ID: 948227023

View in Genome Browser
Species Human (GRCh38)
Location 2:236319115-236319137
Sequence GCTGCGATGAAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948227023_948227027 -5 Left 948227023 2:236319115-236319137 CCCTCCTCCTTCTTCATCGCAGC No data
Right 948227027 2:236319133-236319155 GCAGCCTGCACTTCCATTCCAGG No data
948227023_948227029 -1 Left 948227023 2:236319115-236319137 CCCTCCTCCTTCTTCATCGCAGC No data
Right 948227029 2:236319137-236319159 CCTGCACTTCCATTCCAGGAAGG No data
948227023_948227032 16 Left 948227023 2:236319115-236319137 CCCTCCTCCTTCTTCATCGCAGC No data
Right 948227032 2:236319154-236319176 GGAAGGTACAGCCTGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948227023 Original CRISPR GCTGCGATGAAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr