ID: 948219398

View in Genome Browser
Species Human (GRCh38)
Location 2:236257722-236257744
Sequence GTTGACCAGCAAGTGAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948219396_948219398 -1 Left 948219396 2:236257700-236257722 CCTGCTCTGCTCCTAACTGGCTG 0: 1
1: 1
2: 28
3: 208
4: 1059
Right 948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG 0: 1
1: 1
2: 1
3: 8
4: 125
948219394_948219398 5 Left 948219394 2:236257694-236257716 CCTGCTCCTGCTCTGCTCCTAAC 0: 1
1: 1
2: 1
3: 39
4: 503
Right 948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG 0: 1
1: 1
2: 1
3: 8
4: 125
948219392_948219398 30 Left 948219392 2:236257669-236257691 CCCTGACTACAAGTCAGGAAGCA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG 0: 1
1: 1
2: 1
3: 8
4: 125
948219393_948219398 29 Left 948219393 2:236257670-236257692 CCTGACTACAAGTCAGGAAGCAT 0: 1
1: 0
2: 1
3: 10
4: 114
Right 948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG 0: 1
1: 1
2: 1
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948219398 Original CRISPR GTTGACCAGCAAGTGAACAC AGG Intronic
900161656 1:1226967-1226989 GCTCACCACCAAGTGAACTCAGG + Intronic
907398500 1:54209265-54209287 GTTTACTAGGAAGGGAACACAGG + Intronic
907457054 1:54582655-54582677 TTTCACCAACAAGGGAACACGGG - Intronic
908155924 1:61353045-61353067 GTTTGGCAGGAAGTGAACACTGG + Intronic
919036927 1:192323709-192323731 GTTGAACTGCAGGTGAAGACTGG + Intronic
921015777 1:211189445-211189467 GTTGATGAGCCAGTGAAAACTGG + Intergenic
921185700 1:212667568-212667590 ACTGACCAGCAAGGGAACTCTGG - Intergenic
924659601 1:246004328-246004350 GTTGACTTTCAAGTGAAAACTGG - Intronic
1068147323 10:53088390-53088412 GGTGGCCACCAAGTGACCACAGG + Intergenic
1068233643 10:54203668-54203690 GGTGTCCAGGAAGGGAACACAGG - Intronic
1068524666 10:58114562-58114584 GTTGAACAGAAAGAAAACACTGG + Intergenic
1074386230 10:113018844-113018866 GGTGACCAGGAAATGTACACTGG - Intronic
1091419017 12:318788-318810 GATGACCAGACAGTGAACATAGG + Intronic
1094205666 12:27837835-27837857 GTTGAGCAGAAAGTGAGGACTGG - Intergenic
1098147604 12:67513664-67513686 GTTGCCCAGCAAGTAATAACTGG - Intergenic
1100173920 12:92007967-92007989 GGTGAGCAGCAGGTGAGCACAGG + Intronic
1100707129 12:97213026-97213048 GAGGACCAGCAGGTGAACATAGG + Intergenic
1101206572 12:102494186-102494208 TTTGATGAGCAAGTGAATACAGG - Intergenic
1102722819 12:115032854-115032876 GCAGACCAGCAAATGAATACAGG + Intergenic
1103369298 12:120406657-120406679 GCAGACCAGCAAGTGAAATCTGG + Intergenic
1103649287 12:122421046-122421068 TTTTACCAGCATGTGAACTCAGG - Intronic
1104643175 12:130480236-130480258 GTTGACCACGAAGTTACCACAGG - Intronic
1107261369 13:38495246-38495268 GATGACCAGCCAATGAACAAGGG + Intergenic
1118471841 14:66081700-66081722 TTTGACCAGCAAGATAAGACTGG + Intergenic
1202935386 14_KI270725v1_random:82994-83016 GTTGACCAACAAGTGACTTCAGG - Intergenic
1124878842 15:33622707-33622729 GTTCAACAGTAATTGAACACTGG - Intronic
1125126148 15:36223381-36223403 GTGGACCAGCAAATGAACTCAGG + Intergenic
1130890777 15:88132200-88132222 GTTGACCAGAAAATGACTACTGG + Intronic
1131843554 15:96464779-96464801 GGTGTCCAGCAAGTGAAAAGTGG - Intergenic
1132698337 16:1211794-1211816 GTCGACCAGCAGGTGCGCACAGG + Exonic
1137835937 16:51592596-51592618 AGTGGCCAGTAAGTGAACACCGG + Intergenic
1141240182 16:82258559-82258581 GTTGAACAGAAAGTTACCACAGG - Intergenic
1143930662 17:10420003-10420025 GTGGAGCAGTAAGTGAAAACAGG - Exonic
1144541006 17:16143112-16143134 GTTGTCTAGCAAGTGAACCTGGG - Intronic
1146935784 17:36811808-36811830 GCTGACCAGAAAGAGAACCCAGG - Intergenic
1150599325 17:66636924-66636946 GTTGATCAGCAATTGTGCACAGG - Intronic
