ID: 948228952

View in Genome Browser
Species Human (GRCh38)
Location 2:236335713-236335735
Sequence CTGTGTTAATGGAATAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948228952_948228955 6 Left 948228952 2:236335713-236335735 CCTACCTTATTCCATTAACACAG 0: 1
1: 0
2: 0
3: 17
4: 183
Right 948228955 2:236335742-236335764 ATATAGATACCATACAAAAAAGG 0: 1
1: 0
2: 3
3: 31
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948228952 Original CRISPR CTGTGTTAATGGAATAAGGT AGG (reversed) Intronic
902426593 1:16328525-16328547 CTGTGATAATGGATTAGAGTGGG + Intronic
902720927 1:18303421-18303443 CTATGCTCATGGAATAGGGTGGG + Intronic
909475501 1:76076575-76076597 CTGTGGGAATGAAATAAGATAGG + Intronic
911247258 1:95532429-95532451 CGAGGTTAATGGAATGAGGTGGG + Intergenic
913395711 1:118369529-118369551 GTGTGTTACTGGCATAAGGATGG - Intergenic
915050394 1:153065006-153065028 CTGGCTTCATGGAATAAGGCAGG - Intergenic
916239209 1:162622514-162622536 CTCAGTTACTGGCATAAGGTTGG + Intergenic
918739182 1:188105423-188105445 CTGTATTATTTGAATCAGGTAGG - Intergenic
919795327 1:201318142-201318164 CTGTGTTCAAGAAATATGGTAGG + Intronic
921097485 1:211899800-211899822 TTGTGTTAATGAAAAAAGGTGGG + Intergenic
921119179 1:212121844-212121866 CAGTGCTGATGGAACAAGGTTGG + Intergenic
921768368 1:219001394-219001416 CTGTGGTAATGGATTACAGTTGG - Intergenic
922046665 1:221951799-221951821 CTGTGTGTAAGGAAAAAGGTTGG - Intergenic
1064232773 10:13544107-13544129 CTGGGTTAATGAAAGAAGGAGGG + Intergenic
1070740851 10:78902360-78902382 CTGTGTTGTTGGGATAAGGGTGG - Intergenic
1071586223 10:86824202-86824224 CTGTGTTTTTGCAAGAAGGTGGG + Intronic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1080812473 11:35718332-35718354 CTGTTTTAATTGTATTAGGTTGG + Intronic
1080962288 11:37174527-37174549 CTGTGAAAATGGACTAATGTAGG + Intergenic
1081266806 11:41034118-41034140 TTGGATTAATGGAATAAGGAGGG + Intronic
1081712321 11:45225228-45225250 CTGTGTTCCTGGACTAAGTTAGG - Intronic
1083553326 11:63607087-63607109 CTGTGCTGATGGAATGAGGTGGG + Intronic
1084284011 11:68120290-68120312 CTGTGTTACTAGACAAAGGTGGG - Intronic
1086147518 11:83569011-83569033 CTGTCTCAAAGGAATAATGTTGG + Intronic
1089872053 11:121683933-121683955 CTGTGTTTATGGTATAATGCAGG - Intergenic
1091123704 11:133078313-133078335 CTGTTTTAATGGAGCAATGTAGG - Intronic
1091995604 12:4990936-4990958 CTGTGTTCCTGGCATAAAGTAGG + Intergenic
1092780726 12:11984207-11984229 TTTTGTTAATGGAATGAGTTAGG + Intergenic
1092930838 12:13314318-13314340 CAGTTTTAATGGGATAGGGTGGG + Intergenic
1098701639 12:73635938-73635960 CTTTCTTATTGGAATAAGGTAGG - Intergenic
1098764398 12:74468244-74468266 CTATGTTGATGAAATAAGGCAGG - Intergenic
1102359807 12:112275402-112275424 CTGTGTTAAGGGAAAAAGCCAGG - Intronic
1102768871 12:115455966-115455988 GTCTCTTAATGGAATAAGTTAGG - Intergenic
1104493634 12:129216388-129216410 TGGTCTTAATGGATTAAGGTGGG + Intronic
