ID: 948229828

View in Genome Browser
Species Human (GRCh38)
Location 2:236341744-236341766
Sequence TGCTGTGTGTGGTGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1362
Summary {0: 1, 1: 1, 2: 15, 3: 110, 4: 1235}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948229812_948229828 30 Left 948229812 2:236341691-236341713 CCCAATGGGCAGAAGGCGAAGCT 0: 1
1: 0
2: 0
3: 10
4: 107
Right 948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG 0: 1
1: 1
2: 15
3: 110
4: 1235
948229820_948229828 -5 Left 948229820 2:236341726-236341748 CCCATGTCTTCCAGCCTGTGCTG 0: 1
1: 0
2: 1
3: 39
4: 515
Right 948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG 0: 1
1: 1
2: 15
3: 110
4: 1235
948229818_948229828 -3 Left 948229818 2:236341724-236341746 CCCCCATGTCTTCCAGCCTGTGC 0: 1
1: 0
2: 2
3: 39
4: 391
Right 948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG 0: 1
1: 1
2: 15
3: 110
4: 1235
948229819_948229828 -4 Left 948229819 2:236341725-236341747 CCCCATGTCTTCCAGCCTGTGCT 0: 1
1: 0
2: 6
3: 32
4: 366
Right 948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG 0: 1
1: 1
2: 15
3: 110
4: 1235
948229813_948229828 29 Left 948229813 2:236341692-236341714 CCAATGGGCAGAAGGCGAAGCTG 0: 1
1: 0
2: 2
3: 15
4: 199
Right 948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG 0: 1
1: 1
2: 15
3: 110
4: 1235
948229817_948229828 -2 Left 948229817 2:236341723-236341745 CCCCCCATGTCTTCCAGCCTGTG 0: 1
1: 0
2: 4
3: 43
4: 455
Right 948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG 0: 1
1: 1
2: 15
3: 110
4: 1235
948229821_948229828 -6 Left 948229821 2:236341727-236341749 CCATGTCTTCCAGCCTGTGCTGT 0: 1
1: 0
2: 2
3: 28
4: 405
Right 948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG 0: 1
1: 1
2: 15
3: 110
4: 1235
948229816_948229828 -1 Left 948229816 2:236341722-236341744 CCCCCCCATGTCTTCCAGCCTGT 0: 1
1: 0
2: 1
3: 24
4: 328
Right 948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG 0: 1
1: 1
2: 15
3: 110
4: 1235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948229828 Original CRISPR TGCTGTGTGTGGTGGGGAGA AGG Intronic
900093211 1:929561-929583 GGCAGGGTGTGGTGGGCAGAAGG + Intronic
900210421 1:1452998-1453020 TGCTGGGCGGGGTGGGGGGACGG - Intronic
900216370 1:1483992-1484014 TGCTGGGCGGGGTGGGGGGACGG + Intronic
900403924 1:2484170-2484192 TGCTGTGTGGGGTGAGTATATGG + Intronic
900465621 1:2824036-2824058 GGCTGTGTGTCGGGGGGAAAGGG - Intergenic
900481691 1:2902559-2902581 TCCTGGGTGTGGTGTGGAGTGGG + Intergenic
900539247 1:3194589-3194611 GGTGGCGTGTGGTGGGGAGACGG - Intronic
900539253 1:3194610-3194632 GGTGGCGTGTGGTGGGGAGACGG - Intronic
900755726 1:4433296-4433318 TGCTGCGTGTGATGGGAACATGG + Intergenic
901004931 1:6166996-6167018 TGCAGAGTGAGGTGGGGAGGTGG - Intronic
901045895 1:6395674-6395696 TCCTGAGTCTGGTGGGGACATGG - Intergenic