1155437081 18:25824597-25824619 GGTGACCAGCAAGTGACCACTGG + Intergenic
1156293662 18:35771662-35771684 GTTAACCAGCACGTAACCACTGG + Intergenic
1160608631 18:80071259-80071281 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608664 18:80071368-80071390 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608699 18:80071477-80071499 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608712 18:80071514-80071536 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608736 18:80071587-80071609 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608771 18:80071696-80071718 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608784 18:80071733-80071755 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608808 18:80071806-80071828 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608843 18:80071915-80071937 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608856 18:80071952-80071974 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608880 18:80072025-80072047 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608891 18:80072061-80072083 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608904 18:80072098-80072120 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608965 18:80072281-80072303 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608989 18:80072354-80072376 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609013 18:80072427-80072449 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609026 18:80072464-80072486 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609039 18:80072501-80072523 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609063 18:80072574-80072596 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609074 18:80072610-80072632 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609087 18:80072647-80072669 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609135 18:80072793-80072815 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609148 18:80072830-80072852 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609174 18:80072904-80072926 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609322 18:80073391-80073413 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609366 18:80073537-80073559 GGTGACCAGCAGGTGTGCACAGG - Intronic
1161351787 19:3797088-3797110 GTTTGCCAGGAAGAGAACACAGG - Intronic
1161577619 19:5063562-5063584 GGTGTCCACCAAGTCAACACAGG - Intronic
1163528021 19:17832984-17833006 GTTGCACAGCAAGTCAACTCAGG - Intronic
1164655476 19:29918042-29918064 GTTGACCACCAAGTGGCCAATGG + Intergenic
1168419189 19:56190095-56190117 GTTCACCAGCGAGTCCACACTGG - Exonic
924999707 2:395138-395160 GATGTCCAACAACTGAACACAGG + Intergenic
925080356 2:1058609-1058631 GTTGAGCAGAAGGTGAACCCTGG + Intronic
935921524 2:108020919-108020941 AGTGACCCACAAGTGAACACAGG + Intergenic
936514598 2:113173872-113173894 GTTGAGCAGCTAGGGAACCCTGG + Intronic
938201839 2:129378464-129378486 GTTGACCATGAATTGAAAACTGG + Intergenic
938586749 2:132698377-132698399 GCAGACCAGAGAGTGAACACTGG + Intronic
941147167 2:161862882-161862904 CTTGACCAACAAGTGAGCTCAGG + Exonic
942871959 2:180745743-180745765 GGTGACCACAATGTGAACACTGG - Intergenic
943960338 2:194255230-194255252 GTTCATGAGCAAGTGAACACAGG - Intergenic
947158118 2:227184213-227184235 GCAGACCAGCAAGTGCACATGGG + Intronic
947424652 2:229972525-229972547 AGTGACCAGCAAGTGAACAGAGG + Intronic
948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG + Intronic
1169592222 20:7157516-7157538 ATTGATCATCCAGTGAACACTGG + Intergenic
1169648526 20:7841533-7841555 AATGACCAGCAAGTCAACATTGG + Intergenic
