ID: 948225810

View in Genome Browser
Species Human (GRCh38)
Location 2:236308557-236308579
Sequence GCCCCCACACTGGCCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948225810_948225817 27 Left 948225810 2:236308557-236308579 CCCTCTGTGGCCAGTGTGGGGGC No data
Right 948225817 2:236308607-236308629 AGCATTTGTCCTTCTGTGCTTGG No data
948225810_948225813 -3 Left 948225810 2:236308557-236308579 CCCTCTGTGGCCAGTGTGGGGGC No data
Right 948225813 2:236308577-236308599 GGCTCTGCCTTCCATCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948225810 Original CRISPR GCCCCCACACTGGCCACAGA GGG (reversed) Intergenic