ID: 948222837

View in Genome Browser
Species Human (GRCh38)
Location 2:236287188-236287210
Sequence TCCTGTGAGGCAGCAGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948222834_948222837 -4 Left 948222834 2:236287169-236287191 CCACAGGCTAAATCCTCTGTCCT No data
Right 948222837 2:236287188-236287210 TCCTGTGAGGCAGCAGCTTGAGG No data
948222833_948222837 11 Left 948222833 2:236287154-236287176 CCAAAGAGTAAAGAGCCACAGGC No data
Right 948222837 2:236287188-236287210 TCCTGTGAGGCAGCAGCTTGAGG No data
948222830_948222837 19 Left 948222830 2:236287146-236287168 CCTGGCCTCCAAAGAGTAAAGAG No data
Right 948222837 2:236287188-236287210 TCCTGTGAGGCAGCAGCTTGAGG No data
948222827_948222837 22 Left 948222827 2:236287143-236287165 CCCCCTGGCCTCCAAAGAGTAAA No data
Right 948222837 2:236287188-236287210 TCCTGTGAGGCAGCAGCTTGAGG No data
948222829_948222837 20 Left 948222829 2:236287145-236287167 CCCTGGCCTCCAAAGAGTAAAGA No data
Right 948222837 2:236287188-236287210 TCCTGTGAGGCAGCAGCTTGAGG No data
948222828_948222837 21 Left 948222828 2:236287144-236287166 CCCCTGGCCTCCAAAGAGTAAAG No data
Right 948222837 2:236287188-236287210 TCCTGTGAGGCAGCAGCTTGAGG No data
948222831_948222837 14 Left 948222831 2:236287151-236287173 CCTCCAAAGAGTAAAGAGCCACA No data
Right 948222837 2:236287188-236287210 TCCTGTGAGGCAGCAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948222837 Original CRISPR TCCTGTGAGGCAGCAGCTTG AGG Intergenic
No off target data available for this crispr