1105654109 13:22416165-22416187 CTGGCTTCATGGAATGAGGTAGG - Intergenic
1106157984 13:27174923-27174945 CTGACTAAATGGATTAAGGTTGG - Intergenic
1107034352 13:35884885-35884907 TTGTTTTAATGGAATAAGAATGG - Intronic
1111002611 13:82205344-82205366 CTGTGCTCTTGGAACAAGGTTGG + Intergenic
1113240918 13:108336073-108336095 CTGTGTTGCTGGAAAAAGGGTGG - Intergenic
1115899217 14:38126244-38126266 CTGTGTTAAAGGAAATAGGAAGG - Intergenic
1122381085 14:101307708-101307730 CTGTGTTAATGAAAAAGGGTTGG + Intergenic
1123761522 15:23436916-23436938 TTGTGTTAATGGAAAGAGCTTGG + Intergenic
1123951707 15:25284880-25284902 CTGTCCAAATGGAATAAGTTGGG - Intergenic
1124217752 15:27823024-27823046 CTGTGTGTACGGAATGAGGTAGG + Intronic
1124267783 15:28252654-28252676 TTGTGTTAATGGAAAGAGCTTGG - Intronic
1125625624 15:41106801-41106823 TTGTGGTAATGGATTCAGGTTGG - Intronic
1125726059 15:41868681-41868703 CTGTGTGAGTGGACTCAGGTGGG - Intronic
1128665404 15:69533881-69533903 CTGGGTTCAGGGAATGAGGTTGG + Intergenic
1129306397 15:74667197-74667219 ATGTGGTAATGGATTAAAGTTGG + Intronic
1129341203 15:74888054-74888076 CAGGGTTAATGGATTAAGGGCGG - Intergenic
1135490785 16:22907489-22907511 CTGTTTTCATGGACTAAGGGAGG + Intronic
1138546550 16:57722926-57722948 CTGTGTGCCTGGAATAAGGGGGG + Intronic
1140843949 16:78868906-78868928 GTGTTTTAATGGAAAAAGGGGGG - Intronic
1143877794 17:10005546-10005568 CTGTGTTCATGCAGGAAGGTGGG + Intronic
1146351847 17:32101876-32101898 CTCTCTTAATGGAATAGGGTTGG + Intergenic
1149652828 17:58287642-58287664 TTGTGTGAATGGTATGAGGTGGG + Intergenic
1149869248 17:60168004-60168026 CTCTCTTAAGGGAATAGGGTTGG + Intronic
1150173754 17:63027910-63027932 CTATGAAAATGGAATGAGGTGGG - Intronic
1151645689 17:75429798-75429820 CTGTTTTTTTGGCATAAGGTCGG + Intergenic
1153121379 18:1731175-1731197 ATCTGTTAAGGGAATAGGGTTGG - Intergenic
1156307986 18:35896977-35896999 CTGTGGTGTTGGAGTAAGGTTGG - Intergenic
1157832781 18:50872435-50872457 TTGTTTTATTGGTATAAGGTAGG + Intergenic
1157932227 18:51835624-51835646 CTTTGTTAAGGGACTAAGGTAGG + Intergenic
1158144992 18:54302225-54302247 CTGTGTTATAGGAACAATGTGGG + Intronic
1158485065 18:57858939-57858961 CTGTGGTAATGTTAAAAGGTGGG + Intergenic
1160215822 18:76929663-76929685 ATGAGTTAATGAAATAAGTTTGG + Intronic
1162491238 19:10993502-10993524 TTGTAGTAATGGAATAAGTTGGG + Intronic
1162763768 19:12905128-12905150 GTGTGTGAATGGAATAACCTAGG - Intronic
1163209926 19:15832695-15832717 CTGTGTGTAAGGAAAAAGGTTGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1165137573 19:33679431-33679453 CGTTGCTAATGGAAGAAGGTGGG - Intronic
1165727503 19:38123518-38123540 CAGGGTTAATGGATTAAGGGCGG - Intronic
1168179671 19:54652610-54652632 CATTGTTAATGGAATCAGCTGGG - Intronic
1168522533 19:57063770-57063792 CAGTTTTAACTGAATAAGGTGGG - Intergenic
926606597 2:14904490-14904512 CTGTCATACTGGAAGAAGGTGGG - Intergenic
926785890 2:16518135-16518157 CTGTGTGGCTGGAATAAGATGGG - Intergenic
