ID: 948228287

View in Genome Browser
Species Human (GRCh38)
Location 2:236330243-236330265
Sequence AACAGACAACAGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 3, 2: 15, 3: 116, 4: 450}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948228287_948228289 -1 Left 948228287 2:236330243-236330265 CCAAATTTGGCCTGTTGTCTGTT 0: 1
1: 3
2: 15
3: 116
4: 450
Right 948228289 2:236330265-236330287 TTTTGCAAATAAAGTTTTATTGG 0: 64
1: 826
2: 1323
3: 1434
4: 2057

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948228287 Original CRISPR AACAGACAACAGGCCAAATT TGG (reversed) Intronic
901935498 1:12623515-12623537 AACAGTCCACAGACCAAATCTGG - Intergenic
902276193 1:15341237-15341259 TACAGCCCACAGGCCAAATCGGG - Intronic
902353721 1:15880057-15880079 AACATACAAGAGCCCAAATCTGG - Intronic
902559134 1:17266147-17266169 AACAGGCAGTAGGCCAGATTTGG + Intronic
903127021 1:21255148-21255170 AACGGACAACAGGTCAAATTCGG + Intronic
903447783 1:23433353-23433375 AACACACACCAGGCCCAATCTGG + Intronic
903727642 1:25462875-25462897 AACAGCACACAGGCCAAATCTGG + Intronic
904155394 1:28478910-28478932 AACTGAAAATAGGCCAAATGAGG - Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905089232 1:35414637-35414659 AACAGGGAGCAGGCCAGATTTGG - Intronic
905473372 1:38209075-38209097 TACAGCCCACAGGCCAAATCAGG - Intergenic
906096156 1:43225465-43225487 AATAGACAGCAGGCCCAATGTGG + Intronic
906816449 1:48885118-48885140 AACAGGAAACAGACCAGATTTGG - Intronic
906902229 1:49847466-49847488 AACAGACAACATGCAGAATTGGG + Intronic
907522817 1:55035826-55035848 AAGAGACAGCAGGCTAATTTTGG + Intergenic
907967899 1:59350976-59350998 AACAGGCAGTAGGCCAGATTTGG - Intronic
908004702 1:59715847-59715869 AACAGTCAGTAGGCAAAATTTGG - Intronic
908334555 1:63107940-63107962 AAGGGACAACATGCCAAATTGGG + Intergenic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
909407323 1:75305969-75305991 AACAGACAGCAAACCAGATTTGG - Intronic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
911314122 1:96335134-96335156 AACAAACAACAGGCTGTATTTGG - Intergenic
911498254 1:98656657-98656679 AATAGAAAAGAGGCCAAATATGG - Intergenic
913008922 1:114663621-114663643 AACAGGCAGTGGGCCAAATTTGG - Intronic
913218486 1:116640411-116640433 AAATGACAACATCCCAAATTTGG + Intronic
913303993 1:117404732-117404754 AACAGACAGCAAGCAGAATTTGG - Intronic
913457973 1:119053129-119053151 AAGAGTCCACAGGCCAGATTTGG - Intronic
914736368 1:150421071-150421093 AATAGGCAGCAGGCCAGATTTGG + Intronic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
915961913 1:160274081-160274103 TACAGCCCACAGGCCAAATCTGG - Intergenic
916083002 1:161247901-161247923 CACAGGCAGCAGGCCAGATTGGG - Intergenic
916365213 1:164018616-164018638 AACAGAAAACTTTCCAAATTTGG + Intergenic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916848084 1:168673764-168673786 AACAAACAAAAAGCCAAATGAGG + Intergenic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
918747435 1:188222918-188222940 TATAGCCTACAGGCCAAATTTGG - Intergenic
918805669 1:189039268-189039290 AACAGATAACAGGCTGGATTTGG - Intergenic
919272777 1:195371334-195371356 AACAGACAACAAGCCAGATTTGG - Intergenic
920784981 1:209032758-209032780 AACAGACAACAGGCCCCAGTTGG - Intergenic
920897392 1:210068283-210068305 AAAAGACAGCATGACAAATTGGG - Intronic
920997008 1:211002982-211003004 AACAGGCCACTGGCAAAATTTGG - Intronic
921121981 1:212145306-212145328 AATAAACCACAGGCCAAATCTGG + Intergenic
921224747 1:213007138-213007160 AGCAGAGATCAGGCCAAGTTTGG - Exonic
921436856 1:215133968-215133990 AACAAACAAGAGGCCAAGTTTGG + Intronic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
921765615 1:218969978-218970000 AATAGACAGTAGTCCAAATTTGG - Intergenic
922201050 1:223401646-223401668 AACACACAACAGGCACATTTTGG + Intergenic
922251339 1:223851375-223851397 AGCAAACTACAGCCCAAATTTGG + Intergenic
922251341 1:223851388-223851410 AACAGGCAGAAGGCCAAATTTGG - Intergenic
922884509 1:229007608-229007630 AACAGACAATAGGCTCAAATCGG + Intergenic
923562528 1:235052110-235052132 AACAGGCCACTGGCCAGATTTGG + Intergenic
924662872 1:246038055-246038077 AACAGGCAGCAGGCCAGATATGG + Intronic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1064369742 10:14741033-14741055 AACAGTCAACAGGTGACATTAGG + Intronic
1064433295 10:15289736-15289758 AGCAGGCAGCAGGCCACATTTGG - Intronic
1064669837 10:17701444-17701466 AACAGGCAACAGGCTAAATTTGG - Intronic
1064797907 10:19034591-19034613 AACAGGACACAGGCCAAATTTGG + Intergenic
1067661100 10:48236667-48236689 AGCAGAAAACAGGCCAAGATGGG + Intronic
1068039209 10:51801413-51801435 AACAGACCATGGGCCAGATTTGG + Intronic
1068696161 10:59970050-59970072 AATAGACAACTGGCCAGATGCGG + Intergenic
1068867275 10:61907740-61907762 AACAGACAGTGGGCCAGATTTGG - Intronic
1068931487 10:62594848-62594870 AACTGACAGTAGGTCAAATTTGG + Intronic
1069359124 10:67621840-67621862 AATAGACAAGAGGCCAGATTTGG - Intronic
1070075340 10:73129539-73129561 AACATACAATAGGCAAACTTTGG - Intronic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1072557534 10:96532738-96532760 AACAGGGAGCAGGCCAGATTTGG + Intronic