901051976 1:6429824-6429846 TGCTGTGTGTGATTGGGCGCTGG + Intronic
901601383 1:10426260-10426282 TCCTGAGTCTGGTGGGGAGGAGG - Intergenic
901746037 1:11374355-11374377 TGGTGTGTGTGGTGTGTGGATGG + Intergenic
901783433 1:11609176-11609198 TCCTGAGTCTGGTGGGGAGGAGG + Intergenic
901784726 1:11617106-11617128 TGCTGTGAGGGTGGGGGAGAAGG - Intergenic
901902339 1:12375851-12375873 TTGTGTGTGTGGTGGGGATGGGG - Intronic
901926155 1:12567506-12567528 GGGTGTGTGTGGTGCAGAGAGGG - Intergenic
902482260 1:16718190-16718212 TGCTGTGTGTGATTGGGCGCTGG - Intergenic
902932491 1:19741213-19741235 TTCTATGTGAAGTGGGGAGATGG + Intronic
903177462 1:21589564-21589586 TCCCGGGTGTGGTGGTGAGATGG + Intergenic
903264470 1:22149266-22149288 AGCTCTCTGGGGTGGGGAGATGG - Intergenic
903417328 1:23192895-23192917 AGCTGTGGGTGGTGGGGGGCGGG - Exonic
903441730 1:23393432-23393454 TGATGTGTGAGGTGTGTAGAGGG - Intronic
903887813 1:26551181-26551203 TGCTGTGAGGGGTGGGGACAAGG + Intronic
903932660 1:26872469-26872491 TGCTGTGTGGGGAGTGGAAAAGG + Intergenic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
904286554 1:29456380-29456402 TGATGTGGGTGGTGGGAAAAGGG + Intergenic
904326359 1:29729124-29729146 TGCCGTGTGTGGTGGGCAGGAGG - Intergenic
904433168 1:30478290-30478312 TGCCATGTGTGGTGGGAAGGAGG + Intergenic
904471719 1:30740411-30740433 TGCGGGGCGTGGTGGGGAGTGGG - Intronic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
904913722 1:33954393-33954415 TTCTGTTGGTGGTGGGGGGAGGG + Intronic
904941227 1:34165902-34165924 TTGTGTGTGGGGTGGGGAGGGGG + Intergenic
905187510 1:36207247-36207269 TGCTGTTTGTGGGGAGGGGACGG - Intergenic
905199086 1:36304279-36304301 TGGTGTGTGGGGTGGGGGCAGGG + Exonic
905406278 1:37734841-37734863 TGCTGGGTGTGGTGGTGTGCTGG - Intronic
905615614 1:39395709-39395731 TTCTTTGTGGGGTGGGGAGGTGG - Intronic
905962288 1:42053442-42053464 TGAGGGATGTGGTGGGGAGAGGG - Intergenic
906120222 1:43384700-43384722 TGTGGAGGGTGGTGGGGAGAAGG + Intronic
906251296 1:44312852-44312874 TGCTGGGTGGGCTGGGGAGTAGG - Intronic
906832984 1:49053094-49053116 TGCTGTGTGTGATGGATAGTTGG + Intronic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
907451068 1:54546241-54546263 TGCTGTGTGGGGGGTGGACAGGG + Intronic
907491782 1:54813219-54813241 GGCTGTGCATGGTGTGGAGAGGG - Intronic
907495217 1:54839225-54839247 TGATGTGTGGGGTGTGTAGAGGG + Intronic
907620709 1:55975515-55975537 TGCTCTGTGTGGTTGGCAGAAGG + Intergenic
907980141 1:59472545-59472567 TCCTGAGTCTGGTGGGGACATGG + Intronic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
908185107 1:61645056-61645078 TGCTTTGTGTGCTGGGCACATGG + Intergenic
908258604 1:62321799-62321821 TTTTGTGTGGGGTGGGGAGGTGG - Intergenic
908264513 1:62365282-62365304 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
909752665 1:79182584-79182606 TTCTGTGATTTGTGGGGAGATGG - Intergenic
909824927 1:80115813-80115835 TGCTCTGTCTAGTGGGGACAGGG + Intergenic
910508405 1:87976820-87976842 AGGTGTGTGTGGTGGGGGAAGGG - Intergenic
910526484 1:88184578-88184600 TGCGGTGGGTAGTGGAGAGAAGG - Intergenic
910657127 1:89631240-89631262 GGATGTGGGTGGTGGGGAGGGGG + Intergenic
910801209 1:91148697-91148719 TGCTCCCTGTGGTTGGGAGAGGG + Intergenic
910875883 1:91877326-91877348 TTGTGTGTGTGGTGGGGGTAGGG + Intronic
911043164 1:93607881-93607903 TGCTGTGTCTGGTGGGCGGATGG - Intronic
911480757 1:98437264-98437286 TTGTGTGTGTGGTGGGGCGGGGG + Intergenic
911605932 1:99905189-99905211 AACTGTGTGTGGTGGGGGGGTGG + Intronic
912003164 1:104859859-104859881 TGGTGTGGGTGATGGGGTGATGG + Intergenic
912403907 1:109420289-109420311 AATTGTGTGTGGTGGGGAGTAGG + Intronic
912435414 1:109657687-109657709 TGCAGTGTGTGGGGGGAAGGTGG + Intronic
912447660 1:109750258-109750280 TGCTGTGTGAGCTGGGGTGTGGG + Exonic
912449228 1:109759173-109759195 GTGTGTGTGTGGTGGGGTGATGG + Intronic
912468830 1:109892721-109892743 TGCAGTGGGTGGTGGGGAGGTGG + Intergenic
912507610 1:110166884-110166906 TTCTCTGTGTGCTGGGGAGCAGG + Exonic
912680407 1:111725560-111725582 TGCTGTGTCTAGTGGGGAGAAGG + Exonic
912716513 1:111987617-111987639 TGCTGTATGAGCTGTGGAGAAGG - Intronic
912951656 1:114124477-114124499 TGATGGGAGTGGTGGGGAGCTGG + Intronic
913087828 1:115455622-115455644 TCCTGTGTGTGCTGAAGAGATGG - Intergenic
913324621 1:117615862-117615884 TGGTGTGTATGGTGGGGACGGGG + Intronic
913611368 1:120512686-120512708 TGCTGAGCCTGGTGGGGAGAAGG + Intergenic
913983423 1:143544136-143544158 TGCTGAGCCTGGTGGGGAGAAGG - Intergenic
914204166 1:145512971-145512993 TTCTGTGTGTGGCCGGGGGATGG - Intergenic
914438347 1:147680666-147680688 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
914483290 1:148086158-148086180 TTCTGTGTGTGGCCGGGGGATGG - Intergenic
914530769 1:148522485-148522507 GGCTGTGGGTGGTGGGGGGGGGG + Intergenic
914579824 1:149009553-149009575 TGCTGAGCCTGGTGGGGAGAAGG - Exonic
914640764 1:149605306-149605328 TGTTGTGGGTTGTGGGGAGGGGG - Intergenic
915013551 1:152712573-152712595 GGCTGTTTGTGCTGGGGACACGG - Intergenic
915038275 1:152946871-152946893 TGCTGGGTGTGGGGGTGTGAGGG - Intergenic
915104211 1:153522237-153522259 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
915136233 1:153733610-153733632 TGCTTTTTTTTGTGGGGAGATGG + Intronic
915172386 1:153986955-153986977 GGCTGTGTGTGTTGGGGTGGTGG - Intergenic
915234903 1:154473466-154473488 CGCTGTGTGTTGGGGGGACAGGG + Intronic
915351096 1:155226799-155226821 AGGTGTGTGAGGTGGGGAGGCGG - Intergenic
915635772 1:157185524-157185546 TGCTGTGTGTGGTGAGCAGGTGG - Intergenic
915648314 1:157289600-157289622 TGCTGTGTGTGGTGAGCACGTGG + Intergenic
916062517 1:161109903-161109925 AGCTGGGCGTGGTGGGGGGAGGG + Intronic
916116922 1:161492897-161492919 GAGTGTGTGTGGTGGGGGGATGG + Intergenic
916118200 1:161506062-161506084 TGCTGTGTTTGCTGGGGCGGCGG + Intronic
916123749 1:161551064-161551086 CTCTGTGTGTGGCGGGGGGAGGG - Intergenic
916178462 1:162062883-162062905 CGCTCTGAGTGGTGTGGAGAGGG + Intergenic
916655006 1:166867449-166867471 TGATGAGTGTGGTGAGGGGAGGG + Intronic
916715518 1:167443784-167443806 TGCTGTGTGTGGTTGGGTGGAGG + Intronic
916843115 1:168620712-168620734 TGTTGTAGGTGGTGGGGAGAGGG + Intergenic
917517384 1:175719324-175719346 TGCAGTGTGTGGATGGGGGAGGG - Intronic
917579996 1:176366804-176366826 TGCTGTGTGTGGTTAGGTGTGGG - Intergenic
917981550 1:180272517-180272539 TGAAGTGAGTGGTGGGGAAAGGG - Intronic
918071040 1:181133554-181133576 TGCTGAGTATAGTGGGAAGAAGG + Intergenic
918135902 1:181673774-181673796 TGCTGGGTGGGGTTGGGAGGAGG - Intronic
918295126 1:183149445-183149467 AGCTGTGTGGTGTGAGGAGAGGG - Intergenic
918791953 1:188841075-188841097 TCCTGAGTCTGGTGGGGACATGG - Intergenic
919002690 1:191853713-191853735 TGCTGGGTGTTCTGTGGAGAAGG + Intergenic
920030838 1:203036539-203036561 TGGTGTGTGTGGAGGGGTGGGGG + Intronic
920479349 1:206307352-206307374 TCCTGAGTCTGGTGGGGACATGG - Intronic
920719479 1:208373755-208373777 TTTTGTGTGTGGTGGAGAGGAGG + Intergenic
920775803 1:208936072-208936094 TCCTGTGTGAGGTGGGGATGGGG - Intergenic
921068291 1:211638440-211638462 TAGTTTGTGTGGTGGGGCGAGGG - Intergenic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921252623 1:213311804-213311826 AGCTGTGTGAGGTGGGGAGATGG + Intergenic
921581904 1:216905166-216905188 TTCTGTGTGTGATGGGCAGCCGG - Intronic
921660550 1:217795940-217795962 AGCTGGGCGTGGTGGTGAGAAGG - Intronic
922063821 1:222116863-222116885 TAGTGTGTGTGGTGGGGTGGGGG - Intergenic
922452094 1:225745662-225745684 TTTTGTGGGGGGTGGGGAGATGG + Intergenic
922725221 1:227919903-227919925 TGTTGTGTGTGCTGGGGACAGGG - Exonic
922770829 1:228182303-228182325 GGGTGTGTGTGGTGGGGACGGGG + Intergenic
922770843 1:228182341-228182363 CGGGGTGTGTGGTGGGGGGACGG + Intergenic
922770863 1:228182401-228182423 GGGTGTGTGTGGTGGGGACGGGG + Intergenic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
922770889 1:228182481-228182503 GGGTGTGTGTGGTGGGGACGAGG + Intergenic
923014197 1:230113219-230113241 TGCTCTGTGTGGTGCTGTGAAGG + Intronic
923156104 1:231280770-231280792 TACTGTGTTTGATGGGGAGATGG - Intergenic
923591985 1:235327818-235327840 TGCTGGTTTTGGGGGGGAGAAGG - Exonic
923929990 1:238684532-238684554 TGCTGAGTCTGGTGGGGAGGTGG - Intergenic
924057658 1:240139744-240139766 TGTAGGGTGTGGTGGGAAGATGG + Intronic
924214706 1:241809184-241809206 TCCTGTGTGTTGGGGGGAGGGGG + Intergenic
924481433 1:244439015-244439037 TGGGGTATGGGGTGGGGAGATGG - Intronic
924609626 1:245563041-245563063 TGCTGGCTGTGCTGGGGAGGTGG - Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1063039240 10:2319980-2320002 GTGTGTGTGTGGTGGGGGGAGGG - Intergenic
1063112895 10:3052264-3052286 TGTTCTGTGCGGTGTGGAGACGG - Intergenic
1063123635 10:3122338-3122360 TGCTGTGGCTGCTGGGGAGCTGG + Intronic