927286376 2:21361257-21361279 CTGTGTAACTGGTATAAGGGTGG - Intergenic
928047113 2:27946496-27946518 CTGTGTTTATAAAATAAGTTGGG + Intronic
930450879 2:51536057-51536079 ATGTGTTAATGGATTACAGTTGG - Intergenic
933024413 2:77237028-77237050 CTGGCTTCATGGAATAAGTTAGG + Intronic
933197432 2:79408141-79408163 CTATCTTAATGGAAGAAGATGGG - Intronic
933640196 2:84750609-84750631 GTGTGTTAATGAAATAAGATTGG + Intronic
935009362 2:99117821-99117843 CTGTGTGACTGGAATCAGGAAGG + Intronic
935704025 2:105840362-105840384 TTCTGTTAATGAAATAAGGAGGG + Intronic
936679039 2:114749885-114749907 CTGTGTTAAGGAAATAATTTAGG + Intronic
937831611 2:126430587-126430609 CTGAGTTAATGAATTAAGGTGGG + Intergenic
938176598 2:129138214-129138236 CTGTGTTATTTGAAGAATGTAGG - Intergenic
939792212 2:146591753-146591775 CTGTCATAATGGAATAAGATTGG - Intergenic
940276869 2:151948780-151948802 GAGTGTAAGTGGAATAAGGTGGG + Intronic
942493667 2:176516299-176516321 CTGTGATTAGGGAATGAGGTTGG + Intergenic
943223764 2:185143421-185143443 CTGTGTTAATAGTTTATGGTAGG - Intergenic
944541257 2:200755830-200755852 CTGTGATCATGGAATTAGGAAGG - Intergenic
944574700 2:201080644-201080666 CTGTGGTATTGGCATAAGGGTGG - Intronic
946090442 2:217217892-217217914 CTATGTTAATGGAAAAAGTAGGG + Intergenic
946105058 2:217361869-217361891 TTTTGTTAAGGTAATAAGGTGGG - Intronic
946439210 2:219680821-219680843 CTGTGTTAATGCAATATTATAGG + Intergenic
948228952 2:236335713-236335735 CTGTGTTAATGGAATAAGGTAGG - Intronic
1171109930 20:22471574-22471596 ATGTCATAATGGAATAGGGTAGG - Intergenic
1172663331 20:36582452-36582474 CTGTGTTAACTGAAAATGGTGGG + Intronic
1173350086 20:42236888-42236910 CTGTGTGAATAGAATGTGGTAGG + Intronic
1173355555 20:42284706-42284728 CTGTCTTAAAGAAAGAAGGTTGG + Intronic
1174091444 20:48051930-48051952 CCATGTTAATGGATTGAGGTTGG + Intergenic
1174957166 20:55111082-55111104 ATCTGTAAATGGAATAAGGTAGG + Intergenic
1177558902 21:22725745-22725767 CTGTGAGAATGGACTAAGGCAGG + Intergenic
1179993655 21:44962405-44962427 CTGTATAAATGGAATCATGTAGG + Intronic
1181450195 22:23014698-23014720 CTGTGTTGATGGATTAATGGTGG - Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
955827698 3:62965659-62965681 GTGTATTAATGAAATAAAGTAGG - Intergenic
956737752 3:72251384-72251406 CTCTGCTTATGGAATGAGGTTGG - Intergenic
957694108 3:83611498-83611520 GTGATTTAATGGTATAAGGTTGG + Intergenic
958418654 3:93906806-93906828 CTCTGGTCATGGAACAAGGTTGG + Intronic
959935000 3:112020117-112020139 CTGTGTAAAAGGAATAAAGATGG + Intergenic
959940437 3:112075475-112075497 CTGTTTTCATGGAAACAGGTAGG + Exonic
960788426 3:121399601-121399623 CTGAATTAAAGGAATAAGTTGGG + Intronic
960865276 3:122193594-122193616 CTGTGTTACTGGCACATGGTAGG - Intronic
962104782 3:132379324-132379346 CTGTGTCTATGGAGGAAGGTGGG + Intergenic
962644335 3:137420810-137420832 CAGTGTTAGTGGAATCAGATGGG - Intergenic
964301001 3:155284808-155284830 CTGTGTGTAAGGAAAAAGGTTGG + Intergenic
