ID: 948229756

View in Genome Browser
Species Human (GRCh38)
Location 2:236341415-236341437
Sequence GTGTGTTTGTAAAAGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 1, 2: 9, 3: 24, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948229751_948229756 0 Left 948229751 2:236341392-236341414 CCAGGCGTCTGCAGGGGGCAGGG 0: 1
1: 0
2: 5
3: 65
4: 428
Right 948229756 2:236341415-236341437 GTGTGTTTGTAAAAGTGGCAGGG 0: 1
1: 1
2: 9
3: 24
4: 312
948229747_948229756 6 Left 948229747 2:236341386-236341408 CCTGGTCCAGGCGTCTGCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 217
Right 948229756 2:236341415-236341437 GTGTGTTTGTAAAAGTGGCAGGG 0: 1
1: 1
2: 9
3: 24
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948229756 Original CRISPR GTGTGTTTGTAAAAGTGGCA GGG Intronic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
902063792 1:13667158-13667180 GTGTGATTGTCAAAATGGTAGGG - Intergenic
902515620 1:16987983-16988005 GTGTGGTTGGAGAGGTGGCAAGG - Intronic
902635428 1:17731978-17732000 GTGTGTGTGTGTAAGTGACAGGG - Intergenic
902754883 1:18542408-18542430 GTGTGTGTGTAAATGTGGATGGG - Intergenic
905577232 1:39055017-39055039 GTGTGTTTATAAAATTTCCAGGG - Intergenic
905831968 1:41076745-41076767 GTGTGTTTGAGAAATTGGAAAGG + Intronic
906166425 1:43689777-43689799 CTGTGGTGGTTAAAGTGGCATGG + Intronic
906978361 1:50600506-50600528 TTGTGTGTGTATATGTGGCAAGG - Intronic
907010085 1:50954713-50954735 GTGTGTTTTTAGTAGAGGCAGGG + Intronic
908982990 1:69981100-69981122 GTGTGTGTATGCAAGTGGCAAGG - Intronic
909666358 1:78138407-78138429 GTGTATTTGCTAAAGTTGCAAGG - Exonic
909950967 1:81719969-81719991 ATTTGTTTCTAAAAATGGCAGGG - Intronic
910096722 1:83531068-83531090 CTGTGTTTGAAAAACTAGCATGG - Intergenic
910456661 1:87404717-87404739 GTGTTTTTGAGAAAGTGGCTGGG - Intergenic
910794607 1:91085172-91085194 GTGTGTTTGTATATGTGGAAGGG + Intergenic
913137964 1:115911080-115911102 GTATGATTATAAAAGTGCCATGG - Intergenic
913268654 1:117070778-117070800 TTGTGTTTGTACAAGAGGGAGGG + Intronic
915532803 1:156513144-156513166 GAGTGATTGTAAAGGTGCCATGG + Intergenic
915923246 1:159994653-159994675 GTGTGTGTGTGTATGTGGCAGGG - Intergenic
916368307 1:164059406-164059428 GTTTGTTTGTAATAGCAGCAAGG + Intergenic
917102063 1:171456125-171456147 GTTTGTATATAAAAATGGCATGG - Intergenic
918638801 1:186812997-186813019 GTGTGTGTGTGAGAGAGGCAAGG - Intergenic
918694792 1:187532027-187532049 ATGAGTTTCTTAAAGTGGCAGGG - Intergenic
921582527 1:216911895-216911917 GTGTGTTTTTAATAGAGTCAGGG - Intronic
921928813 1:220736294-220736316 TTGTGTTTTTAGAAGAGGCAGGG - Intergenic
922654633 1:227370833-227370855 ATTTATTAGTAAAAGTGGCAAGG + Intergenic
923121623 1:230997682-230997704 GTGTGGTTAAAAAAGAGGCAAGG - Intronic
923325725 1:232878560-232878582 GTGTGTTTGGAAGAAAGGCAGGG - Intergenic
923598374 1:235378926-235378948 TTGTGCTTGCAAAAGGGGCACGG + Intronic
923709817 1:236378261-236378283 TTGTGTTTGTAGAAGAGGGAGGG - Intronic
924024490 1:239818231-239818253 GTGTTTTTGTAAAAGAAGGAAGG - Intronic
924230286 1:241957091-241957113 GTGTGTGTGTAAAAGGGGCATGG + Intergenic
924442096 1:244095083-244095105 GCTTGTTTGTGAAAGTGCCACGG + Intergenic