1072676681 10:97471799-97471821 AACAGAAACCAGGCCAGGTTCGG - Intronic
1072865733 10:99059147-99059169 AACAGGAAGCAGGCCAGATTTGG + Intronic
1072952138 10:99857181-99857203 AACAGGTAGCAGGGCAAATTTGG - Intergenic
1073318524 10:102599791-102599813 AACAGACAGGAGGCCAGGTTGGG + Intronic
1074522042 10:114234839-114234861 AAGAGACCACAGACCAAATTAGG + Intergenic
1075009913 10:118858909-118858931 AACAGCCAATGGGCCAATTTTGG - Intergenic
1075038109 10:119086248-119086270 AACAGGCAGTAGACCAAATTTGG + Intergenic
1075229351 10:120660398-120660420 AACAGACAGCAAGTCAGATTTGG + Intergenic
1075358575 10:121807743-121807765 AACAAGCAGCAGACCAAATTTGG - Intronic
1075714062 10:124545775-124545797 AACAAACCACAGGCATAATTTGG + Intronic
1075953138 10:126499059-126499081 TACAGACTGCAGGCCAAATCTGG + Intronic
1076154860 10:128195938-128195960 AACAGGCAGCAGGCTAGATTTGG - Intergenic
1077952200 11:6972338-6972360 AACAGGTGACAGGCCAAATTTGG + Intronic
1078112839 11:8413091-8413113 AACAGATGGCATGCCAAATTTGG - Intronic
1078760170 11:14245369-14245391 GACAGACAACAGACCAAGTTGGG + Intronic
1079049222 11:17138806-17138828 AACAGAGAGCAGGCCAGATTTGG + Intronic
1079963897 11:26957104-26957126 AACAGTCAAGAGGCAAAAATGGG - Intergenic
1082096186 11:48131580-48131602 AACAGACAATGAGCCAAATTTGG - Intronic
1084602333 11:70153351-70153373 AACAGACAGGGGGCCAGATTTGG + Intronic
1084682526 11:70674844-70674866 AACAGGCAATGGGCCAGATTTGG + Intronic
1085607437 11:77914747-77914769 AGCAGGCAACAGGCCAGCTTTGG + Intronic
1085658445 11:78339317-78339339 AAAAGAGAACAGGGCAAGTTTGG - Intronic
1086384302 11:86291340-86291362 AACAGACAGCTGGCCAGGTTCGG - Intergenic
1086389567 11:86348884-86348906 AAAAGACAATAGGAAAAATTAGG - Intergenic
1087283198 11:96235243-96235265 AACAGCCTGCAGGCCAGATTTGG - Intronic
1087431034 11:98055725-98055747 AGCAGACACCATACCAAATTAGG - Intergenic
1087949183 11:104199201-104199223 AACAGGCACTGGGCCAAATTTGG + Intergenic
1088526084 11:110756570-110756592 AACAGTGAACAGGACAAATATGG - Intergenic
1088726544 11:112642173-112642195 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1089043664 11:115479923-115479945 AACAGACAACAGGAGAGATATGG + Intronic
1089276374 11:117338812-117338834 AACAGGCAAGAGGCCAAGGTAGG - Intronic
1089924132 11:122239609-122239631 AAAAGACAAGGGGCCAGATTAGG + Intergenic
1090069671 11:123532637-123532659 CATAGCCAACAGGCCAAATTCGG + Intronic
1091733499 12:2899401-2899423 AACTGACGGCAGGCCAGATTTGG + Intronic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1095254447 12:40018128-40018150 AACAGAAAGCCGGCCAGATTTGG - Intronic
1095454543 12:42369010-42369032 AACAGACAGCTGACCAGATTTGG - Intronic
1095505229 12:42890049-42890071 AACAGAAAAGAGGCATAATTAGG - Intergenic
1095549900 12:43423303-43423325 AATAGGCAACAGGCCAGATTTGG + Intronic
1095632341 12:44392937-44392959 AACAAACATCAGGGCAAATTTGG + Intergenic
1095837866 12:46658030-46658052 AACAGAAAACAGGCAAAATAGGG + Intergenic
1096713297 12:53474318-53474340 AAGAGACAAGAGTCCAAAGTAGG - Intronic
1097612642 12:61843400-61843422 AAAAAACAACAGGAAAAATTCGG + Intronic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1098115026 12:67166024-67166046 AATAGGCCACAGGCCAGATTTGG - Intergenic
1098177681 12:67809892-67809914 AACAGACAACTGACCAAAATGGG - Intergenic
1098276073 12:68812582-68812604 AACAGGTAACAGGCCAAAGTTGG - Intronic
1098377346 12:69831216-69831238 AACAGGCTGCAGGCCAGATTTGG - Intronic
1098513747 12:71349636-71349658 AACAGGTGACAGGCCAGATTTGG + Intronic
1098830670 12:75358996-75359018 AACAGACCATAGGACAGATTTGG + Intronic
1099947578 12:89262331-89262353 CACAGACTACAGGCTATATTTGG + Intergenic
1099980439 12:89595244-89595266 AATAGACAACAGGCTAGATTTGG + Intronic
1100144847 12:91665049-91665071 AGCAGTGAACAGGCCAGATTTGG - Intergenic
1100392706 12:94158015-94158037 AACAGGCAACAAGCCAGATTTGG + Intronic
1100414956 12:94362327-94362349 AACTAACAACAGGCCAAGTGCGG + Intronic
1100791673 12:98137023-98137045 ACAAAACAACAGACCAAATTTGG + Intergenic
1101051551 12:100868944-100868966 AACAGACAGCAGGCCAGATGTGG + Intronic
1101208013 12:102508208-102508230 AACAGGCAATGGGCCAGATTTGG - Intergenic
1101366289 12:104073846-104073868 AAAAGACAGCAGGCCACATTTGG - Intronic
1102033104 12:109754620-109754642 AGCAGCCAGCAGGCCAGATTTGG + Intronic
1102590670 12:113954694-113954716 TACAGTCCACAGGCCAAATCTGG + Intronic
1102702977 12:114855838-114855860 AACAGTCAATTGGCCAAATTGGG - Intergenic
1102817627 12:115880511-115880533 AACAGACAATAGGCCAGGTTTGG + Intergenic
1102954325 12:117049550-117049572 AACAGCCCATAGGCCCAATTTGG + Intronic
1102954328 12:117049563-117049585 AATAGATGACAGGCCAAATTGGG - Intronic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1103964137 12:124627351-124627373 ACCAGGCAACAGGCCAGATCTGG - Intergenic
1104578617 12:129991666-129991688 AACAGGCAACAGATCAGATTTGG + Intergenic
1105451806 13:20506792-20506814 TACAGCCCACAGGCCAAATCTGG + Intronic
1105661616 13:22502119-22502141 TACAGGCATCAGGCCAGATTTGG + Intergenic
1105866254 13:24462011-24462033 AACAGACACAAGGCAGAATTTGG + Intronic
1106199208 13:27522514-27522536 AACAGACAACAGGCCAAGTGGGG + Intergenic