965671992 3:171157119-171157141 CTGTGTAAAAGTAATAAGGCAGG + Intronic
965755516 3:172022215-172022237 CTATGTAGATGGAATAACGTGGG + Intergenic
966295028 3:178409669-178409691 CTGCATTAATTGAATAAGGGAGG - Intergenic
966792381 3:183685468-183685490 CTGTCTTAATGGAATGTGGAGGG + Intergenic
967143762 3:186587897-186587919 TTCTGTTAATGGAATAAGAAAGG - Intronic
968840329 4:2999601-2999623 TTTTGTTTATGGAATGAGGTAGG - Intronic
971109274 4:23564864-23564886 CTGTGTTAATGGGCTAGAGTTGG - Intergenic
972218115 4:36920245-36920267 TTGTGGTATTGGAATAAGGTGGG - Intergenic
973300586 4:48578683-48578705 CTGTGTTAAGGGAAAAAATTGGG - Intronic
974527863 4:63067434-63067456 CTTAGTTAATGAAATAAGATGGG + Intergenic
974565713 4:63576731-63576753 CTCTGGTAAGGGAAGAAGGTGGG + Intergenic
975282371 4:72575859-72575881 CTGTGTTTATGAAATAAAATTGG - Intergenic
976446249 4:85132745-85132767 CTGGCTTAATGGAATGAGTTAGG + Intergenic
976496954 4:85740857-85740879 CTGTGTTTCTGGGATAATGTAGG - Intronic
977378074 4:96234734-96234756 ATGTGTTAATGGATTAGAGTTGG + Intergenic
977546917 4:98394383-98394405 CTGTGGTAATGGAAGAGGGTGGG + Intronic
977563210 4:98554686-98554708 CTGTGGTAATGGAATATTTTAGG - Intronic
979132166 4:117060804-117060826 CTGTGCAAACAGAATAAGGTAGG + Intergenic
980267559 4:130537860-130537882 CTGTCTTAATGGAACCAGTTGGG - Intergenic
980693947 4:136331490-136331512 CTGGCTTAATGGAATGAGTTAGG - Intergenic
981923525 4:150113248-150113270 CTGGGTTAATGGAATGAGTTAGG + Intronic
982253449 4:153430459-153430481 CTTTGTGAATGGTATAAAGTAGG - Intergenic
983806504 4:171999960-171999982 ATTTGTTTATGGAATATGGTGGG + Intronic
984110723 4:175610185-175610207 CTGAGTTAAAGGAATAGGTTGGG + Intergenic
984365254 4:178791454-178791476 CATTGTTAAGGGAATAAGGGAGG + Intergenic
987394090 5:17404623-17404645 CTGTGTTCATGGAGGAGGGTGGG + Intergenic
987494921 5:18630898-18630920 CTGTGTTAATGCAATGATCTAGG + Intergenic
989589951 5:43104123-43104145 CTGTGTTAATGGAATTTGGCAGG - Intronic
991426863 5:66500747-66500769 GTGTGTTTATGGAATACGGTGGG - Intergenic
992184683 5:74232527-74232549 CAATGTTAATGGAATGAGGCTGG - Intergenic
993130079 5:83885713-83885735 CTGTGTGAATGGAACCATGTGGG + Intergenic
1000516536 5:162241812-162241834 CAGTGATAATGGAATAATATTGG - Intergenic
1004318167 6:14609909-14609931 TTGTGTCAATGGACTAAGGCAGG + Intergenic
1009194959 6:60673089-60673111 GTGTGATAATGTCATAAGGTTGG - Intergenic
1010282840 6:74040545-74040567 CTATCTTACTGAAATAAGGTAGG - Intergenic
1010676114 6:78745539-78745561 TTGTGTTAGTGGGATAAAGTAGG + Intergenic
1011028071 6:82891275-82891297 CTGTGCTAATGGAATCTAGTGGG + Intergenic
1013142506 6:107351850-107351872 CTGTGTTAATGCTATTTGGTAGG - Intronic
1013418251 6:109943805-109943827 CTGTGTTATGGGAATAAGCTTGG - Intergenic
1014089418 6:117386574-117386596 CTGTCTTAGTGGAACAAGATAGG + Intronic
1014430391 6:121363681-121363703 ATGTGGTAATGGAATAGAGTTGG + Intergenic
1016323104 6:142869794-142869816 CTGTGTTAATAAAATGAAGTTGG - Intronic
