ID: 948217715

View in Genome Browser
Species Human (GRCh38)
Location 2:236244241-236244263
Sequence CTATATGAGCAGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948217711_948217715 3 Left 948217711 2:236244215-236244237 CCTGTGCACATGAGTTACGATAC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 948217715 2:236244241-236244263 CTATATGAGCAGAGGCTGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948217715 Original CRISPR CTATATGAGCAGAGGCTGGA GGG Intronic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
900142693 1:1145234-1145256 CTCTCGGGGCAGAGGCTGGATGG - Intergenic
900731295 1:4262555-4262577 GTATATATGCAGAGGCTGGAGGG + Intergenic
902389786 1:16096514-16096536 ATATATAAGCTGAGGCTTGAAGG - Intergenic
903056038 1:20636830-20636852 CTATAGAAACAGGGGCTGGAAGG + Intronic
904922303 1:34018096-34018118 TTATATGAACAGGGACTGGATGG - Intronic
905501421 1:38441957-38441979 CTATGTGAACAGAGGCTAAAGGG - Intergenic
905838851 1:41156025-41156047 GTATTTCAGCAGAGGCTGGAAGG - Intronic
906201932 1:43966075-43966097 CTTTTTGAGCAGGAGCTGGAGGG + Intronic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
907832523 1:58078548-58078570 TTGTTTGAGCAGAGGCTGCAGGG - Intronic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
910369907 1:86504277-86504299 GTGTAAGCGCAGAGGCTGGAGGG - Intergenic
911437901 1:97886393-97886415 CTCTATGAGTGGGGGCTGGATGG - Intronic
914963491 1:152228871-152228893 GTATTTGAGCAGAGACTTGAAGG - Intergenic
915515307 1:156409304-156409326 ATGTATGAGCAGGGGATGGAAGG + Intronic
917413066 1:174780275-174780297 CCATCTGAGCAGAGTATGGAGGG - Intronic
917443715 1:175088849-175088871 CTGTTTGAGCACAGCCTGGAAGG - Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920949118 1:210556188-210556210 CAATATGGGAGGAGGCTGGAAGG - Intronic
921315665 1:213888068-213888090 CTAGCTGAGCAGAGGCCAGAAGG + Intergenic
923206755 1:231766561-231766583 CTAAATGAGCAGAGGAAGGGTGG + Intronic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
924257583 1:242197556-242197578 ATATCTGAGCTGAAGCTGGAAGG - Intronic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
1063612229 10:7572474-7572496 TTATGATAGCAGAGGCTGGAAGG + Intronic
1064970926 10:21066068-21066090 CCATATGAGCATAAGCTGGATGG + Intronic
1069637347 10:69933259-69933281 CTATTTGGGCAGAGTCTTGACGG + Intronic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1071587707 10:86841513-86841535 ATATTTGAGCAGAGTCTTGATGG + Intronic
1073127280 10:101159234-101159256 CCAAATGGGCAGAGGCTGCAGGG + Intergenic
1073298931 10:102458896-102458918 CTATATAATCAGAGGGTTGAGGG + Intergenic
1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG + Intronic
1073564866 10:104526436-104526458 GCAAATGAGCAGAGACTGGATGG - Intergenic
1074850054 10:117432443-117432465 CTACATGAGGAAAGGCAGGAGGG - Intergenic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1076097541 10:127744306-127744328 CCATAGGAGAAGAGGCAGGAAGG - Intergenic