1106353209 13:28954905-28954927 AACAGAGCACAGGCCAAATAAGG - Intronic
1106743328 13:32671782-32671804 AACACACAACTGGCTTAATTAGG - Intronic
1107002288 13:35562302-35562324 AACAGAAATCAGGTCAATTTGGG - Intronic
1107937070 13:45354065-45354087 AACAGAAATAAGCCCAAATTTGG - Intergenic
1108021297 13:46130334-46130356 AGCAGACAACAGGGCAGATCTGG + Intronic
1108118296 13:47154581-47154603 AAAAGATGACAGGCCAGATTTGG - Intergenic
1108522322 13:51257667-51257689 AACAGAAAACAGGCCAATGTAGG - Intronic
1108524263 13:51272512-51272534 TAAAGACCACAGGCCAAATCTGG + Intronic
1109559799 13:64031949-64031971 AAAAGGCAACAGTCCAAATGTGG + Intergenic
1110097766 13:71551797-71551819 AAGAGACAAAAAGCCAAATATGG + Intronic
1110288427 13:73776942-73776964 AAAAGACAACAGTCCAATTGGGG + Intronic
1110444682 13:75565680-75565702 GACAGCCTACAGGCCAAATCTGG - Intronic
1111436662 13:88219776-88219798 AACAGGCACCAGCCCAAATTGGG + Intergenic
1111644117 13:91008678-91008700 AAAAGACAACAGGTCAGAGTAGG - Intergenic
1112518441 13:100076350-100076372 AACAGAGGACTGGCCAGATTTGG - Intergenic
1114817219 14:25974438-25974460 AACAGATTGCAGGCCAGATTTGG + Intergenic
1115097539 14:29655674-29655696 AATAGAAAAAAGGCCAATTTTGG + Intronic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1115523423 14:34255593-34255615 AACAGGCCACAGGCCCAATTTGG + Intronic
1115859101 14:37664707-37664729 AACAGACAACCTACAAAATTGGG + Intronic
1116090387 14:40296522-40296544 AACAGACACCAGGCTAAAAGGGG - Intergenic
1116995471 14:51319293-51319315 AACAGTCAGCAAGCCAGATTAGG - Intergenic
1117713276 14:58554822-58554844 AAAAGACTTCAGGCCAGATTTGG + Intergenic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1119732407 14:76959136-76959158 GACAGACAACAGGCCCATGTAGG + Intergenic
1120093599 14:80362897-80362919 AACAGACAGTGGGCCATATTTGG - Intronic
1120267354 14:82268190-82268212 GACAGACAACAGAGCAAAGTAGG - Intergenic
1120703741 14:87726092-87726114 AAGAGAAAAAAGGCCAAATCGGG - Intergenic
1120959998 14:90115711-90115733 AACAGGCAACAGGCCGATCTAGG + Intronic
1121066391 14:90970973-90970995 TACAGACCAGAGGCCAAATCTGG + Intronic
1121386112 14:93527230-93527252 AACTGGCAGCAGGCCAGATTTGG - Intronic
1121615897 14:95313458-95313480 AAGAGGCAGCAGGCCAGATTTGG + Intronic
1121750069 14:96345890-96345912 AACAGACGACAGGACCAATTTGG + Intronic
1122379562 14:101292590-101292612 AACAGTCCACAGGCTGAATTTGG - Intergenic
1122621712 14:103061678-103061700 AACAAGCAGCAGGCTAAATTTGG + Intergenic
1123725319 15:23095752-23095774 AACAGGCAACAAGCCTAATATGG + Intergenic
1124794152 15:32760523-32760545 AAAAGATTACAGGGCAAATTTGG - Intergenic
1125136570 15:36350661-36350683 AAAAGACAAAAGGACAAAGTAGG - Intergenic
1125635865 15:41188238-41188260 AACAGTCTGCAGGCCAGATTTGG + Intronic
1125826357 15:42679801-42679823 AACAGGCAGCAGACCAGATTTGG + Intronic
1125848292 15:42879661-42879683 AACAGTCTGCAGGCCAAATTTGG - Intronic
1125894539 15:43291603-43291625 AACAGGCAGTAGGCCACATTTGG + Intronic
1126614499 15:50563122-50563144 AACAGGCAACAGACCAGATTTGG - Intronic
1126748785 15:51854318-51854340 GACAGGCAGCAGGCCGAATTTGG + Intronic
1126934793 15:53694902-53694924 AACAGGCAGCAGGCCTGATTTGG - Intronic
1128777946 15:70338021-70338043 AGCAGCAAACAGGCCAAATTTGG - Intergenic
1128994059 15:72283922-72283944 AATAGGCCACAGGCCAGATTTGG + Intronic
1130625203 15:85507285-85507307 AACAGGCAGCAGGCTAGATTTGG - Intronic
1130762738 15:86837397-86837419 TACAGCCTCCAGGCCAAATTTGG + Intronic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1131528194 15:93169325-93169347 AACATACAACAGATCAGATTTGG - Intergenic
1132422126 15:101679177-101679199 AGCTGACAACTTGCCAAATTTGG - Intronic
1133610213 16:7426393-7426415 ATAAGAAAACAGGCCCAATTCGG - Intronic
1133906682 16:10028870-10028892 AACAAACAAGGGCCCAAATTGGG + Intronic
1134147813 16:11781310-11781332 AAAGGACAGCAGGCCAGATTGGG + Intronic
1134303923 16:13015140-13015162 AACAGGCGGCAGGCCAGATTTGG - Intronic
1134518524 16:14906340-14906362 AACAGACAGCTGGCCAGAGTTGG - Intronic
1134555406 16:15159877-15159899 AACAGACAGCAGGCCAGAGTTGG + Intergenic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1134706195 16:16304993-16305015 AACAGACAGCTGGCCAGAGTTGG - Intergenic
1134961345 16:18407117-18407139 AACAGACAGCTGGCCAGAGTTGG + Intergenic
1134965645 16:18489720-18489742 AACAGACAGCTGGCCAGAGTTGG + Intronic
1135151144 16:20007097-20007119 AACAGACAGTGGGCCAGATTTGG - Intergenic
1138278610 16:55755399-55755421 AAAAGACAGTAGGCCAGATTTGG - Intergenic
1138289945 16:55838222-55838244 AAAAGACAGTAGGCCAGATTTGG + Intergenic
1138602896 16:58067691-58067713 AACAAAAAACAGACTAAATTAGG + Intergenic
1138956169 16:61972754-61972776 AAAAGACAATAGGAAAAATTAGG - Intronic
1139048325 16:63090848-63090870 AACAGGCAGTAGACCAAATTTGG - Intergenic
1139206705 16:65035947-65035969 AGCAGACAGAAAGCCAAATTGGG - Intronic
1139780463 16:69347275-69347297 AACAGGCAATGGGCCAGATTTGG + Intronic
1140325487 16:73997539-73997561 TACTGACTACGGGCCAAATTTGG - Intergenic
1141043719 16:80695110-80695132 AACAAACATCTGGCCAGATTTGG - Intronic