1016573318 6:145539316-145539338 CTGTTTATATGTAATAAGGTAGG + Intronic
1016725331 6:147358696-147358718 CTGTATTCATGTAATAAAGTAGG + Intronic
1017139428 6:151177358-151177380 CTGTGATAATGGACTGGGGTTGG - Intergenic
1019052620 6:169194788-169194810 CTGTGTTACTGGAAAAAGGATGG - Intergenic
1020724764 7:11798108-11798130 CTGTCTTAATGGAACAAAGATGG - Intronic
1021622556 7:22563101-22563123 CTGTGATATTGGAATATGGAAGG + Intronic
1023269962 7:38451768-38451790 CTGTTTTAAAAGAATAATGTAGG + Intronic
1028012476 7:85664711-85664733 CTGTCTTAATGGCACAAAGTAGG - Intergenic
1031784521 7:126012786-126012808 TTGTGTTTGGGGAATAAGGTGGG + Intergenic
1033333583 7:140434608-140434630 ATTTTTAAATGGAATAAGGTAGG - Intergenic
1033550100 7:142439068-142439090 CTGTGTCCCTGGAAGAAGGTGGG + Intergenic
1038466733 8:27771810-27771832 CTGTCTTAAGGGAATTAGCTGGG + Intronic
1038708255 8:29916720-29916742 CTGTCTTCATAGAATAAGTTAGG - Intergenic
1039053878 8:33518748-33518770 ACCTCTTAATGGAATAAGGTAGG + Intergenic
1039170961 8:34744380-34744402 CTGTGTTAATCAAATTAGCTGGG + Intergenic
1039650296 8:39334183-39334205 CTGTGTTGATGAAATCAGGCCGG + Intergenic
1040529659 8:48256291-48256313 CTGAATTAAAGGAATAAGTTGGG - Intergenic
1042112618 8:65396746-65396768 CTGAGTTAATAGAAGATGGTTGG - Intergenic
1042117829 8:65451250-65451272 CTGTCTCTATGAAATAAGGTTGG + Intergenic
1043284503 8:78512994-78513016 ATGTGTTAAAGGATTAAAGTTGG + Intergenic
1044942525 8:97357776-97357798 CTGTCTTAATGTAAGAAGCTGGG + Intergenic
1048707427 8:137169483-137169505 CTGTGTTTGTGGAACGAGGTTGG + Intergenic
1051892089 9:21952843-21952865 CTGTGGTAATGGATTACAGTTGG + Intronic
1052752181 9:32503081-32503103 CTGACTCAATGGAATACGGTAGG - Intronic
1054353198 9:64037802-64037824 CTGGGTTAATAAAATAAGATAGG - Intergenic
1055443582 9:76360438-76360460 CTATGCTACTGAAATAAGGTGGG + Exonic
1056761500 9:89418799-89418821 CTGTGTTAATAGAATCATGGAGG - Exonic
1058078777 9:100678708-100678730 GTGTGTTAATGGACTAATGATGG + Intergenic
1060055481 9:120409365-120409387 CTGTATTTATATAATAAGGTTGG - Intronic
1061527408 9:131178120-131178142 CTGTGTTAATGGAGTAGGCCAGG + Intronic
1062188685 9:135234033-135234055 CTGGCTTCATAGAATAAGGTGGG - Intergenic
1062727243 9:138081974-138081996 CTTTGTATATGGTATAAGGTAGG - Intronic
1190679683 X:52814349-52814371 CTGTGTTAATAGGATATGGAAGG + Intronic
1191885663 X:65885452-65885474 AGGAGTTAATGCAATAAGGTTGG + Intergenic
1192773909 X:74222150-74222172 TTGTGTTAATGCAAGAGGGTTGG - Intergenic
1193504485 X:82324946-82324968 CTGGCTTAATGGAATAGGTTTGG + Intergenic
1193512790 X:82426289-82426311 CTGTGTTAATTCACTAAGGATGG + Intergenic
1193673039 X:84413352-84413374 GTTTGTTTATGGTATAAGGTGGG + Intronic
1194196436 X:90899486-90899508 CTGTCTTCATAGAATAAGTTTGG + Intergenic
1197076058 X:122354113-122354135 CTGGCCTTATGGAATAAGGTTGG - Intergenic
1200542280 Y:4473686-4473708 CTGTCTTCATAGAATAAGTTTGG + Intergenic