ID: 948222827

View in Genome Browser
Species Human (GRCh38)
Location 2:236287143-236287165
Sequence TTTACTCTTTGGAGGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948222827_948222835 9 Left 948222827 2:236287143-236287165 CCCCCTGGCCTCCAAAGAGTAAA No data
Right 948222835 2:236287175-236287197 GCTAAATCCTCTGTCCTGTGAGG No data
948222827_948222837 22 Left 948222827 2:236287143-236287165 CCCCCTGGCCTCCAAAGAGTAAA No data
Right 948222837 2:236287188-236287210 TCCTGTGAGGCAGCAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948222827 Original CRISPR TTTACTCTTTGGAGGCCAGG GGG (reversed) Intergenic
No off target data available for this crispr