1141885162 16:86886693-86886715 AACAGGCAGCAGGCAAGATTTGG - Intergenic
1142243255 16:88956663-88956685 AACAGACACCAGGCCAGGTGGGG - Intronic
1143753987 17:9053079-9053101 AACAGGCAACAGACAGAATTTGG - Intronic
1144294601 17:13861639-13861661 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1146089592 17:29862995-29863017 AACAGACCATGGGCCACATTTGG - Intronic
1146119638 17:30180757-30180779 AACAGGCAACAGGCCAGATTTGG + Intronic
1146528455 17:33587053-33587075 AACAGGCAACAGGCTGGATTTGG - Intronic
1147730779 17:42600090-42600112 CACACACAACAGGCCACATGTGG + Intronic
1148402089 17:47372964-47372986 AACAGAAAACAATCCAAATTTGG - Intronic
1149030282 17:52074808-52074830 AACAGGCAATGGGCCATATTTGG - Intronic
1149158333 17:53661156-53661178 AACAAACGGCAGGCCAGATTTGG + Intergenic
1149454748 17:56778798-56778820 AAGAGAGAAAAGACCAAATTAGG - Intergenic
1149573409 17:57693875-57693897 AATAGGCAACAGGCCTGATTTGG - Intergenic
1149786900 17:59443331-59443353 AACAGGCAGCAGTCCAAATTTGG + Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1150192746 17:63260425-63260447 AACAGGTAGCAGGCCATATTTGG + Intronic
1150997157 17:70331771-70331793 AACCGACAGCAGGTCAGATTTGG - Intergenic
1153141305 18:1975461-1975483 AAGAGGCAACAGGCCATATTTGG + Intergenic
1153397374 18:4639889-4639911 AACAGCCAAGAAGCCAAATTTGG + Intergenic
1153443461 18:5146841-5146863 AACAGACCACAGGCCAGATTTGG + Intronic
1153813184 18:8770064-8770086 ACCAGAAAACAGCCCAAATATGG + Intronic
1155087897 18:22475413-22475435 AGTAGGCAACAGGCCATATTTGG - Intergenic
1155901097 18:31391634-31391656 AACAGACAGCAAGCCAGATTTGG - Intronic
1156279503 18:35621480-35621502 AACAAACAACAGACCAATTGCGG - Intronic
1156753467 18:40490740-40490762 AACTGACAGCCGGCCAGATTTGG + Intergenic
1156877066 18:42027591-42027613 AACAGGCAACAGGCTGAATTTGG - Intronic
1156904569 18:42337730-42337752 AACAGGCAACAGGCAGAGTTTGG - Intergenic
1156908513 18:42382901-42382923 AACAAAAAACACCCCAAATTGGG - Intergenic
1157018631 18:43751084-43751106 AACAAGCAACAGGCCAGATTTGG + Intergenic
1157268902 18:46254470-46254492 AACAGGCAGCAGGCCAGAATTGG - Intronic
1157534088 18:48445829-48445851 AACAGGCAACGGACCAGATTTGG + Intergenic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1157938348 18:51897867-51897889 AACAGGCAACTGGCCCGATTTGG + Intergenic
1158116233 18:53999094-53999116 AAAAGACAACAGTCCCCATTTGG + Intergenic
1160712472 19:558914-558936 AACTGACCTCAGGCCAGATTGGG + Intergenic
1165292913 19:34903902-34903924 AACAGACTATAGGCCACATTTGG + Intergenic
1166320061 19:42012132-42012154 AATAGACAGCAGGTCAGATTTGG - Intronic
1166527545 19:43522048-43522070 AACTGATGGCAGGCCAAATTTGG - Intronic
1166563993 19:43752434-43752456 AACAGAAAGCAGACCAGATTTGG - Intronic
1167381925 19:49143151-49143173 GACGGACCACAGGCCAAGTTAGG - Intronic
1167711013 19:51110935-51110957 AACAGGCAGCAGGCCCGATTTGG + Intergenic
1168411835 19:56145095-56145117 AACAGGCTGCAGGCCAGATTCGG + Intronic
926543409 2:14208932-14208954 AGCAGACAACATGGCATATTAGG - Intergenic
928008939 2:27589540-27589562 AACAGACAATAGGGGAAATGTGG - Intronic
928243475 2:29606628-29606650 AACAGGCAATGGGCCAGATTAGG - Intronic
929196433 2:39189605-39189627 AACAGGCAGTAGGCCAGATTTGG - Intronic
929470806 2:42190951-42190973 AACAGTTGACAGGCCAGATTTGG + Intronic
929987992 2:46756467-46756489 AACAGGCCACAGGCCAGATTTGG + Intronic
930022569 2:47010357-47010379 AACAGTTCACAGGCCAAATCTGG - Intronic
930875907 2:56215808-56215830 AACAGGCAACAGGCTAAATGTGG - Intronic
931190949 2:59999733-59999755 TACAGCCTACAGTCCAAATTCGG + Intergenic
931830541 2:66046414-66046436 AACAGACAAAAGGCCAATTCTGG - Intergenic
932529839 2:72517336-72517358 AACAGGCAACAGGCTGGATTTGG + Intronic
933189523 2:79318670-79318692 AACAGGCAGCAGGCTAGATTTGG - Intronic
933447492 2:82400899-82400921 AAGTGACAACAGGCAATATTTGG + Intergenic
933462523 2:82607175-82607197 AACAGGCAACAAGCTAGATTTGG - Intergenic
934648806 2:96075576-96075598 AGCAGGCAGCAGGTCAAATTTGG + Intergenic
934862672 2:97777417-97777439 AACAGACTGCAGGCCAGATTTGG - Intronic
935355457 2:102195085-102195107 ACCACACAACGGGCCAAATGTGG - Intronic
935604992 2:104962540-104962562 AAAAGACAACAGGCCAGATGCGG - Intergenic
935607514 2:104985515-104985537 AAGAGTCAACAGCTCAAATTAGG + Intergenic
935665056 2:105503979-105504001 TACATACAACAGAGCAAATTTGG + Intergenic
935685470 2:105679132-105679154 AAGAGAAAACAGACAAAATTGGG - Intergenic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
936791997 2:116162164-116162186 TACAGACAACAAGCAAAAGTGGG - Intergenic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
940450753 2:153833722-153833744 AACAAGCAGCAGGCCAGATTTGG + Intergenic
940756857 2:157693184-157693206 AACAGACAGTGGGCCATATTTGG + Intergenic
940996990 2:160160063-160160085 AACAAGCAACAGGCCAAATATGG - Intronic
941078020 2:161028579-161028601 AGCACACAACAGACCTAATTTGG + Intergenic
941677483 2:168359241-168359263 AACAGACAGCAAGCCAGATTAGG - Intergenic
942040732 2:172059675-172059697 AACAGTCAGCAGTCCAGATTTGG + Intronic
942866443 2:180681290-180681312 AACAGATAGCAGGCAAAATTTGG - Intergenic
942936745 2:181566382-181566404 AACAGGCACCAGGACAAATTGGG - Intronic