1078264815 11:9746940-9746962 TTATAAGAGCAGATGCTGGCAGG + Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1080231456 11:30020929-30020951 CTATATAAGCAAAGGCTTCACGG - Intergenic
1083102706 11:60326624-60326646 GTTTATGAGCATAGGATGGAGGG + Intergenic
1083546965 11:63556079-63556101 CTATTAGAGCAGGGGCTGGATGG + Intronic
1083998728 11:66284664-66284686 GTATATGATGAGGGGCTGGAAGG + Exonic
1085850668 11:80115802-80115824 GTACATGGGCAGAGGGTGGATGG + Intergenic
1086492013 11:87365057-87365079 GCATATGAGCAGAGGCTGCTAGG - Intergenic
1086654717 11:89339678-89339700 CTATCAGAACAGAGGATGGAAGG + Intronic
1087238837 11:95752523-95752545 CTATAGGAGCTGAGAATGGATGG + Intergenic
1087896226 11:103589788-103589810 TTATATGGGCACAGGCTAGAGGG - Intergenic
1090437582 11:126699247-126699269 CTATGTGAGGACAAGCTGGATGG - Intronic
1090957975 11:131530629-131530651 CCACATGAGCTGAGGCTGGCAGG - Intronic
1092223378 12:6730602-6730624 CCAGATGAGCAGGGGCTGGAAGG + Intronic
1093498177 12:19780583-19780605 CTATAGCAGCAGAGACTGCAAGG + Intergenic
1096069868 12:48768907-48768929 GGATATGAGCAGGGGCTGGGAGG - Intronic
1096552714 12:52383935-52383957 CTAACTCAGCAGAAGCTGGAAGG + Intronic
1097023642 12:56037655-56037677 CCATGAGAGCAGAGACTGGAAGG + Exonic
1097357743 12:58621041-58621063 CTAGAGGAACAGAGGCTGGAAGG - Intronic
1099037225 12:77603659-77603681 TTTGATGAGCAGAAGCTGGATGG + Intergenic
1100390403 12:94141806-94141828 TTACAGCAGCAGAGGCTGGAAGG + Intergenic
1100702283 12:97161329-97161351 ATATTTGAGCAGAGACTAGAGGG + Intergenic
1101576619 12:106003115-106003137 CAAAATGAGCAGGGGCTGTAGGG + Intergenic
1102989734 12:117306315-117306337 CTATATTAGCAGAGGCCTTAAGG + Intronic
1104063961 12:125291135-125291157 CTTTATGAGAAGAGGTTAGAAGG + Intronic
1104644282 12:130486071-130486093 ATACATGGGCAGTGGCTGGAGGG - Intronic
1104723482 12:131060257-131060279 CTCTATGAGCAAAGGCTGAGTGG - Intronic
1105057122 12:133112230-133112252 CTCCATGGGCAGAGGGTGGAGGG - Exonic
1106395474 13:29376272-29376294 CTACATGTGGAGAGGCTAGAGGG + Intronic
1107553316 13:41496570-41496592 CTCTATGCCCAGAGGCTGCAGGG + Intergenic
1107566543 13:41611042-41611064 CTAAATGAGCAGAGGCACCAGGG - Intronic
1107892250 13:44924533-44924555 CTATCTGAGTAGAGGTTGCAGGG - Intergenic
1108153285 13:47558664-47558686 CTATTTGAGCAGAGATTTGAAGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1114695797 14:24626666-24626688 GTATCTGAGTAGAGGTTGGAAGG + Intergenic
1116579894 14:46626821-46626843 CTACTTGAGCGGAGGGTGGATGG + Intergenic
1118884443 14:69854603-69854625 ATATTTGAGCAGAGGCTTAAAGG - Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119440414 14:74624485-74624507 CTGTCTGAGCTGGGGCTGGAAGG + Intergenic
1119618692 14:76115330-76115352 CTATAGGAGCAAGGACTGGAAGG - Intergenic
1119827114 14:77666441-77666463 ATATTTGAGCAAAGACTGGAAGG + Intergenic
1119918672 14:78426181-78426203 AAATGAGAGCAGAGGCTGGAGGG + Intronic