924483102 1:244454067-244454089 GTGCGTTTGTATATGTGGAAGGG + Intergenic
924808904 1:247384045-247384067 GTGTGTTTGTATATGTGGAAGGG - Intergenic
1063198167 10:3762374-3762396 GTGTGTTTGTAACAGGAGAATGG - Intergenic
1064130375 10:12704066-12704088 GTGTGTGTGTAAATGTGCAAAGG + Intronic
1064269015 10:13848630-13848652 GTGTGTGTGTAAACGCGGCAGGG + Intronic
1064298428 10:14099996-14100018 CAGTGTTTGTATAAATGGCAGGG - Intronic
1064664124 10:17632196-17632218 TTGTGTTTGTGACAGTGACAGGG + Intergenic
1065875780 10:29996122-29996144 GTGTGTTTTTAATAGAGACAGGG - Intergenic
1067708032 10:48625681-48625703 GTGTGTGTGTACACGTTGCAGGG - Intronic
1067880125 10:50035770-50035792 CAGTGTTTGAAAAAGTGGCAGGG + Intergenic
1067882069 10:50054373-50054395 TTGTCTTTTTAATAGTGGCAGGG + Intergenic
1069028667 10:63571908-63571930 CTGTGTTTCTAAAGGTAGCATGG - Intronic
1069276113 10:66593207-66593229 GTGTGTTGGTGATGGTGGCAGGG + Intronic
1070079583 10:73172180-73172202 TTGTCTTTGAAAAAGTGGAAAGG - Intronic
1070439453 10:76429011-76429033 GTGTGTGTGTATAATTGGCAGGG - Intronic
1070776798 10:79114531-79114553 GTGTGTGTGTGAAGGTGGGAGGG + Intronic
1071357436 10:84812302-84812324 GTGTGTTTGTATATGTGGAAGGG - Intergenic
1073553487 10:104425784-104425806 GTGACTTGGTAAAAGTGACAAGG + Intronic
1074842651 10:117370946-117370968 GTGTGTGTTTAAAGGTGGCCTGG + Intronic
1075549984 10:123385212-123385234 GTGTGTTTGTCAAAGGGAAAGGG + Intergenic
1077235172 11:1478508-1478530 CTGGGTTTCTAAAAGTGCCACGG + Intronic
1078567226 11:12426686-12426708 GTATGTTTGTGAAAGGGGCCAGG + Intronic
1078752241 11:14176218-14176240 GTGTGTTTGCATATGTGGAAGGG - Intronic
1078835572 11:15026190-15026212 GTGTGTTTGTATATGTGGAGGGG - Intronic
1080233282 11:30042046-30042068 GTGTGCCTGTAACAGTGGCTGGG - Intergenic
1080472197 11:32557179-32557201 GTGTGTTTTTAATAGAGACAGGG - Intergenic
1081521938 11:43890308-43890330 CTGAGCTTGTAAAAGTGACACGG + Intronic
1081543497 11:44052987-44053009 GGGTGTTTGTAACAGTGACCTGG - Exonic
1081575921 11:44318428-44318450 GTGGGGTGGTAAAAGTGGGAAGG + Intergenic
1081605069 11:44521951-44521973 TTGTGTTTTTAATAGAGGCAGGG - Intergenic
1082601212 11:55157890-55157912 GTCTGTTTGTAAAATCTGCAAGG - Intergenic
1083503892 11:63137332-63137354 GTGTGTTTGTATATGTGAAAGGG + Intronic
1083862509 11:65429914-65429936 GGGTGGTTGTCACAGTGGCAGGG + Intergenic
1084325441 11:68397305-68397327 GGCTGTGTGTGAAAGTGGCAGGG + Intronic
1085999377 11:81962274-81962296 GTCTGTAAGTAAAAGTTGCAAGG - Intergenic
1086320144 11:85637622-85637644 TTGTCTTTGTAAAGCTGGCAAGG + Intergenic
1086853014 11:91833474-91833496 GTTTTTTTCTAAAAGTTGCATGG - Intergenic
1086902843 11:92387102-92387124 GTGTGTGTGTAACAGAGGGAAGG + Intronic
1087966672 11:104423242-104423264 CTGTGTTTGTAAAAGGAACAGGG + Intergenic
1088482236 11:110305397-110305419 GTTTGTTTGTTTAAGTGACAAGG - Intergenic
1088649880 11:111948159-111948181 GTGGCCTTGTAGAAGTGGCATGG - Intronic
1089036900 11:115403983-115404005 GTGTGTTTTTCAAAGCAGCATGG + Intronic
1090505273 11:127305033-127305055 GTGTCTTTGTAAAAGAAGCTGGG - Intergenic
1091222596 11:133937938-133937960 GTGTTTCTGTAAAGGTGGGAGGG + Exonic
1094383133 12:29865350-29865372 GTGTGTTTTTAGTAGAGGCAGGG - Intergenic
1094562623 12:31569633-31569655 GTGTGTTTTTAATAGAGACAGGG - Intronic
1094704099 12:32897551-32897573 GTGTGTTCGTAAGAGAGGAATGG - Intergenic
1095458440 12:42415342-42415364 GTATGTTTTTAATAGAGGCAAGG + Intronic
1096058762 12:48678890-48678912 TTCTGTATATAAAAGTGGCATGG - Intronic
1096357896 12:50957976-50957998 GTGTGTGTGTAGTAGAGGCAGGG + Intronic
1096409522 12:51366953-51366975 TTGTATTTTTAATAGTGGCAGGG - Intronic
1098185638 12:67893222-67893244 TGCTGTTTGGAAAAGTGGCAGGG + Intergenic
1098456841 12:70684046-70684068 CTGTGTTAGTAAAATTGCCATGG - Intronic
1099083232 12:78212627-78212649 CTGTGTTTCTCAAAATGGCAGGG - Exonic
1099728963 12:86473127-86473149 TTGTGTTTTTAGAAGAGGCAGGG + Intronic
1100295147 12:93254263-93254285 GTGTGTTTGTATATGTGGAGGGG - Intergenic
1101148644 12:101865136-101865158 GTGTGTTTGTATATGTGGAAGGG - Intergenic
1101503196 12:105323260-105323282 GTGTGAGTGTAAATGTGGGAAGG - Intronic
1102801421 12:115738004-115738026 GTATGTATGTAAATGTGACATGG + Intergenic
1103229618 12:119318298-119318320 GTGTTATTGTAAAAGTAACAGGG + Intergenic
1103242943 12:119430161-119430183 GTGTGTGTGTATGTGTGGCAGGG - Intronic
1106702103 13:32240489-32240511 GTTTGTTTTTAAAACTGGAATGG + Intronic
1107196873 13:37662705-37662727 GTCTGTTTGTCACAGTGGGAAGG + Intronic
1109523290 13:63541532-63541554 CTTGGTTTGTAAAACTGGCAAGG + Intergenic
1111191059 13:84806674-84806696 GTGTGTGTGTATGAGTGACAGGG - Intergenic
1113323272 13:109258267-109258289 GTGGGTTTGTAGAAATGTCAGGG + Intergenic
1113700966 13:112388119-112388141 GTGTGTTTGTGTATGTGGAAGGG - Intronic
1113989178 13:114345935-114345957 GTCTCTCTGTAAAAGTAGCAAGG + Intergenic
1114934349 14:27515126-27515148 GACTGTCTGTAAAAGTGGCCTGG + Intergenic
1116495789 14:45558602-45558624 TTGAGTTTGTAAAATTAGCAAGG - Intergenic
1116800236 14:49435963-49435985 GTGTGTTTGTTATAGGGGCTTGG - Intergenic
1117817380 14:59611842-59611864 CTGTGTTTGTATATGTGGAAGGG + Intronic
1118519690 14:66569336-66569358 GTGTGTGTGTTAAAGAGGAAGGG - Intronic
1118577334 14:67256256-67256278 GTATATTTGTAAAAATGGGATGG + Intronic
1118646444 14:67845659-67845681 GTGTGTGTGTATATGTGACAGGG - Intronic
1119065830 14:71525355-71525377 GTGTGTTTTTAATAGAGACAGGG + Intronic
1119138482 14:72243022-72243044 GTGTGTTTTTAATAGAGTCAGGG + Intronic
1119937283 14:78603433-78603455 CTGTGTTTTCACAAGTGGCACGG - Intronic
1120818641 14:88891119-88891141 GTGTGGTTGGGAAAGTGGAAAGG - Intergenic
1120853389 14:89190947-89190969 ATGTGTTTGTAACAGTGGTGTGG + Intronic
1121088733 14:91166791-91166813 GTGATTTTTTTAAAGTGGCAAGG - Intronic
1121696468 14:95916628-95916650 GTGTGTATCTCAAGGTGGCATGG + Intergenic
1124984641 15:34595041-34595063 GTGTGTAGGTAGAAGTGGCTGGG + Intergenic
1125374733 15:39016363-39016385 GGGTGTTTGTCAAAGTAACAGGG - Intergenic
1126035547 15:44541897-44541919 GCTAGTTTATAAAAGTGGCAGGG - Intronic
1128351622 15:66894648-66894670 GTGTGTTTGTGTATGTGGAAGGG - Intergenic
1128854272 15:70994017-70994039 TTGTATTTTTAAAAGAGGCAGGG + Intronic
1129381413 15:75169852-75169874 GTGTGTTTGTATATGTGGAGGGG + Intergenic
1130837405 15:87664255-87664277 GTGTGTTTGTATACGTGGAAGGG + Intergenic
1130998829 15:88921739-88921761 GTATGTTTGTAAATGTGGAAGGG + Intergenic
1131566113 15:93487012-93487034 CTGTGTTGGGAAAGGTGGCATGG - Intergenic
1131996952 15:98142554-98142576 TTATATTTGTAAAAGGGGCAAGG - Intergenic
1134755719 16:16665580-16665602 GTGTGTGTGTATAAGAGGCAGGG + Intergenic
1134971112 16:18531732-18531754 TTGTGATTGTAAAATTGGCCTGG - Intronic
1134990347 16:18693585-18693607 GTGTGTGTGTATAAGAGGCAGGG - Intergenic
1136136597 16:28260098-28260120 GTGTGTGTGTAAAAGAGAGAGGG + Intergenic
1136302421 16:29344867-29344889 TTTGGTTTGTAAAAGTGGAAAGG - Intergenic
1136407004 16:30053805-30053827 GTGTGTTTGGAAGAGGGGGAGGG + Intronic
1137012807 16:35340375-35340397 GTGTGTTATAAAAAGTGACAGGG + Intergenic
1137253985 16:46760268-46760290 GTGTGTTTGTAGGAGTCGAAGGG - Intronic
1137883675 16:52079121-52079143 GTGTCTTTGTAAGAGGGGGAGGG + Intergenic
1138100180 16:54246107-54246129 GTGTGTGTGTACAAGTGGGTGGG + Intronic
1138976667 16:62215855-62215877 GTGTGTGTGTATATGTGGCAGGG + Intergenic
1139835097 16:69831999-69832021 TTGTGTTTTTAATAGAGGCAGGG + Intronic
1140039293 16:71395199-71395221 GTGTGTTCCTTAAAGTGGCCTGG + Intergenic
1140878169 16:79172690-79172712 GTGTGTGTGTAAAAAGGCCATGG + Intronic
1141039185 16:80656669-80656691 GTATGTTTGGAACAGGGGCACGG - Intronic
1141422837 16:83927960-83927982 GTGTGTTTGTAATAGAGCCAGGG + Intronic
1143849079 17:9795896-9795918 GTGTTTGTGTATAGGTGGCAGGG + Intronic
1143851597 17:9816954-9816976 GTGGGTTTGCAGAAGTGCCAAGG + Intronic
1147186213 17:38714563-38714585 GTGTATTTTTAATAGAGGCAGGG - Intronic
1147305737 17:39563261-39563283 GTGTGTGTGTAAGCGAGGCAGGG + Intronic
1148769515 17:50058848-50058870 GTCTCTTTGGAAAAGTGGGATGG + Intronic
1149100243 17:52897392-52897414 GTGTGTTTGGACAAGGGGAAAGG - Intronic
1150509453 17:65734390-65734412 GTCAGTTTGTAAGAGTGGAAAGG - Intronic
1150615375 17:66766536-66766558 GTTTGTTTTTAACAGTGGCAGGG - Intronic
1151833331 17:76568654-76568676 GTGGGTGTGTAAAAGGGGGAAGG + Intronic
1153317212 18:3735979-3736001 GTGTGTGTGTGCATGTGGCATGG - Intronic
1153960351 18:10134958-10134980 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1153961648 18:10145269-10145291 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1155361623 18:25008923-25008945 GTGTGTTAGAAAAAGGGTCAAGG + Intergenic
1157200219 18:45653467-45653489 GTGTGTATGTGAAAGTGGCAGGG + Intronic
1157728658 18:49985047-49985069 GTATTTATGTAAAACTGGCACGG + Intronic
1158113799 18:53972214-53972236 TTGTGTTTGTATAAATGACAGGG - Intergenic
1158728183 18:59993892-59993914 GTGTGTTTTTAATAGAGACAGGG - Intergenic
1160193237 18:76732561-76732583 GTGTGGTTGTATATGTGGAAGGG - Intergenic
1161125922 19:2557000-2557022 GTGTGTGTGTAGAGGTGGGAGGG - Intronic
1161150846 19:2708075-2708097 TTGTATTTGTAATAGAGGCAAGG + Intergenic
1161178654 19:2864528-2864550 GTGTGTTTTTAATAGAGACAGGG - Intergenic
1161192947 19:2969454-2969476 GTGAGTTTGTGGAAGTGGCTAGG - Intergenic
1161506722 19:4648223-4648245 GTGTGTTTGTGACGATGGCAGGG + Intronic
1162634798 19:11959057-11959079 GTGTGTTTTTAGTAGTGACAGGG + Intronic
1164095087 19:22001715-22001737 GTGTGTTTTTAGAAGAGACAGGG - Intronic
1167710246 19:51106027-51106049 GAGTGTTTGTAGAGGAGGCAAGG - Intronic
1168383762 19:55945752-55945774 TTGTGTTTTTAATAGAGGCAGGG + Intergenic
1168416135 19:56169975-56169997 GTGTGTGTGTAATAGAGACAGGG - Intergenic
927769741 2:25849263-25849285 GTGTGTTTTTACCAGAGGCAGGG - Intronic
928338721 2:30422691-30422713 GTGTATTTGTCACTGTGGCAAGG - Intergenic
929240796 2:39651106-39651128 GTGTGTTTGAAGAAGGGACATGG + Intergenic
930668167 2:54120309-54120331 GAGTGTTTGTAACTGTGGCCTGG + Intronic
930769719 2:55119363-55119385 GTGAATTTCTTAAAGTGGCAGGG + Intergenic
931957784 2:67447399-67447421 GTGTGTGTGTCTAAGTGGAAGGG - Intergenic
932522174 2:72426561-72426583 GTATGTTTGAAAAAGTGACCTGG - Intronic
933558296 2:83859412-83859434 GTGTGTTTGTCTAAGAGACAAGG - Intergenic
934615842 2:95770225-95770247 GTTTGTTTGTGACAGTGACAAGG - Intergenic
934838460 2:97610422-97610444 GTTTGTTTGTGACAGTGACAAGG + Intergenic
935413224 2:102787730-102787752 TTGTGTTTCTAAAAGTTGCTTGG - Intronic
935740661 2:106144764-106144786 GTGTTTTTATAAAAGAGGCCTGG - Intronic
936363276 2:111827065-111827087 GTGGGACTGCAAAAGTGGCATGG - Intronic
937235535 2:120429795-120429817 GTTTGTTTGGAGGAGTGGCAAGG - Intergenic
939424804 2:142021326-142021348 GTGTGTGTGTCAGAGTGGAAAGG + Intronic
940400281 2:153241094-153241116 GTGTGTTTGTATATGTGGAGGGG + Intergenic
940787366 2:157996143-157996165 GTGTGTATGGTAGAGTGGCAAGG - Intronic
940853152 2:158707139-158707161 GTGTGTGTGTAAAAGCTACAAGG - Intergenic
941233029 2:162934791-162934813 GAGTGGTTAGAAAAGTGGCAAGG - Intergenic
941877940 2:170454055-170454077 GTGTGTTTGTATGCGTGGAATGG - Intronic
942555684 2:177170351-177170373 GCATGTTTGTCAAACTGGCAGGG + Intergenic
943078087 2:183222633-183222655 GTGTGTTTGAAACTGTTGCAAGG + Intergenic
943479557 2:188400777-188400799 GTATGTTTACAAAAGTGGAATGG + Intronic
943758606 2:191584845-191584867 GTGTGTTTGCATATGTGGAAGGG + Intergenic
944112300 2:196145617-196145639 ATGTGGTTGTAAGAGTGGGATGG + Intronic
945914576 2:215689675-215689697 GTTTGTTTTTTAAAGTGGCGTGG - Intergenic
945969637 2:216223085-216223107 GTGTGTTTCCAGAGGTGGCAGGG + Intergenic
948229756 2:236341415-236341437 GTGTGTTTGTAAAAGTGGCAGGG + Intronic
948614188 2:239187778-239187800 GTGTGCTTGTTAAAGTGGACAGG + Intronic
1168889670 20:1286717-1286739 GTGTGTGTGCACAAGTGACAGGG + Intronic
1169640083 20:7741805-7741827 TTGAGTTTATAAAAGTGGCTGGG - Intergenic
1169711205 20:8565701-8565723 TGGTGTAAGTAAAAGTGGCAAGG + Intronic
1169852847 20:10071449-10071471 GTATGTTTGTAAAAATGGCAAGG - Intergenic
1170742136 20:19067385-19067407 GTATGTTTTTAGAAGAGGCATGG - Intergenic
1173573398 20:44093350-44093372 GTGTTTTAGTTAAAGAGGCAGGG + Intergenic
1177045736 21:16167178-16167200 GTGTGTGTGTAAAACTGTTATGG + Intergenic
1177213617 21:18100992-18101014 GTGTGTTTGAAATAGTGATATGG + Intronic
1177528249 21:22326659-22326681 TTGTGTTTTTAATAGAGGCAGGG + Intergenic
1179579603 21:42332781-42332803 GGGTGTGTGTGAAAGTGGGATGG + Intergenic
1180057111 21:45364704-45364726 GGGTGTTTGAAAAAGGGGCAGGG + Intergenic
1182223822 22:28780025-28780047 GGGAGTTAGTAAAAATGGCATGG + Intronic
1182267117 22:29125698-29125720 GTGTCTATGTAAAATTGGAAAGG - Intronic
1182454622 22:30442190-30442212 GTGTGTTTATAATAGAGACAGGG - Intergenic
