ID: 948222996

View in Genome Browser
Species Human (GRCh38)
Location 2:236288200-236288222
Sequence CACTGGTTCAGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948222989_948222996 -1 Left 948222989 2:236288178-236288200 CCAGCTGAAGCAGGAACACACCC No data
Right 948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG No data
948222985_948222996 7 Left 948222985 2:236288170-236288192 CCCCACCTCCAGCTGAAGCAGGA No data
Right 948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG No data
948222986_948222996 6 Left 948222986 2:236288171-236288193 CCCACCTCCAGCTGAAGCAGGAA No data
Right 948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG No data
948222987_948222996 5 Left 948222987 2:236288172-236288194 CCACCTCCAGCTGAAGCAGGAAC No data
Right 948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG No data
948222988_948222996 2 Left 948222988 2:236288175-236288197 CCTCCAGCTGAAGCAGGAACACA No data
Right 948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948222996 Original CRISPR CACTGGTTCAGGAGGGAAGA AGG Intergenic
No off target data available for this crispr