557-95048579 GTCCCGGCCGCCGCGGCCGGAGG - Intronic
1057881507 9:98796226-98796248 CTGCAGTTCGCCGCGGCCGGGGG - Exonic
1057995989 9:99822082-99822104 GTGCAGCGCGGCGCCGCAGCTGG + Exonic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1061052250 9:128203737-128203759 GTGGGGGGCGCGCCGGCCGCGGG - Intronic
1061181710 9:129028331-129028353 GGGCGGGGCGCGGAGGCCGCGGG + Intergenic
1061208217 9:129176467-129176489 AGGCAGGGCGCCCTGGCCGCCGG - Exonic
1061208468 9:129177457-129177479 GGGCAGAGCGCAGCGGGCGCGGG + Exonic
1062364694 9:136203144-136203166 CTGCTGGGCGCTGCGCCCGCGGG + Exonic
1062421567 9:136484851-136484873 GTGCAGAGCGCCTCGACCACTGG - Exonic
1062547408 9:137069949-137069971 GGGCAGGGCGCCGCCTCAGCCGG + Exonic
1185445563 X:256124-256146 GTGCGGGGGGCCGCTGACGCCGG - Intergenic
1185643205 X:1599747-1599769 GTGCAGGGGGCCGCTCCCTCTGG + Intronic
1187900905 X:24025748-24025770 ACGCGGGGCGCCGCGGGCGCGGG - Intronic
1190285224 X:48957203-48957225 GCGCTGGGCGCAGCGGCGGCGGG - Exonic
1192180346 X:68912217-68912239 GTGCAGGGGGCGGCTGCCGCCGG + Intergenic
1195702621 X:107716472-107716494 TTTCACGGCGCAGCGGCCGCAGG + Intronic
1197782531 X:130172093-130172115 CTGCAGCCCGCCTCGGCCGCTGG + Exonic
1198254724 X:134914941-134914963 GGGCCGGGCGCCGCGGGCGGCGG + Intronic