ID: 948222835

View in Genome Browser
Species Human (GRCh38)
Location 2:236287175-236287197
Sequence GCTAAATCCTCTGTCCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948222833_948222835 -2 Left 948222833 2:236287154-236287176 CCAAAGAGTAAAGAGCCACAGGC No data
Right 948222835 2:236287175-236287197 GCTAAATCCTCTGTCCTGTGAGG No data
948222824_948222835 25 Left 948222824 2:236287127-236287149 CCTGTCCATGGGAGAGCCCCCTG No data
Right 948222835 2:236287175-236287197 GCTAAATCCTCTGTCCTGTGAGG No data
948222831_948222835 1 Left 948222831 2:236287151-236287173 CCTCCAAAGAGTAAAGAGCCACA No data
Right 948222835 2:236287175-236287197 GCTAAATCCTCTGTCCTGTGAGG No data
948222828_948222835 8 Left 948222828 2:236287144-236287166 CCCCTGGCCTCCAAAGAGTAAAG No data
Right 948222835 2:236287175-236287197 GCTAAATCCTCTGTCCTGTGAGG No data
948222826_948222835 20 Left 948222826 2:236287132-236287154 CCATGGGAGAGCCCCCTGGCCTC No data
Right 948222835 2:236287175-236287197 GCTAAATCCTCTGTCCTGTGAGG No data
948222829_948222835 7 Left 948222829 2:236287145-236287167 CCCTGGCCTCCAAAGAGTAAAGA No data
Right 948222835 2:236287175-236287197 GCTAAATCCTCTGTCCTGTGAGG No data
948222827_948222835 9 Left 948222827 2:236287143-236287165 CCCCCTGGCCTCCAAAGAGTAAA No data
Right 948222835 2:236287175-236287197 GCTAAATCCTCTGTCCTGTGAGG No data
948222830_948222835 6 Left 948222830 2:236287146-236287168 CCTGGCCTCCAAAGAGTAAAGAG No data
Right 948222835 2:236287175-236287197 GCTAAATCCTCTGTCCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948222835 Original CRISPR GCTAAATCCTCTGTCCTGTG AGG Intergenic
No off target data available for this crispr