943631212 2:190254308-190254330 AACAGAGAAAAGGCCACATGAGG + Intronic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
943949412 2:194111684-194111706 CACAGACAAAAGGCCAAGTGAGG - Intergenic
944611925 2:201419243-201419265 GACAGCCCACAGGCCAACTTCGG + Intronic
944953680 2:204783330-204783352 CACAGAGAACAGGCCACATAAGG - Intronic
946842100 2:223829289-223829311 AACAGGCAGAAGGCCAGATTTGG - Intronic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
947699787 2:232223074-232223096 AACACACAACAGTCCAAATTCGG - Intronic
948025278 2:234771538-234771560 AACAGACAAAAGGCTGAAGTAGG + Intergenic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
948240706 2:236430995-236431017 AACAGGCACCAGGCCAGATTTGG - Intronic
1168781593 20:496210-496232 GGCAGACCACAGGCCAAATTTGG + Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168866224 20:1089329-1089351 AACAAGCAGCAGGCCAGATTTGG + Intergenic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1169175652 20:3510436-3510458 AGCAGACAGCAGGCCTGATTTGG + Intronic
1169795434 20:9457841-9457863 GACAGAAAACCGCCCAAATTGGG + Intronic
1169837910 20:9900941-9900963 AAGAGGCAGCAGGCCAGATTTGG - Intergenic
1169993155 20:11525965-11525987 AACAGAAAACAAGCATAATTCGG - Intergenic
1171278340 20:23876943-23876965 AACAGACAACACCCCAAAGCAGG + Intronic
1173451107 20:43164891-43164913 AACAGGCAGCAGGCCAGATCTGG + Intronic
1173877413 20:46383009-46383031 AACAGGCAACAGGCCTAATATGG - Intronic
1173971993 20:47160400-47160422 AACAGGCGACAGGCCAGATTTGG + Intronic
1174219767 20:48944833-48944855 AGCAGACAGTAGGCCAGATTTGG - Intronic
1174792906 20:53497130-53497152 AACAAGTAGCAGGCCAAATTTGG + Intergenic
1174937889 20:54892520-54892542 AACAGGCAGCAGACCTAATTCGG - Intergenic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175451002 20:59068019-59068041 AACAGAGAGCTGGCCAGATTTGG - Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1177011532 21:15735834-15735856 AAAAGACAATAAGCAAAATTTGG - Intronic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177502706 21:21978650-21978672 AACAGAAAACAGTCTAGATTTGG - Intergenic
1177594561 21:23220870-23220892 AACAGAAAACATTCCAAATTTGG - Intergenic
1177607986 21:23407156-23407178 AACAGGCAGCAAGCCAGATTTGG + Intergenic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1178374804 21:32057766-32057788 AACAGATGACAAGCCAGATTTGG - Intergenic
1178453460 21:32726731-32726753 AACAGAGACCATGACAAATTGGG + Intronic
1178604023 21:34019535-34019557 AACAGGCAATGGGCCAGATTTGG - Intergenic
1179184886 21:39077976-39077998 AACAGACAAAGGGCCAGATTTGG + Intergenic
1179393326 21:41013806-41013828 AACAGGCAGCTGGCCAAACTTGG + Intergenic
1179420739 21:41234386-41234408 AACAGGCAGCAGGTCAGATTTGG - Intronic
1180662950 22:17484884-17484906 AAAGGACATCAGGCCAGATTTGG + Intronic
1181914009 22:26264760-26264782 TACAGCCCACTGGCCAAATTTGG - Intronic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
1183218504 22:36496722-36496744 AACAGACGCCAGGCCAAGTGGGG + Intronic
949121661 3:391955-391977 AACAGGCAGCAGGCTGAATTTGG - Intronic
949345593 3:3073379-3073401 AACAGGCAACAAGCCAGATTTGG - Intronic
949571162 3:5294553-5294575 AACAGAAATAAGGCTAAATTGGG - Intergenic
951106910 3:18755055-18755077 AACAGGCAGTAGGCCATATTTGG - Intergenic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
951989938 3:28665184-28665206 AACAGTCCACAGGCCAGATGTGG - Intergenic
952084916 3:29808318-29808340 AAAAGAGAAGAAGCCAAATTGGG - Intronic
952085799 3:29819403-29819425 AACAGATAACAGACCAGATTTGG + Intronic
955144733 3:56305767-56305789 AGCAGGCAAAAGGCCAGATTTGG - Intronic
955358768 3:58254293-58254315 TACAGCCTACAGGTCAAATTTGG + Intronic
955499603 3:59570755-59570777 AATAGACCACAGGCCAAATTTGG - Intergenic
955591723 3:60543233-60543255 AACAGGCAGCAGCCCAGATTTGG + Intronic
955666991 3:61360307-61360329 ACCAGACAGCTGGCCAGATTTGG + Intergenic
955830308 3:62994520-62994542 AACAGTCCACAGGCCAGATTTGG + Intergenic
955842130 3:63123862-63123884 AACAGCCAACAGGCAGATTTGGG - Intergenic
955960054 3:64331332-64331354 AACAGCCTAGAGGCCAAATTTGG - Intronic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
956402811 3:68897925-68897947 CACAGACAACAGATCACATTGGG + Intronic
956424317 3:69117807-69117829 TACAAACAACTGGCCCAATTTGG + Intronic
956524008 3:70137336-70137358 AATAGGCAACAGGACAAATTTGG - Intergenic
956635345 3:71358725-71358747 AACAGACAGTAAGCCATATTTGG - Intronic
956732926 3:72213454-72213476 AACAGGCTGCAGGCCAAATTCGG - Intergenic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
957110326 3:75947377-75947399 AACAGGCAGCAGGCCAGATCTGG - Intronic
958072466 3:88632105-88632127 AACAGATAATGGGCCAAATTGGG + Intergenic
958982936 3:100745776-100745798 AACAGGCAATAGTCCAGATTTGG - Intronic
959719041 3:109466734-109466756 AACAGACAACCTGCAGAATTGGG + Intergenic
959890753 3:111552673-111552695 AATAGGCAACAAGCCAGATTTGG + Intronic
960263655 3:115595979-115596001 AATAGGTAGCAGGCCAAATTTGG - Intergenic
960670459 3:120150844-120150866 AACAGGCAGCAGGCTAGATTTGG + Intergenic
960735760 3:120778101-120778123 AACAGGCAAGAAGCCAAGTTGGG - Intronic
