ID: 948223805

View in Genome Browser
Species Human (GRCh38)
Location 2:236293409-236293431
Sequence CCGTGGTAGGCCCTGGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948223792_948223805 22 Left 948223792 2:236293364-236293386 CCACTCACAGAAGTGACCAGAAG No data
Right 948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG No data
948223798_948223805 -6 Left 948223798 2:236293392-236293414 CCCCAGGGGCTCTCTCTCCGTGG No data
Right 948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG No data
948223801_948223805 -8 Left 948223801 2:236293394-236293416 CCAGGGGCTCTCTCTCCGTGGTA No data
Right 948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG No data
948223796_948223805 6 Left 948223796 2:236293380-236293402 CCAGAAGCCTGTCCCCAGGGGCT No data
Right 948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG No data
948223800_948223805 -7 Left 948223800 2:236293393-236293415 CCCAGGGGCTCTCTCTCCGTGGT No data
Right 948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG No data
948223791_948223805 29 Left 948223791 2:236293357-236293379 CCACTGGCCACTCACAGAAGTGA No data
Right 948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG No data
948223797_948223805 -1 Left 948223797 2:236293387-236293409 CCTGTCCCCAGGGGCTCTCTCTC No data
Right 948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948223805 Original CRISPR CCGTGGTAGGCCCTGGAATG TGG Intergenic
No off target data available for this crispr