1122199217 14:100112127-100112149 CTATATGAGCTGAAGCTGGCAGG - Intronic
1123738970 15:23216469-23216491 CCAGCTCAGCAGAGGCTGGAAGG - Intergenic
1124290190 15:28445439-28445461 CCAGCTCAGCAGAGGCTGGAAGG - Intergenic
1124293048 15:28472129-28472151 CCAGCTCAGCAGAGGCTGGAAGG + Intergenic
1126683118 15:51223326-51223348 ATATCTGAGCAGTGGCTGGTGGG + Intronic
1127754526 15:62078422-62078444 AGATATGAGCAAAGACTGGAAGG - Intergenic
1127848194 15:62889977-62889999 CTGTGTGAGCAGAGGCTTGGAGG + Intergenic
1129144045 15:73632334-73632356 GAAAATGAGCAGAGGATGGAGGG - Intronic
1130966155 15:88699509-88699531 CTGCATGGGCAGGGGCTGGAGGG - Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1133653825 16:7839765-7839787 CTAGTACAGCAGAGGCTGGAAGG - Intergenic
1135997852 16:27266383-27266405 CTCTATGAGAAGAGACTGTAGGG + Intronic
1136547996 16:30966075-30966097 CTATATGCACAGGGGCAGGAGGG + Exonic
1137740115 16:50761459-50761481 AGAGATGAGCAGAGGCTGGAGGG - Intronic
1138347100 16:56326746-56326768 CTCCATGGGCAGAGGCAGGAGGG + Intronic
1138477105 16:57277972-57277994 CTAAATGAGCAGAGGCTGCCGGG + Intronic
1140184987 16:72761254-72761276 AAACATGGGCAGAGGCTGGAAGG - Intergenic
1142948000 17:3451008-3451030 CTATATGAGGAGAGGCTGAGTGG + Intronic
1143410099 17:6703488-6703510 CTATGGGAGCAGAGAGTGGAAGG + Intronic
1143858242 17:9868632-9868654 CCAGATGAGCAGAGGCTTCATGG + Intronic
1143964664 17:10748623-10748645 CTATACAGGCAGAGGCAGGAAGG - Intergenic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1147670644 17:42174976-42174998 CTTGTTGGGCAGAGGCTGGAGGG - Intronic
1148379976 17:47189232-47189254 TTAAATGAGCAGGGGCTGGCCGG - Intronic
1149017138 17:51921156-51921178 CTGTATGAGCAGTGGTTAGATGG - Intronic
1157439091 18:47696679-47696701 CTAGTGGAGCAGAGGTTGGAGGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1159044705 18:63358289-63358311 CTAGCTGAGAAGAGGCTGGGAGG + Intronic
1160128697 18:76204777-76204799 ATATCTGAGCTGAGACTGGAAGG - Intergenic
1162971934 19:14185947-14185969 CTATCTGAGCAGAGGCCTGAAGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164478357 19:28592345-28592367 CCATTTGAGCAGACACTGGAAGG - Intergenic
1165112473 19:33510415-33510437 GTATATATGCAGAGGCTGGAAGG + Intronic
1165324079 19:35104136-35104158 GCAGAGGAGCAGAGGCTGGAAGG + Intergenic
1166949639 19:46417988-46418010 CTTTTTGGGGAGAGGCTGGAAGG - Intergenic
1167054655 19:47102081-47102103 CAATGTGAGGAGAGGCTGCAAGG + Intronic
1168277424 19:55285348-55285370 CCATAGGGGCAGAGGCTGGAGGG + Intronic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
927494702 2:23544685-23544707 ACATTTGAGAAGAGGCTGGAAGG + Intronic
928167425 2:28981355-28981377 CTGTCTGAGCAGGGGCTGGGTGG - Exonic
932292743 2:70596316-70596338 GGATTTGAGCAGCGGCTGGAAGG - Intergenic
932822899 2:74916457-74916479 ATATTTGAGCAGAGGCCTGAAGG + Intergenic
933169809 2:79112676-79112698 GGTAATGAGCAGAGGCTGGATGG - Intergenic