960765577 3:121126211-121126233 AACAGGCAGCATGCCAGATTTGG - Intronic
961247023 3:125463536-125463558 AAGAGACCACAGGACAACTTAGG + Intronic
961472328 3:127123710-127123732 AATAGGCAACAGGCCAGATTTGG + Intergenic
961776016 3:129286117-129286139 AACAGGCAGTAGGCCAGATTTGG - Intronic
962055484 3:131866965-131866987 AACAGAGAAAAGGCCAAAACAGG + Intronic
962563268 3:136630580-136630602 AAGAGACAACATGCCATATTTGG + Intronic
963633185 3:147759693-147759715 AACAGAAAATAGGTCAAGTTTGG - Intergenic
964897929 3:161620710-161620732 AACAGAAAAAATGCCAGATTAGG + Intergenic
964968289 3:162526361-162526383 AGCAGACTACAGGCTAGATTTGG + Intergenic
965088064 3:164125162-164125184 AACACAAGACAGGCCACATTTGG - Intergenic
965512950 3:169589373-169589395 GATTGACAATAGGCCAAATTCGG + Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966532607 3:180997626-180997648 AACAGACCACAGGATGAATTTGG + Intergenic
966684628 3:182680561-182680583 AACAGAGAACAGGCCATCTGAGG + Intergenic
966954234 3:184857261-184857283 AACAGACGGCTGGCCAGATTTGG - Intronic
967185700 3:186942713-186942735 AACACACAACATGCCTAATCAGG - Intronic
970182423 4:13413824-13413846 AAATGACCACAGGCCACATTTGG + Intronic
970336280 4:15047208-15047230 AACAAACAAAAAGCCAAAGTTGG - Intronic
970748779 4:19332790-19332812 AACAGACAATCCCCCAAATTAGG - Intergenic
971059937 4:22956500-22956522 AGCAGGCCACAGGCCATATTTGG + Intergenic
971111151 4:23587493-23587515 ATGAGACAACAGGAGAAATTAGG - Intergenic
972586726 4:40444361-40444383 AACAAACAGCAGGCCATATTTGG - Intronic
973208558 4:47588406-47588428 ATCAGACAGTAGGCCAAATTTGG - Intronic
973827000 4:54718070-54718092 AACAGGCTACAGGCCAATTCTGG - Intronic
974061819 4:57042272-57042294 AACAGATGGCAGGCCAGATTTGG - Intronic
974340642 4:60611111-60611133 AACAGAAACCAGGCCAAGTGTGG + Intergenic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
976084146 4:81389926-81389948 AACAGGCAGCAGGCCAGACTTGG + Intergenic
976101753 4:81571705-81571727 AACAAACAAGTGGCTAAATTAGG + Intronic
976126260 4:81836552-81836574 AACAGGCAATCGGCCAGATTTGG + Intronic
977987695 4:103403642-103403664 GAAAGACAAGAAGCCAAATTAGG - Intergenic
979026808 4:115587900-115587922 AACACACAGCAGGGCAAGTTGGG + Intergenic
979270388 4:118753392-118753414 AACAGAAAATAGGCTAGATTTGG + Intronic
979841139 4:125441930-125441952 AACAGGCACTAGGCCCAATTTGG - Intronic
979934705 4:126677031-126677053 AACAGGTAGCAGGCCAGATTTGG + Intergenic
979970535 4:127129623-127129645 AACAGACAACAAGCTGGATTTGG - Intergenic
979975736 4:127194197-127194219 AACAGGAAGCGGGCCAAATTTGG + Intergenic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
982050551 4:151497369-151497391 AACAGGTGACTGGCCAAATTTGG - Intronic
982976389 4:162067341-162067363 AACAAAGAATAGGCCAAATGTGG - Intronic
983198298 4:164832906-164832928 TATAGACCACAGGCCAAATCTGG - Intergenic
983671976 4:170247831-170247853 GACAGGCAATAGGCCAGATTTGG - Intergenic
984155185 4:176187653-176187675 AACAGGCAACAGGCTGAATTTGG + Intronic
984160176 4:176242949-176242971 AACAGATGATAGGCTAAATTTGG - Intronic
985380017 4:189383545-189383567 ACCAGAGAATAGGCCAAATTTGG + Intergenic
986341092 5:6790048-6790070 AACAGGCAACAGGTCAGATTTGG - Intergenic
986448874 5:7847602-7847624 AATAGGCAACTGGCCAGATTTGG + Intronic
986801412 5:11264379-11264401 AACAAACAGTGGGCCAAATTTGG + Intronic
987287431 5:16471073-16471095 AACAGGTAGCAGGCCAGATTTGG + Intergenic
987419853 5:17706696-17706718 AACAGACAGTGGGCCAGATTTGG - Intergenic
987669246 5:20985994-20986016 AACAGACAAAAGGCCAAATTTGG - Intergenic
987900705 5:24007704-24007726 AACTAAGAACATGCCAAATTTGG + Intronic
988555583 5:32233137-32233159 AACAGGCGCCAGGCCAGATTTGG - Intronic
988832660 5:35002979-35003001 AACAAAGGACAGGACAAATTAGG + Intronic
989242925 5:39220811-39220833 AACATTCCACAGGCCAGATTTGG - Intronic
989437717 5:41434172-41434194 AGCAGCCAACAGGGCAAACTAGG - Intronic
990422060 5:55645456-55645478 AACAGACATCAGACAAGATTTGG - Intronic
990428091 5:55708878-55708900 ATCTGTCAGCAGGCCAAATTTGG + Intronic
990433591 5:55764248-55764270 AGATGGCAACAGGCCAAATTAGG - Intronic
990626985 5:57624678-57624700 AACAGACAGCAGGGCTTATTTGG - Intergenic
991343717 5:65640136-65640158 AACAGACAATGGACCAAATTTGG - Intronic
991451595 5:66756740-66756762 CACTGACAACAGAGCAAATTTGG + Intronic
992570016 5:78045893-78045915 AATAGGCAGCAGGCCATATTTGG - Intronic
992936560 5:81713142-81713164 AACAGACAAAAGAGCAAATAGGG + Intronic
993213884 5:84993905-84993927 AACAAACATCAGGCCTATTTGGG - Intergenic
993254213 5:85566730-85566752 AATAGTCCACAGGCCAGATTTGG - Intergenic
993295886 5:86139388-86139410 AACTGACAACATCCTAAATTAGG + Intergenic
993608261 5:90021553-90021575 CAGAGACATGAGGCCAAATTTGG + Intergenic
994438879 5:99775791-99775813 AAAAGATAAATGGCCAAATTAGG + Intergenic
994900894 5:105767878-105767900 GACAGGCATCAGGCCAGATTTGG - Intergenic
995138061 5:108701860-108701882 AACACACAACAGGGCCTATTAGG - Intergenic
996549373 5:124713356-124713378 AACAGACAGTGGGCCAGATTTGG - Intronic
996813710 5:127549695-127549717 AAAAGATGACAGGCCAGATTTGG - Intronic
