ID: 948217202

View in Genome Browser
Species Human (GRCh38)
Location 2:236240562-236240584
Sequence CTCGGATGGCACCCTGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948217202_948217211 29 Left 948217202 2:236240562-236240584 CCCAAAGCAGGGTGCCATCCGAG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 948217211 2:236240614-236240636 AAGTGTCTGCACATCTTGAGTGG 0: 1
1: 0
2: 1
3: 10
4: 136
948217202_948217212 30 Left 948217202 2:236240562-236240584 CCCAAAGCAGGGTGCCATCCGAG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 948217212 2:236240615-236240637 AGTGTCTGCACATCTTGAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 115
948217202_948217207 1 Left 948217202 2:236240562-236240584 CCCAAAGCAGGGTGCCATCCGAG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 948217207 2:236240586-236240608 AAGCCCCAGATGCAGCATGGTGG 0: 1
1: 0
2: 2
3: 13
4: 238
948217202_948217206 -2 Left 948217202 2:236240562-236240584 CCCAAAGCAGGGTGCCATCCGAG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 948217206 2:236240583-236240605 AGAAAGCCCCAGATGCAGCATGG 0: 1
1: 0
2: 4
3: 31
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948217202 Original CRISPR CTCGGATGGCACCCTGCTTT GGG (reversed) Intronic
900458123 1:2787099-2787121 CTTGGATGCAACCCTGCCTTGGG - Intronic
904064153 1:27735668-27735690 GTCGGATGGGACCCAGGTTTGGG - Intronic
909979373 1:82080535-82080557 CTATGCTGGCACCCTGCTCTTGG - Intergenic
913077894 1:115356714-115356736 CTATGATGGCACCCTGATCTTGG - Intergenic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
915718731 1:157967867-157967889 ATCTGCTGGCACCCTGATTTTGG + Intergenic
920545125 1:206810035-206810057 GTCGGATCTCACCCTTCTTTGGG + Intronic
1070282152 10:75057879-75057901 CTGGGATGGGACTTTGCTTTCGG + Intronic
1073206499 10:101772188-101772210 CTGGGAAAGCAGCCTGCTTTGGG - Intronic
1074817480 10:117153566-117153588 CTCTAATGGCACCCTGATCTTGG - Intergenic
1079077455 11:17393065-17393087 CAAGGATGGCACCCCGCTTCAGG + Exonic
1080154048 11:29087631-29087653 CTCGGGTGGTATCCTGCTTCTGG - Intergenic
1095049248 12:37542224-37542246 CTCGCATGGCAGCCTGTCTTTGG + Intergenic
1100790582 12:98125934-98125956 CTTGGATGGCACCTTGAATTTGG - Intergenic
1101402688 12:104402132-104402154 CCCTGCTGGCACCCTGATTTTGG - Intergenic
1101558169 12:105830482-105830504 CTCTGCTGACACCCTGATTTTGG - Intergenic
1104248856 12:127070384-127070406 CTGGGATGGAACAGTGCTTTTGG - Intergenic
1106193772 13:27476226-27476248 CTTGGATGGGACCCTGGGTTTGG - Intergenic
1106525212 13:30534331-30534353 CTCCCATGGCTCCCTTCTTTGGG + Intronic
1106717014 13:32401090-32401112 CTTGGCTGGCTCCCTGCTTTAGG - Exonic
1108891171 13:55261747-55261769 CTCTGCTGGCACCCTGATCTTGG + Intergenic
1111352806 13:87053706-87053728 CCCTGATCGCACCCTGATTTTGG + Intergenic
1117058066 14:51933100-51933122 CTCTGCTGGCACCTTGATTTTGG + Intronic
1117518460 14:56526182-56526204 CTCTGCTGGCACCTTGATTTTGG + Intronic
1121802019 14:96782600-96782622 CTCTGCGGGCACCTTGCTTTAGG + Intergenic
1123117153 14:105899923-105899945 CTTGGATGGCACCCTTATCTTGG + Intergenic
1125029043 15:35057950-35057972 CTCATTTGGAACCCTGCTTTAGG - Intergenic
1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG + Exonic
1132349396 15:101129596-101129618 CTCTGATGGCACCTTGATCTTGG + Intergenic
1136580597 16:31148933-31148955 CTCGAATAGCACCTCGCTTTGGG + Intronic
1137056523 16:35748864-35748886 CTTGGATGGGAGCCTGCCTTGGG + Intergenic
1148395926 17:47308113-47308135 CTGAGATTGCACCCTGCTCTGGG + Intronic
1149995139 17:61402268-61402290 CACGGAGGTCACCCTGCTCTTGG + Intronic
1153450468 18:5221828-5221850 CTCTGATGGCACCTTGATCTTGG - Intergenic
1154327205 18:13400185-13400207 CTTGGATGGCAGGCTTCTTTGGG + Intronic
1155959938 18:31985701-31985723 CCAGGGTGGCACCCTGCTCTTGG + Intergenic
1157382948 18:47236400-47236422 CTTGGATGGCATTCTGATTTTGG - Intronic
1157596301 18:48866079-48866101 CTATGCTGGCACCCTGATTTGGG - Intergenic
1157634184 18:49133475-49133497 CTCAGCTGACACCTTGCTTTTGG - Intronic
1158939830 18:62397288-62397310 CCAGGCTGGCACCCTGATTTTGG - Intergenic
926512821 2:13803526-13803548 CACCGATGACACCCTGATTTTGG + Intergenic
932912106 2:75817275-75817297 TTGTGATGGCACCCTGATTTTGG + Intergenic
937277124 2:120692219-120692241 CTTGGCTCCCACCCTGCTTTTGG + Intergenic
938091872 2:128439798-128439820 CTCAGAGGGCACCTTGATTTTGG + Intergenic
942072735 2:172330064-172330086 CTGGCATGGCAGCCTGCTTGGGG - Intergenic
946877296 2:224142109-224142131 CGGGTATGGCAGCCTGCTTTTGG - Intergenic
948217202 2:236240562-236240584 CTCGGATGGCACCCTGCTTTGGG - Intronic
948703714 2:239776834-239776856 CTCGCACGGCACCCTGTTCTGGG + Intronic
948976073 2:241464545-241464567 CTCTGGAGGGACCCTGCTTTAGG - Intronic
948980949 2:241494472-241494494 CTCGGCAGGGACCCTGCTCTGGG - Exonic
1171202273 20:23251617-23251639 TCCTGATGGCAGCCTGCTTTGGG + Intergenic
1172001920 20:31785468-31785490 CTCTTTTGGCACCTTGCTTTTGG + Intronic
1172392548 20:34575605-34575627 GCCAGATGGCACCCTGCTTGGGG - Intronic
1175984930 20:62759947-62759969 CCCGGCTGTCACCCTGCCTTGGG + Intronic
1176342684 21:5713366-5713388 CCCTGATTGCACCCTGCATTAGG + Intergenic
1176474938 21:7145517-7145539 CCCTGATTGCACCCTGCATTAGG + Intergenic
1176502143 21:7611090-7611112 CCCTGATTGCACCCTGCATTAGG - Intergenic
1176537005 21:8111435-8111457 CCCTGATTGCACCCTGCATTAGG + Intergenic
1178778139 21:35572165-35572187 CACGGATGGCCTCGTGCTTTTGG + Intronic
1179575932 21:42308433-42308455 CTCGAGGGGCACTCTGCTTTGGG + Intergenic
1185258931 22:49850789-49850811 CACGGAGGGCTCCCTGCCTTCGG + Intergenic