933644503 2:84799425-84799447 CTACTTGGGCAGAGACTGGAGGG + Intronic
936067090 2:109340491-109340513 GAATATGGGCAGATGCTGGAGGG + Intronic
939685678 2:145196635-145196657 TCAGATGAGGAGAGGCTGGAAGG - Intergenic
940050537 2:149458096-149458118 CCATACCAGCAGAGGCTGAATGG + Intronic
940346066 2:152630379-152630401 AAATATTAGCAGAGGTTGGATGG + Intronic
941160569 2:162029963-162029985 ATAGATAAGCAGAGGATGGATGG - Intronic
941639942 2:167976634-167976656 CCATAGGAGCAGAGGTTGGCGGG - Intronic
944700812 2:202244519-202244541 CTATAGTAGAAGTGGCTGGAAGG - Intergenic
945981842 2:216318544-216318566 AAATTTGAGCAGAGACTGGAAGG + Intronic
947808349 2:232983507-232983529 CTATCTGAGCAGAGGCCTGCAGG + Intronic
948217715 2:236244241-236244263 CTATATGAGCAGAGGCTGGAGGG + Intronic
1169279571 20:4255490-4255512 CTATGTCAGCAGAGGCTGGAGGG + Intergenic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1172468686 20:35175335-35175357 TTGTATGAGAAGTGGCTGGAGGG - Intronic
1174056955 20:47804561-47804583 GTATATATACAGAGGCTGGAGGG - Intergenic
1174408870 20:50321077-50321099 CTATTTGAGCAGAGGCCTGGAGG - Intergenic
1175400276 20:58696286-58696308 GAATGTGGGCAGAGGCTGGATGG - Intronic
1175885553 20:62288430-62288452 CTATGGGTGCAGAGGCTGGGAGG + Intronic
1176553645 21:8243102-8243124 TTAAATGAGCCGAGGCTGGCCGG - Intergenic
1176572567 21:8426126-8426148 TTAAATGAGCCGAGGCTGGCCGG - Intergenic
1176580476 21:8470687-8470709 TTAAATGAGCCGAGGCTGGCCGG - Intergenic
1177252516 21:18612827-18612849 CTATGTGAGCAGAGTCAAGATGG - Intergenic
1179585368 21:42370942-42370964 GTGTGTGAGCAGTGGCTGGAGGG - Intergenic
1180341740 22:11625829-11625851 TTAAATGAGCCGAGGCTGGCCGG - Intergenic
1181929374 22:26387633-26387655 CGTAATGAGTAGAGGCTGGAAGG - Intergenic
1181956395 22:26590237-26590259 CGAGGTGAGCAGAGGCTGGTCGG + Intronic
1182348478 22:29684000-29684022 CTCTATGAGCAGAAACTGCAGGG - Intronic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1183515363 22:38262447-38262469 CTATATGAGCAAAGGCACGGAGG + Intronic
1183933593 22:41249517-41249539 CACTATCAGCAGAGTCTGGATGG - Intronic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950797749 3:15524087-15524109 CTGTATGTGCAGAGGCTCCAAGG - Intergenic
951481538 3:23167084-23167106 AAATATGAGCAAAGGCTGGAAGG - Intergenic
952023295 3:29048794-29048816 CTATATAAGCAGACCCTTGATGG - Intergenic
952429379 3:33207228-33207250 CAATATGAAGAGAGACTGGAGGG + Intronic
952440832 3:33326684-33326706 GTATATGAGCACAGGCTTAATGG + Intronic
953020907 3:39112460-39112482 CTATGTGCTCAGAGGCTGGGTGG + Exonic
953158669 3:40398105-40398127 CTATATCAGCAGGTGCCGGAGGG + Intronic
955119472 3:56042130-56042152 CTATATGTGCAGGTGCAGGAAGG - Intronic
955698554 3:61660507-61660529 CTATGTGAACAGAGGCGAGAGGG - Intronic
956674512 3:71721845-71721867 ACATGTGAGCAGAGGCTTGAAGG + Intronic
957120352 3:76082612-76082634 ATATTTGAGCAGAGACTTGAAGG - Intronic
957761290 3:84560727-84560749 CTACAATAGCAGAGCCTGGAAGG - Intergenic
