ID: 948226064

View in Genome Browser
Species Human (GRCh38)
Location 2:236310170-236310192
Sequence CAGGTCAACCAAGGCAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948226064_948226070 6 Left 948226064 2:236310170-236310192 CCACCTTTGCCTTGGTTGACCTG No data
Right 948226070 2:236310199-236310221 ATCTACACTCCTCCCTTTCCTGG No data
948226064_948226071 7 Left 948226064 2:236310170-236310192 CCACCTTTGCCTTGGTTGACCTG No data
Right 948226071 2:236310200-236310222 TCTACACTCCTCCCTTTCCTGGG No data
948226064_948226072 13 Left 948226064 2:236310170-236310192 CCACCTTTGCCTTGGTTGACCTG No data
Right 948226072 2:236310206-236310228 CTCCTCCCTTTCCTGGGCCCAGG No data
948226064_948226076 21 Left 948226064 2:236310170-236310192 CCACCTTTGCCTTGGTTGACCTG No data
Right 948226076 2:236310214-236310236 TTTCCTGGGCCCAGGAGAAAAGG No data
948226064_948226078 25 Left 948226064 2:236310170-236310192 CCACCTTTGCCTTGGTTGACCTG No data
Right 948226078 2:236310218-236310240 CTGGGCCCAGGAGAAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948226064 Original CRISPR CAGGTCAACCAAGGCAAAGG TGG (reversed) Intergenic
No off target data available for this crispr