1182532832 22:30974181-30974203 GTGTGTGTGTAAATATGACATGG + Intergenic
1182602534 22:31477803-31477825 CTTGGGTTGTAAAAGTGGCAGGG + Intronic
1183799117 22:40146735-40146757 GTGTGTTTGTAGTAGAGACAGGG + Intronic
1184264640 22:43340469-43340491 GTGTGTGTGTAAAAGAGACAAGG - Intronic
950547721 3:13648488-13648510 GTGGATTTGGACAAGTGGCACGG + Intergenic
950956613 3:17060132-17060154 GTGTGTTTAGAATGGTGGCATGG + Intronic
954012186 3:47651130-47651152 GTGTGTTTTTTATAGAGGCAGGG - Intronic
954410645 3:50369396-50369418 GTGTGTTAGTGAATGTGGGAAGG - Intronic
955915747 3:63906349-63906371 GTGTGTTAGTATAAGAGGGAAGG - Intronic
957231608 3:77524569-77524591 GTTTGTTTGTAGAAGCAGCAGGG + Intronic
957726465 3:84073073-84073095 GTGTGTTTGTATATTTGGAAAGG - Intergenic
957785926 3:84883308-84883330 GTTTGTTTATACAGGTGGCAGGG - Intergenic
957902147 3:86508061-86508083 GTGTGTTTGTGAGATTGGTAGGG + Intergenic
958325455 3:92392484-92392506 GTCTGTTTGTAGAATTTGCAAGG + Intergenic
958349589 3:92788040-92788062 GTCTGTTTGTAGAATTTGCAAGG + Intergenic
959204924 3:103294736-103294758 GTGGGTATGTAAAAGTGCAAAGG - Intergenic
959814946 3:110664269-110664291 GTGTGGTTGTCAAGCTGGCATGG - Intergenic
961857086 3:129883114-129883136 GTGTGTTTTTAGTAGAGGCAGGG - Intronic
963211696 3:142699607-142699629 GTGTTTTAGTAATAGTGGTATGG + Intronic
964365477 3:155946451-155946473 GTGAGTTTGTTACAGTGGCTTGG + Intergenic
966737978 3:183205204-183205226 GTGTGTTTGTAGTAGAGACAGGG - Intronic
967744620 3:193041316-193041338 GTGTGTGTGTAAAAATGACAGGG - Intergenic
970187824 4:13481586-13481608 CAGTGTTTGTAAATGTAGCATGG - Intronic
972232085 4:37085274-37085296 GTATGTGCCTAAAAGTGGCATGG - Intergenic
972522223 4:39869932-39869954 TTGTGTTTTTAGAAGAGGCAGGG - Intronic
974473816 4:62354533-62354555 GTGTGTGTGTATTAGTGGTAAGG + Intergenic
977526981 4:98157630-98157652 GTGTGTTTGTATACGTGGAGGGG + Intergenic
978476444 4:109136640-109136662 GTGTGAATGGAAAACTGGCAAGG + Intronic
979004299 4:115270698-115270720 GTGTGTGTGTAAAAGAGAGATGG + Intergenic
979939419 4:126741423-126741445 GTGTGTTTGTATATGTGGGTGGG - Intergenic
980473458 4:133278952-133278974 GTGGGTTTGTTAAAGAGGGAGGG - Intergenic
981254493 4:142645568-142645590 CTGTTTTTCTAAAAGTGGGAAGG - Intronic
981421563 4:144556057-144556079 GTGTGTGTGTGTAGGTGGCATGG + Intergenic
983461516 4:168029948-168029970 GTGTATGTGTAAAAACGGCAGGG + Intergenic
983545950 4:168964550-168964572 GTGTGGTTGTTATAGTGGCTGGG - Intronic
984746927 4:183230132-183230154 TTGTTTTTTTAAGAGTGGCAGGG + Intronic
988164124 5:27561285-27561307 GTGTGTTGTTAAAAGTGGCCAGG + Intergenic
989904891 5:47238011-47238033 GTGTGTTTGTAAAGTCTGCAAGG + Intergenic
992312387 5:75513392-75513414 GTATTTTTGGAAAAGTGGGAGGG + Intronic
992957257 5:81922602-81922624 GTGTGTAAGCAAAAGTGGAAGGG + Intergenic
993898631 5:93570166-93570188 GGGTGTTTTAAAAAGTGCCAAGG + Intergenic
993968699 5:94389805-94389827 GTGTTTTTGTAATAGTTACAAGG + Intronic
994306356 5:98210036-98210058 GTGTGTTTTTAAAAGATGCTTGG - Intergenic
994488775 5:100414727-100414749 ATGTGTTTGTATAAGTAGCATGG + Intergenic
994582598 5:101664626-101664648 GTGTGCCTGTAACAGTGGCTGGG - Intergenic