958504951 3:94964547-94964569 CTATATGAGCAGAATGTGTAAGG - Intergenic
960513146 3:118574671-118574693 TTATTTGAGCAGCGGGTGGAGGG + Intergenic
961052016 3:123755061-123755083 CTGTATGAGCAGAGTCCTGAGGG - Intronic
961216558 3:125164739-125164761 CTGCATGAGTAGAGGCTGAAAGG + Intronic
961865077 3:129948064-129948086 AAATCTGAGCTGAGGCTGGACGG + Intergenic
961901767 3:130219939-130219961 CTATATGAGCAGGTGCTGAAGGG + Intergenic
962076770 3:132090406-132090428 ATATTTGAGCAAAGGCTTGAAGG - Intronic
963069328 3:141289867-141289889 CTACCTGAGAAGAGGCTGGGGGG + Intronic
965759726 3:172062770-172062792 CAAAATGAGAAGAGGATGGATGG - Intronic
967388068 3:188929659-188929681 CTATATGTGCAGACCATGGAAGG - Intergenic
968571549 4:1344857-1344879 AGACATGAGCAGTGGCTGGAAGG + Intergenic
969605074 4:8198352-8198374 CTATCACAGCACAGGCTGGAGGG + Intronic
971796858 4:31239142-31239164 TTATATGAGTACAGGATGGAGGG + Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972628302 4:40821820-40821842 AGAGATGAGCAGAGGCGGGAGGG + Intronic
975131820 4:70839313-70839335 CAATAGGAGCACAGGGTGGACGG + Intronic
977957844 4:103051061-103051083 TTACATGAGCTGAGGCAGGAAGG + Intronic
979425042 4:120553554-120553576 GCATTTGAGCTGAGGCTGGAAGG - Intergenic
981260329 4:142711200-142711222 CTATTTGAGCAAAGACTGGAAGG - Intronic
982786306 4:159540791-159540813 CTATGTGAGCAGGTGGTGGAAGG + Intergenic
983116648 4:163825862-163825884 CTATATGAAAACAGGCTTGATGG + Intronic
984602364 4:181743481-181743503 ATATTTGAGCAAAGGCTTGAAGG + Intergenic
985496297 5:208512-208534 CCACATGGGCAAAGGCTGGATGG + Intronic
986116257 5:4778383-4778405 CAATATGGGAAGTGGCTGGAAGG - Intergenic
986865064 5:11976632-11976654 CTCTATGAGAACAGCCTGGAAGG + Intergenic
987182900 5:15385727-15385749 TTATATGAGCACAGGATGGGAGG + Intergenic
989452270 5:41600610-41600632 CTATGTGAGCACAGTCTGGAAGG + Intergenic
990886303 5:60598269-60598291 CCATTTGAGCAGAAGCTGGTGGG - Intronic
996193230 5:120571067-120571089 GCATTTGAGCAGAGGATGGAGGG + Intronic
998155300 5:139783012-139783034 AGACATGACCAGAGGCTGGAGGG - Intergenic
998804542 5:145905782-145905804 CTAAATGAACAAAGGCTGGGAGG + Intergenic
998842784 5:146273776-146273798 CTATATGAGAAAATGATGGATGG + Intronic
999719953 5:154392207-154392229 CTATATAAGCTGAGATTGGAAGG - Intronic
1000029627 5:157390621-157390643 CTAAAAGTGCAGAGGCAGGACGG + Exonic
1002050514 5:176568098-176568120 GTGTCGGAGCAGAGGCTGGATGG + Intronic
1002556905 5:180049041-180049063 TTAAATAAGCAGAGGCTGGTAGG + Intronic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1004919495 6:20362965-20362987 TTATATGAGCAGAGGATTAAGGG - Intergenic
1007282215 6:40721007-40721029 CCATCTGAGCAGTGGCTGGCAGG - Intergenic
1009629051 6:66170840-66170862 CTGAATGAGCAAAAGCTGGAAGG + Intergenic
1010002964 6:70966863-70966885 TTATATGAGAGGAGGCTGAATGG + Intergenic
1014277113 6:119399637-119399659 CTATCTCAGAAGAGGCTGCAAGG - Intergenic