998852280 5:146362760-146362782 AACAGGCAGCAGGCCAGCTTTGG + Intergenic
999006069 5:147980925-147980947 AACAAACAACATGGAAAATTAGG + Intergenic
999054723 5:148562101-148562123 AACAGACAGCAGGCTGGATTCGG - Intronic
999387957 5:151168937-151168959 AGCAGACAACCAGCCAGATTCGG + Intergenic
1000008677 5:157211554-157211576 AACAGACAGCAGGCTGGATTTGG - Intronic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1001709791 5:173769084-173769106 AACAGGCAAGGGGCCAGATTTGG - Intergenic
1001808034 5:174605518-174605540 AACAGACAATAGAGAAAATTAGG - Intergenic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1003026587 6:2560300-2560322 AACAGGCTTCAGGCCAAATGTGG - Intergenic
1004568710 6:16824137-16824159 AACAGGCAGCAGGCCAGAATTGG - Intergenic
1004835313 6:19524465-19524487 AACAGGCAACAGGGCAGATTTGG - Intergenic
1004873126 6:19927641-19927663 AACACATCACAGGCTAAATTTGG - Intergenic
1005190126 6:23211686-23211708 AACACACAACAGGCAGGATTTGG - Intergenic
1005489945 6:26338527-26338549 AACAGGTAGCAGGCCACATTTGG - Intergenic
1006649584 6:35539880-35539902 AAGAGATGGCAGGCCAAATTTGG - Intergenic
1006732877 6:36249437-36249459 AAAAGACAAAATGTCAAATTTGG - Intronic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1009474671 6:64075546-64075568 AACAGACAATTGGTGAAATTTGG - Intronic
1009760351 6:67997049-67997071 AAGAGAAAAAAGACCAAATTTGG + Intergenic
1010129621 6:72475629-72475651 AATAGGCAACAGAACAAATTTGG - Intergenic
1010416082 6:75613149-75613171 AACAGGCAGCTGGACAAATTTGG - Intronic
1010816750 6:80366872-80366894 AACAGACATCTGGCAGAATTAGG + Intergenic
1011408510 6:87041366-87041388 TATAGACAACAAGGCAAATTAGG + Intergenic
1011685749 6:89822137-89822159 AACAGCCAGGAGGCAAAATTTGG + Intergenic
1011876503 6:91968487-91968509 GACAGACAAAAGGCCAAAACAGG - Intergenic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013801748 6:113953802-113953824 AAGAGGCAATTGGCCAAATTTGG - Intronic
1014657900 6:124130964-124130986 AACAGACACCAGGCCAAGACAGG - Intronic
1015170049 6:130242365-130242387 AACAGGCAGTAGGCCAGATTTGG + Intronic
1015283521 6:131459201-131459223 AACAGGCAGCAGACCAGATTTGG + Intergenic
1015726799 6:136307427-136307449 AACAGGCTGCAGGCTAAATTTGG - Intergenic
1015758816 6:136635475-136635497 AAAAGATGACAGGCCTAATTTGG - Intronic
1017265932 6:152446275-152446297 AACAGGCAACTGGCTAAATGTGG + Intronic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1018529640 6:164749288-164749310 AAAAGATAACAAGCCATATTAGG - Intergenic
1018662008 6:166097070-166097092 AACAGAAATGAGGCCAAATCTGG + Intergenic
1020778929 7:12494063-12494085 AAAAGGCAACAGGCTAAATAAGG + Intergenic
1020823391 7:12998498-12998520 AACAGACAAACAGCCAAATCAGG - Intergenic
1020925768 7:14322131-14322153 AACAGGCAGCAGGCCAGATCTGG - Intronic
1021664643 7:22963747-22963769 AACAGGCATCAGGCCAGACTGGG + Intronic
1022054161 7:26711961-26711983 AACTGGCAACTGACCAAATTAGG + Intronic
1023072780 7:36453906-36453928 AACACACAATAAGCCAAACTGGG - Intergenic
1023291946 7:38678084-38678106 AACTGTCCACAGGCCAAAATTGG + Intergenic
1023385252 7:39650263-39650285 AACAGGCAGCAGGCTGAATTTGG - Intronic
1023394963 7:39744077-39744099 AAAAGACAACAGGCATAAATAGG - Intergenic
1023931615 7:44709617-44709639 AAGCGACAACAGGACAAATCCGG - Intergenic
1025845571 7:65193500-65193522 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1025895790 7:65699213-65699235 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1026197128 7:68182839-68182861 AAAAGTCAAGAAGCCAAATTTGG - Intergenic
1026276558 7:68883049-68883071 ATAGTACAACAGGCCAAATTGGG - Intergenic
1026291053 7:69006515-69006537 AACGGGCATCAGGCCAGATTTGG - Intergenic
1027680622 7:81216267-81216289 AACAGGACACAGGCCAAATTTGG - Intergenic
1027723336 7:81771394-81771416 AAAAGAAAGCAGGCCAAATGTGG + Intergenic
1028357349 7:89925403-89925425 AACAGACAGCAGGCTGAATTTGG - Intergenic
1028703446 7:93810769-93810791 AACAGTGTACAGGCCAAATATGG - Intronic
1030797740 7:113809684-113809706 AACAGGCAACGGGCCAGATGGGG - Intergenic
1031264088 7:119561706-119561728 AACACACAAAAGGCCAAAATTGG - Intergenic
1031463490 7:122080289-122080311 AACAGACAATGAGCCAAATTTGG - Intronic
1032865763 7:135922476-135922498 AACAGGCAATGGGCCAGATTCGG + Intergenic
1033370438 7:140702646-140702668 AACTGACAAGAGGCTAATTTTGG - Intronic
1034507915 7:151509666-151509688 TACAGACCAGGGGCCAAATTTGG + Intronic
1034507917 7:151509679-151509701 AACAGGCTGTAGGCCAAATTTGG - Intronic
1034877296 7:154736526-154736548 AAGAGACAGCAAGCCAGATTTGG + Intronic
1036004616 8:4647577-4647599 AACACACACCAGGACATATTGGG - Intronic
1036214575 8:6868358-6868380 AACAGGCAGCAAGCCAGATTTGG - Intergenic
1036505789 8:9354440-9354462 AATAGACAGTGGGCCAAATTTGG - Intergenic
1036738335 8:11339474-11339496 AACAGGCAGCGGGCCAGATTTGG - Intergenic
1037072772 8:14673009-14673031 AACACACAGCAGGCAAGATTTGG + Intronic
1037352081 8:17971214-17971236 AACAGGCAGCAGGCTGAATTTGG + Intronic
1038108270 8:24462902-24462924 AATAGAAAACATGCCCAATTTGG - Intronic
1038127656 8:24692180-24692202 AACAGACCACATGCCAACTCTGG + Intergenic
1041064725 8:54071334-54071356 AACATACAACACTCCAAATTAGG - Intronic