1171102778 20:22401106-22401128 GTTCACCTGTATGTGAACACAGG + Intergenic
1171938839 20:31304540-31304562 GTAGACCAGAAATTGAATACTGG - Intronic
1171940730 20:31326581-31326603 GGTGACCAGCAACTGAAGCCTGG - Intergenic
1172833451 20:37856520-37856542 GGAGACCAGGAAGGGAACACAGG + Intronic
1173049306 20:39543770-39543792 GCTGACCATCAAGAGAAAACAGG - Intergenic
1173897731 20:46563420-46563442 TTTGACCAGCAAGTGTCCAGAGG + Exonic
1176674413 21:9764516-9764538 ATTGACCAGGAAGTGAATTCTGG - Intergenic
1178316682 21:31572354-31572376 GTTGCCCAGAAGATGAACACAGG - Intergenic
1179442229 21:41403352-41403374 GGTGACTAGCAAGTGAACTCTGG - Intronic
950144766 3:10641053-10641075 GATGACTAGCAATTGAACTCAGG + Intronic
953109610 3:39921268-39921290 ATCAACCAGCAAGTGAGCACTGG + Intronic
954234990 3:49249749-49249771 TGTGACCAGCCAGTGAAAACTGG + Intronic
955456809 3:59130791-59130813 GTTGACCAGGAAGTGTAAAGAGG + Intergenic
955735099 3:62030588-62030610 GTTGACCAGCAAGTGAGCACTGG + Intronic
959804743 3:110537813-110537835 CTTGACCTGCAAGTTCACACAGG + Intergenic
960422676 3:117466498-117466520 GTTGTCTAGAAAGTGAAAACTGG - Intergenic
970025174 4:11616295-11616317 GATAACTGGCAAGTGAACACAGG - Intergenic
970826623 4:20284104-20284126 GTTGCCCACCTAGTAAACACTGG - Intronic
975505624 4:75133636-75133658 GTAGACCTGCAAGTGGCCACAGG + Intergenic
975732581 4:77352226-77352248 GTAAGCCACCAAGTGAACACAGG - Intronic
977048501 4:92096716-92096738 GTTGACCAAAAATTGCACACTGG + Intergenic
978947315 4:114515608-114515630 CTTAACCAGCAGGTGAACAGAGG - Intergenic
981260654 4:142714756-142714778 GTTGACTTGAAAGTGAACTCTGG - Intronic
988304869 5:29481156-29481178 AGTGACCACCAAGTGACCACAGG - Intergenic
988894614 5:35658255-35658277 GGTGACCAGTAAATGAACAGTGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
995558178 5:113352336-113352358 GTTCACAAGGAGGTGAACACAGG - Intronic
995799412 5:115977704-115977726 GACGACCAGCAAGTGCACAGTGG - Intronic
996916294 5:128715624-128715646 GAGGACCAGCAAGTAAATACTGG - Intronic
998800053 5:145859960-145859982 TTTGACCTGCATGTGAACAACGG - Intronic
1001040080 5:168328326-168328348 GTTCACCAGCAAGTGAAGAAAGG - Intronic
1002303172 5:178268976-178268998 GGTGACCAGCAAGGGCCCACTGG + Intronic
1002590426 5:180287661-180287683 GTTGACCAGCAGGTCAAAAAGGG - Intronic
1006262778 6:32890064-32890086 GTTTACCTGCAAATGGACACTGG + Intergenic
1009934738 6:70220447-70220469 GTTGACCAGGAAGTAGACAGAGG + Intronic
1016423096 6:143905395-143905417 GTAGAACAGAAAGTCAACACAGG - Intronic
1017304146 6:152897544-152897566 GTCCAACAGCAAGTGAAGACAGG + Intergenic
1022122027 7:27317610-27317632 TTTTACCACCAAGAGAACACAGG - Intergenic
1022589108 7:31643866-31643888 GGTGACCAGTTAGTGAACACAGG - Exonic
1026740822 7:72977181-72977203 TCTGCCCAGCAAGTGAACAAAGG - Intergenic
1026798120 7:73378675-73378697 TCTGCCCAGCAAGTGAACAAAGG - Intergenic
1027102911 7:75387893-75387915 TCTGCCCAGCAAGTGAACAAAGG + Intergenic
1027526467 7:79275751-79275773 GTAGAATAGTAAGTGAACACTGG - Intronic
1037888531 8:22608141-22608163 GTTGGCCAGGAAGTGAACCCAGG + Intronic
1041332136 8:56738321-56738343 TTTCACCAGCCAGTGAGCACAGG - Intergenic
1042176205 8:66039247-66039269 GGTAACCAGCCAGTGAACAGTGG - Intronic
1048556720 8:135485003-135485025 GTTGACCAGGATGTGTACAGTGG + Intronic
1058320164 9:103620175-103620197 GTTTATCAGCAAGAGAAAACTGG - Intergenic
1062598700 9:137310656-137310678 TTTGTCCAGGAAGTGACCACTGG - Intronic
1190621309 X:52289105-52289127 GTGCATGAGCAAGTGAACACAGG - Intergenic
1192331071 X:70175645-70175667 GATGACCATCTAGTGCACACGGG + Intergenic
1198802325 X:140460426-140460448 GGTGGCCAGCAAGTGACAACTGG + Intergenic
1199497069 X:148464345-148464367 GCTGACCAGGAAGTGAGCATGGG + Intergenic