1014761734 6:125363962-125363984 CTCTTTCAGGAGAGGCTGGAGGG + Intergenic
1015590035 6:134814330-134814352 TGACATGAGCAGAGACTGGAAGG + Intergenic
1016652456 6:146478352-146478374 CTACTTGAGCAGAGGGTGGGAGG - Intergenic
1017569655 6:155731092-155731114 CTATAAGAACAGGGGCAGGATGG + Intergenic
1017756458 6:157533455-157533477 ATATTTGAGCAAAGGCTGGGAGG + Intronic
1020263204 7:6543071-6543093 CTCTGAGAGCAGAGGATGGAAGG - Intronic
1021820745 7:24495161-24495183 TTATATGAGCACAGGATGGAGGG + Intergenic
1026223194 7:68418225-68418247 GTATATGAGGAGAGGGAGGATGG - Intergenic
1030309935 7:108058977-108058999 ATATTTGAGCAGAAGCTGGCAGG - Intronic
1032497605 7:132374463-132374485 CTACACCAGCAAAGGCTGGAGGG + Intronic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1035236934 7:157503405-157503427 CTCCAGGAGCAGAGGCTGCAAGG + Intergenic
1036502084 8:9323362-9323384 CTATTTGAGCAGGGTCTTGAAGG - Intergenic
1039279306 8:35965841-35965863 ATATAATAGCAGAGGATGGAAGG + Intergenic
1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG + Intronic
1042563535 8:70091420-70091442 GTCTATTAGAAGAGGCTGGAAGG + Intergenic
1046616463 8:116482995-116483017 GTACATTACCAGAGGCTGGAGGG + Intergenic
1047401149 8:124548616-124548638 CTGTATGAGCACAGGCCTGAGGG + Intronic
1049910169 9:258199-258221 CTTGAATAGCAGAGGCTGGAAGG + Intronic
1050064526 9:1745002-1745024 CTATATGAGGACAGGCTTGAAGG - Intergenic
1051029405 9:12657071-12657093 CCATATTAGGAGAGGCTGCAAGG - Intergenic
1051566293 9:18502746-18502768 CAATATGACAAGAGGCTGCAAGG + Intronic
1056455648 9:86756842-86756864 CTCTATGGGCTGATGCTGGAGGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056954771 9:91073208-91073230 CTAGAGGAGCTGAGGCTGGGCGG - Intergenic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1062386781 9:136315426-136315448 CTAAAATAACAGAGGCTGGAGGG + Intergenic
1062712371 9:137983469-137983491 CTATCTGAGGAATGGCTGGAAGG + Intronic
1186694056 X:12010684-12010706 CTATCTGATTAGAGGCAGGATGG - Intergenic
1187036867 X:15549676-15549698 CGAAATGAGCAGAGCTTGGAAGG - Intronic
1190738357 X:53270489-53270511 GTATTTGAGCAGAGGCTTGAAGG - Intronic
1192365870 X:70472605-70472627 ATGTTTGAGCAGAGGCTGAAGGG + Intronic
1193209696 X:78791916-78791938 CTGAATGGGCAAAGGCTGGAAGG + Intergenic
1195077163 X:101338240-101338262 CTAAATCAGCAAGGGCTGGAAGG - Intergenic
1195728484 X:107941196-107941218 TAATATGAGCTGAGGCTGGGTGG + Intergenic
1196681686 X:118475994-118476016 GCATTTGAGCAAAGGCTGGAAGG + Intergenic
1196756997 X:119166727-119166749 CTGTATGTGCAAAGGCTGCATGG - Intergenic
1198119825 X:133580915-133580937 CCATATGGGCAGAGGTTGGGAGG - Intronic
1198147833 X:133875633-133875655 CTTTTTGAGCTGAGCCTGGATGG - Intronic
1198440119 X:136654980-136655002 ATGTTTGATCAGAGGCTGGACGG - Intronic
1198440804 X:136661195-136661217 GTTGATGAGCATAGGCTGGAGGG - Intergenic
1200095391 X:153657224-153657246 CTAGCTGACCAGAGACTGGAGGG - Intergenic