995379734 5:111518515-111518537 TTGTGTTTTTAATAGAGGCATGG + Intergenic
995455006 5:112341737-112341759 GTGTGTTTTAAATAGTGACAGGG - Intronic
995958600 5:117811215-117811237 GTGTCCTTGTAAAGGTGCCAGGG - Intergenic
996135426 5:119836075-119836097 CTGTGCATGTAAAAGAGGCAGGG - Intergenic
999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG + Intronic
1001400275 5:171442272-171442294 GTGTGTGTGTTACAGTGACAGGG + Intronic
1001809909 5:174619680-174619702 GTGTGGGAGTAAAAGTGGCCTGG + Intergenic
1001831694 5:174794386-174794408 ATGTCTTTGTAAAAGTAGGAGGG + Intergenic
1005024306 6:21448054-21448076 GGGTGTTGGTGAAAGTGGGAAGG + Intergenic
1005328525 6:24725711-24725733 TTGTATTTTTAAAAGAGGCAGGG - Intergenic
1005528156 6:26672978-26673000 GTGTGTTTATAAAAGTGGGATGG - Intergenic
1005530916 6:26704978-26705000 GTGTGTTTATAAAAGTGGGATGG - Intergenic
1005539880 6:26796668-26796690 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1005542639 6:26828661-26828683 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1006062937 6:31439140-31439162 GTGTGTTTGTTAAAATGGGGAGG + Intergenic
1006142338 6:31937480-31937502 GTGTGTCTGGAATAGTGGAAGGG + Intronic
1006150792 6:31987214-31987236 GGGTGTTTGTTAAAGTAACAGGG + Intronic
1006157093 6:32019952-32019974 GGGTGTTTGTTAAAGTAACAGGG + Intronic
1007474768 6:42112019-42112041 GGGTGGTTGAAAAGGTGGCAGGG - Intronic
1009010697 6:57838796-57838818 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1009013456 6:57870774-57870796 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1009650790 6:66475572-66475594 GTGTGATTGCCAAAGTGGAATGG + Intergenic
1013016671 6:106166091-106166113 ATGTGTGTGTCAAAGAGGCAAGG + Intergenic
1013318741 6:108966291-108966313 CTGTGTTTTTAAAAGTTCCACGG - Intronic
1014298679 6:119652706-119652728 GTGTGTGTGTATGTGTGGCAGGG + Intergenic
1014583656 6:123170193-123170215 TTGTGTTTTAAATAGTGGCAAGG + Intergenic
1014653519 6:124070885-124070907 CTGTTTTTGTAACAGTGCCATGG - Intronic
1015577958 6:134692754-134692776 GTGTGTTTGTGTATGTGTCAGGG - Intergenic
1016087414 6:139931068-139931090 TTGTGTTTGTACACGAGGCAGGG + Intergenic
1016742333 6:147541673-147541695 GTGTGTTTGTATATGTGGAAGGG - Intronic
1017120510 6:151019581-151019603 GTGTGTTGGCAAAGGAGGCAGGG - Intronic
1018166280 6:161100266-161100288 GTGGGTTTGTGAATGTGCCACGG + Intronic
1018801724 6:167227852-167227874 GTGTGTTTGTATATGTGGAGGGG + Intergenic
1019116468 6:169767707-169767729 CTGTGTGTGTATATGTGGCATGG - Intronic
1019561149 7:1658384-1658406 GTGTGTTTTTAGTAGAGGCAGGG - Intergenic
1020490292 7:8774268-8774290 CTGTTTTTGTACAAGTGCCATGG + Intergenic
1020938224 7:14495715-14495737 GTGTCTCTTTAAAACTGGCATGG + Intronic
1021371528 7:19854558-19854580 CTCTGTTAGAAAAAGTGGCATGG - Intergenic
1021680259 7:23123383-23123405 CTGTGTTTGAAAAACTGTCAGGG + Intronic
1022086222 7:27070156-27070178 TTGTGTTTTTAGTAGTGGCAGGG - Intergenic
1022629833 7:32074856-32074878 GTGTGTCTGTGAATGTGACACGG + Intronic
1023800208 7:43827239-43827261 GTGTGTTTGTACATGTGAAAGGG + Intergenic
1024169490 7:46769195-46769217 GTGTGTTTCTATATGTGGAAGGG + Intergenic
1026435765 7:70396227-70396249 GTTTTTTTGTATATGTGGCAGGG - Intronic