1041541317 8:58988306-58988328 AGCAGACAGCAGACCAGATTTGG - Intronic
1041992496 8:64011133-64011155 AACAGACAAAAGTACAGATTAGG + Intergenic
1042330909 8:67579677-67579699 AACAGGCAGCAGGCCAGATATGG - Intronic
1042929747 8:74001559-74001581 AACAAAAAACAGGCCACATGTGG + Intronic
1043217647 8:77614931-77614953 AAAAGACAAGAAGCCATATTTGG - Intergenic
1043882269 8:85557849-85557871 AACAAACAACAAGCAAAGTTAGG + Intergenic
1044288351 8:90437540-90437562 AACAATCAACAAGGCAAATTTGG + Intergenic
1044313240 8:90719529-90719551 AACAGGTAGCAGGCCAGATTTGG + Intronic
1044400076 8:91760115-91760137 AACAGCCAAGAGGCTAAATGTGG - Intergenic
1044619701 8:94176801-94176823 AACTCACAAAAGGCCAAATTGGG + Intronic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1045181521 8:99788788-99788810 AATAGGCTACATGCCAAATTTGG + Intronic
1046128471 8:109940096-109940118 AACAGTCTACAGGGCAAACTAGG - Intergenic
1046290461 8:112153401-112153423 AACTGACAACATGCCAAATGAGG + Intergenic
1046885945 8:119367274-119367296 AACAGTCAGCAGACCAAATTTGG + Intergenic
1048859060 8:138710099-138710121 AAGAGAAAACATGCCAAAGTAGG - Intronic
1050243524 9:3662480-3662502 AAAAGTCAACAAGCCATATTGGG - Intergenic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1050440534 9:5657767-5657789 AACAGGCACCAGGGCATATTTGG - Intronic
1051066560 9:13111141-13111163 AACAGGCAGTGGGCCAAATTTGG - Intronic
1051406700 9:16745249-16745271 AGAAGACCACAGGCCAAGTTTGG + Intronic
1051677056 9:19569261-19569283 AACAGGCTGCAGGCCAGATTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1052480266 9:29015555-29015577 AATAGACAGCAGGTCAGATTTGG + Intergenic
1052615902 9:30841378-30841400 AACAGAAAACTTCCCAAATTTGG - Intergenic
1052726863 9:32239066-32239088 GTCAGACAGCTGGCCAAATTTGG - Intergenic
1055311643 9:74988803-74988825 AATAGGCTACAGGCCAAATTGGG + Intronic
1055340785 9:75280605-75280627 AACAGACAAAAGGCCCCATGGGG - Intergenic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1055862998 9:80776183-80776205 AACAGCCCACAGGCCAAATCTGG - Intergenic
1058646776 9:107138403-107138425 AACAGGCAGTGGGCCAAATTTGG - Intergenic
1058939219 9:109797860-109797882 AAGCCACAACAGTCCAAATTAGG - Intronic
1059205763 9:112463591-112463613 AAAAGACAACAAGCCAACTCTGG - Intronic
1059424112 9:114210165-114210187 AACAGACAACTGGCTGGATTTGG - Intronic
1059812895 9:117876245-117876267 AAAAGAAAAAAGTCCAAATTAGG - Intergenic
1059946867 9:119418139-119418161 AACAGGCAATAGGCCAGACTTGG + Intergenic
1060302117 9:122380523-122380545 TACAGCCTGCAGGCCAAATTCGG + Intronic
1060382712 9:123191738-123191760 AACAGGCAATGGGCCAAATTTGG + Intronic
1060384046 9:123206304-123206326 AACAGACAATTGGGGAAATTCGG + Intronic
1060803492 9:126559495-126559517 AACAGACACCTGACCAAATAAGG + Intergenic
1061009944 9:127948887-127948909 AACTAACAACAGCCCAAATGTGG + Intronic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1186058963 X:5682866-5682888 TACAGAGAACAGGCCATGTTAGG + Intergenic
1186370592 X:8942921-8942943 AACATGTAGCAGGCCAAATTTGG + Intergenic
1186701949 X:12099950-12099972 AACAAGCCACAGGCCAGATTTGG - Intergenic
1186706342 X:12143264-12143286 AACAGTCAGCAAGCCAGATTTGG - Intronic
1186896322 X:14007962-14007984 AACAGACTGCAGGCCAGATTTGG - Intergenic
1187186143 X:16987753-16987775 AACAGACAGTGGGCCAGATTTGG + Intronic
1187207794 X:17199228-17199250 AACAGACCATGGGCCACATTTGG + Intergenic
1187510365 X:19912267-19912289 AAAAGACAACAGGCCCAAAATGG - Intergenic
1187708279 X:22028666-22028688 AACAGGCAGTGGGCCAAATTTGG + Intergenic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1188328734 X:28841733-28841755 AACAAACAAAAGGCCAAGTCTGG + Intronic
1188335586 X:28928235-28928257 AACAGAAAAGTGGCCAGATTTGG - Intronic
1189778294 X:44489740-44489762 AACAGACAGCAGGGTAGATTTGG + Intergenic
1191241013 X:58190114-58190136 TAGAGACACCAGCCCAAATTTGG + Intergenic
1192296412 X:69853930-69853952 AACACACTGCAGGCCAGATTTGG + Intronic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1192531395 X:71889949-71889971 AATTGACACCAGGCCAGATTTGG - Intergenic
1192749595 X:73975742-73975764 AACAGACAAAAGTACAGATTTGG - Intergenic
1192788483 X:74356373-74356395 AGCAGAAAACATTCCAAATTTGG + Intergenic
1192802140 X:74476263-74476285 AACAGACAGAAAGCCAAATCAGG - Intronic
1193743088 X:85242404-85242426 AACAGGCAGCAGTCCAGATTTGG - Intergenic
1194649276 X:96496508-96496530 CACAGAGAAAAGGCCATATTAGG + Intergenic
1195348207 X:103972503-103972525 AAGGGACAACAGGCGAAATCAGG + Intergenic
1195359235 X:104066338-104066360 AAGGGACAACAGGCGAAATCAGG - Intergenic
1195590158 X:106615326-106615348 AACAAGCAACAGGCAAGATTTGG + Intronic
1196108519 X:111921307-111921329 AACAGTTGACAGGCCAGATTTGG + Intronic
1196360950 X:114857371-114857393 AATAGACTACAGACCAGATTTGG + Intronic
1197300780 X:124777989-124778011 AACAGTCGATAGGCCAGATTTGG + Intronic
1198419620 X:136457396-136457418 AACAGATGGCAGGCCAGATTTGG + Intergenic
1200300109 X:154965646-154965668 AGCAGGCCACAAGCCAAATTTGG + Intronic
1201551204 Y:15218696-15218718 CACAGCCCACAGGCCAAATCTGG + Intergenic
1201751618 Y:17438131-17438153 AACAAACATCAGGGCAAATTGGG + Intergenic