ID: 948224024

View in Genome Browser
Species Human (GRCh38)
Location 2:236294764-236294786
Sequence TCTGCCCTTCGGAGCTGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948224024_948224031 5 Left 948224024 2:236294764-236294786 CCCCCGCAGCTCCGAAGGGCAGA No data
Right 948224031 2:236294792-236294814 ATTGCCAGGTGAGCCTCATCAGG No data
948224024_948224033 9 Left 948224024 2:236294764-236294786 CCCCCGCAGCTCCGAAGGGCAGA No data
Right 948224033 2:236294796-236294818 CCAGGTGAGCCTCATCAGGCTGG No data
948224024_948224035 22 Left 948224024 2:236294764-236294786 CCCCCGCAGCTCCGAAGGGCAGA No data
Right 948224035 2:236294809-236294831 ATCAGGCTGGACTCAACTGCTGG No data
948224024_948224036 30 Left 948224024 2:236294764-236294786 CCCCCGCAGCTCCGAAGGGCAGA No data
Right 948224036 2:236294817-236294839 GGACTCAACTGCTGGCAAATTGG No data
948224024_948224030 -9 Left 948224024 2:236294764-236294786 CCCCCGCAGCTCCGAAGGGCAGA No data
Right 948224030 2:236294778-236294800 AAGGGCAGAGGAGCATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948224024 Original CRISPR TCTGCCCTTCGGAGCTGCGG GGG (reversed) Intergenic
No off target data available for this crispr