1026453207 7:70547425-70547447 TTGTGTTTGTAATAGAGACAGGG + Intronic
1026644093 7:72152920-72152942 GTGTGTTTGTCCAACTGGCAAGG - Intronic
1026854555 7:73744389-73744411 ATGTGATTCTTAAAGTGGCAGGG + Intergenic
1028001061 7:85499209-85499231 GTGTGTTTGTAAGTGTGGAGAGG + Intergenic
1030364136 7:108626916-108626938 GTGTGTTTGTATATATGGAAGGG - Intergenic
1030982994 7:116208859-116208881 GTGTGTGTGTATCATTGGCAAGG - Intergenic
1031554037 7:123149477-123149499 CTGTGATGGTACAAGTGGCAGGG + Intronic
1032749770 7:134827092-134827114 TTGTGGTTGTAAAAGTTGAATGG - Intronic
1034471920 7:151259423-151259445 GTGTGTTTCTAAAGGAGGCAGGG + Intronic
1034858974 7:154580220-154580242 GTGTGTGTGTATAAGGGGGAGGG - Intronic
1036254085 8:7190371-7190393 GTGTGTATGTATAAGAGACAGGG + Intergenic
1036363406 8:8097116-8097138 GTGTGTATGTATAAGAGACAGGG - Intergenic
1036887544 8:12569936-12569958 GTGTGTATGTACAAGAGACAGGG + Intergenic
1038112131 8:24511303-24511325 GAGTGTTTTAAAAAGTGGCTGGG - Intronic
1040421427 8:47243497-47243519 GTGTCTTTTTAAAAGTTCCAGGG + Intergenic
1043416044 8:80050955-80050977 GTGGTTTTATAAAAATGGCAAGG + Intronic
1046582744 8:116113239-116113261 GCTTATTTGTAAAATTGGCAGGG + Intergenic
1049921071 9:364867-364889 GTGTGTGTGTGAAAGTGGAATGG + Intronic
1052126376 9:24780456-24780478 GTGTGTGTGTAAAAATGTTATGG + Intergenic
1054870732 9:70045072-70045094 GTGAGTTGGGAAAAGTTGCATGG + Intronic
1054880950 9:70144160-70144182 GTGTGTTTGAGAAAGAGGGAGGG - Intronic
1055468737 9:76590957-76590979 GTATGAGTGTGAAAGTGGCAAGG + Intergenic
1055472660 9:76628827-76628849 GTGTGTTTGGAGAAGTGGGTTGG - Intronic
1056704316 9:88939264-88939286 TTGTGTTTGTAAGAGTGATATGG + Intergenic
1057781452 9:98054231-98054253 GTGTGTTTGTATATGTGGAGGGG - Intergenic
1058046675 9:100364767-100364789 GGGTGTTTGTCAAAGTAACAGGG + Intergenic
1059530278 9:115029290-115029312 GTGGGTTAGGAAAAGTGACAAGG + Intronic
1059936281 9:119314330-119314352 TTGTGTTTACAAAATTGGCATGG - Intronic
1061053497 9:128209543-128209565 GTGTGTTTGTTATGGTGGGAGGG - Intronic
1061644162 9:131986353-131986375 GTTTGTTTGTTATAGAGGCAGGG + Intronic
1061830788 9:133293037-133293059 GTGTGTTTGTATATGTGGAGGGG - Intergenic
1186833376 X:13413255-13413277 GCGTGTTTGACAAAGTGGCAAGG + Intergenic
1187289947 X:17943338-17943360 GTGAATTTCTAAAAGAGGCAGGG + Intergenic
1187466645 X:19533343-19533365 GTGTGTGAATAAAAGTGGCTTGG + Intergenic
1188703707 X:33299764-33299786 CTGTAATTGTAAAAATGGCATGG - Intronic
1192195705 X:69026554-69026576 GTGTGTTTGTGTAAGTGACTGGG + Intergenic
1192293352 X:69821165-69821187 GTGTGTTCTTATAAGTGGGAGGG + Intronic
1192781861 X:74302646-74302668 TTGTATTTTTAATAGTGGCAGGG + Intergenic
1194447547 X:94007156-94007178 GTGTGTTTGCAAATGTGGAGGGG - Intergenic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic
1198322302 X:135530420-135530442 GTAGGTTTGTAAAAGCAGCAGGG + Intronic
1199535265 X:148895589-148895611 GTGTGTGTGTAAGAGAGGGAGGG + Intronic
1201347104 Y:12996878-12996900 GGGTGTTTGTTAAAGTAGTAGGG + Intergenic
1201974110 Y:19829881-19829903 GTGTGTTTGTCTAACTGGAAAGG - Intergenic
1202048235 Y:20755236-20755258 TTGTGTTTTTGAATGTGGCAGGG - Intergenic