1203241956 22_KI270733v1_random:27839-27861 CCCTGATTGCACCCTGCATTAGG + Intergenic
952032618 3:29162560-29162582 CTTGAATGACACCCTGATTTTGG - Intergenic
955953563 3:64266096-64266118 CTCAGATGGTACACAGCTTTGGG - Intronic
957040681 3:75333290-75333312 CTCGAAAGGCACCCTGCTCTAGG + Intergenic
959322317 3:104892492-104892514 CTAGGTTGGCACCCTGATCTTGG - Intergenic
961475746 3:127145305-127145327 CAAGGATGGCACCATGCCTTAGG - Intergenic
963316917 3:143769275-143769297 CTCGCCTGGGACCCTGCTCTGGG + Intronic
963938269 3:151076371-151076393 CACGGCTGTCACTCTGCTTTGGG + Intergenic
968439303 4:613526-613548 CTGTGCTGGCACCCTGATTTTGG - Intergenic
969815972 4:9687721-9687743 CCCGGCTGACACCCTGATTTTGG - Intergenic
970823702 4:20250509-20250531 ATCAGATGGTACCCTGCCTTTGG + Intergenic
973805131 4:54518397-54518419 CATGGCTGGCACCCTGCTCTTGG + Intergenic
984197441 4:176676145-176676167 CCAGGATGGCACCCTGATCTTGG + Intergenic
985248195 4:187997147-187997169 CTCCGATGGCCCCCTCCTTGGGG + Intronic
985821466 5:2163605-2163627 CTCGGATGCAACCCTGCAGTCGG - Intergenic
990460853 5:56029641-56029663 CTATGCTGGCACCCTGCTCTTGG + Intergenic
997718489 5:136059693-136059715 CTCGGCTGGCTATCTGCTTTAGG - Intronic
1002634001 5:180598268-180598290 CTCGGAAGGGGCCTTGCTTTGGG - Intergenic
1002764178 6:225497-225519 CTCGAATGCCACACTGCTTCAGG + Intergenic
1007388122 6:41532993-41533015 CTCAGAAGGAACCTTGCTTTTGG + Intergenic
1010726435 6:79339099-79339121 CTGTGCTGGCACCCTGATTTCGG + Intergenic
1016119144 6:140326403-140326425 CACAGATGGCAACTTGCTTTCGG - Intergenic
1024635985 7:51290848-51290870 CTGGGGAGGCACCCTGCTTCAGG - Intronic
1033208965 7:139446259-139446281 CTCTGCTGGCACCCTGATTTTGG - Intergenic
1034032401 7:147782465-147782487 ATCTGCTGGCACCTTGCTTTTGG - Intronic
1037446792 8:18973374-18973396 CCCAGATGGCACCATGCTCTTGG - Intronic
1041705007 8:60837374-60837396 CTCTGCTGGCACTCTGATTTTGG - Intronic
1041732295 8:61075077-61075099 CACGGATGGCATGCTGCCTTCGG - Intronic
1043138078 8:76552915-76552937 CTATGCTGGCACCCTGATTTTGG - Intergenic
1048212600 8:132467847-132467869 TTCTGATGGCACACTGCTGTTGG + Intronic
1048301990 8:133258561-133258583 CTCTGAGGTCACCATGCTTTAGG + Intronic
1049353248 8:142175399-142175421 CTTGGGTGGCACTCTGCTGTTGG - Intergenic
1051853179 9:21532620-21532642 ATCAGCTGGCACCTTGCTTTAGG + Intergenic
1056375627 9:86007730-86007752 CTCTGATGGCAGCATGTTTTCGG - Intronic
1061734502 9:132644504-132644526 CTCTGGGGGCACCCTGCTTGTGG - Intronic
1203458273 Un_GL000220v1:10916-10938 CCCTGATTGCACCCTGCATTAGG + Intergenic
1195900483 X:109792441-109792463 CCCGGCTGGCACCTTGATTTTGG - Intergenic
1197749681 X:129956093-129956115 CTCTGATGGCACACTGCCCTAGG - Intergenic
1198670262 X:139072385-139072407 CTCTGATGGCACCTTGATCTTGG + Intronic
1200250027 X:154547761-154547783 CACGGATGGAACCCTGTCTTTGG - Intronic