1063588972 10:7377970-7377992 TTGTGTGTGTGGGGGGGAGGTGG + Intronic
1064087444 10:12355925-12355947 GGATGTGTGGGGTGGGGTGATGG + Intronic
1064149738 10:12852720-12852742 TGGTGTCTGTGGTGGGGAGGGGG + Intergenic
1064627150 10:17273168-17273190 TGGTGAGGGTGGTGGGGAGGTGG - Intergenic
1065187279 10:23180586-23180608 AGTAGTGTGTGTTGGGGAGATGG - Intergenic
1065659063 10:27986597-27986619 TTCTGTGTGAGATGGGAAGATGG - Intronic
1065741987 10:28805263-28805285 TGCTTTTTGGTGTGGGGAGAGGG + Intergenic
1065810151 10:29435198-29435220 TCCTGAGTGTGGTGGGGGGGCGG - Intergenic
1066104426 10:32144464-32144486 AGCTGGGTGTGGTGGTGACAGGG + Intergenic
1066482891 10:35813960-35813982 TGCTGTGGGGAGTGGGTAGATGG + Intergenic
1066589112 10:36973501-36973523 TACTGTGTGTGGTGGAGAGAGGG + Intergenic
1067242517 10:44508584-44508606 GCCTGTGTCTGCTGGGGAGAAGG + Intergenic
1067283488 10:44890825-44890847 TTCTGGGTGTGGTGTGGAAAAGG - Intergenic
1067456415 10:46422451-46422473 TGCTCTGTGGAGTGGGGAGGGGG - Intergenic
1067630785 10:47962188-47962210 TGCTCTGTGGAGTGGGGAGGGGG + Intergenic
1067744769 10:48927362-48927384 TATTGTGGGTGGTGGGGGGAGGG + Intronic
1067760784 10:49044869-49044891 TTTTGTGTGTGGTGTAGAGAAGG + Intronic
1067945808 10:50687263-50687285 TGCTGTGTTCTGTGGGCAGATGG - Intergenic
1067979846 10:51073484-51073506 TGCTGAATTTGGCGGGGAGAGGG - Intronic
1068044695 10:51871455-51871477 TGCTGTGTGCAGTGGGCAGCAGG - Intronic
1068051862 10:51960494-51960516 TGGGGGGTGTGGTGGGGAGGGGG - Intronic
1068150870 10:53129030-53129052 TTATGTGTGTGGTGGGGGAAGGG + Intergenic
1068221133 10:54047356-54047378 TGCTGTGTGTGGTGGGGGGTGGG + Intronic
1068281648 10:54878818-54878840 TGCTGAGTGGGGTAGGGGGAGGG - Intronic
1068341133 10:55704521-55704543 TGCTGTCTGGGGTTGGGAGAGGG - Intergenic
1068863260 10:61868103-61868125 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
1068978232 10:63034049-63034071 TTCTGAGTCTGGTGGGGAGGTGG + Intergenic
1069286596 10:66722572-66722594 TTCTGTGTGTGGTGGGGTGGGGG - Intronic
1069342148 10:67423634-67423656 TGGTATGTTTGGTGGGGAGAAGG - Intronic
1069541940 10:69301329-69301351 GGCTGGGTGTGGTGGTGAGTGGG + Intronic
1069729416 10:70601206-70601228 AACTGTGGGTGGTGGGGAGGGGG + Intronic
1069996419 10:72344713-72344735 TGCTGTGGGTCGTGGCGGGAGGG + Intronic
1070359745 10:75676056-75676078 TCCCAGGTGTGGTGGGGAGAGGG + Intronic
1070613276 10:77949241-77949263 CACTGAGTGTGGTGGGGGGAGGG - Intergenic
1070839673 10:79475406-79475428 GGCTGTGAGGGGTGGGCAGAGGG + Intergenic
1070867324 10:79714136-79714158 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1070881116 10:79852260-79852282 TGCTGTGTTCTGTGGGCAGATGG - Intergenic
1071288962 10:84174383-84174405 AGGTGTGTGTGGTAGGGAGGTGG + Intronic
1071291734 10:84194042-84194064 TGATCTGTGTGGTGGGCAGCAGG - Intergenic
1071507258 10:86240309-86240331 TGATGTGTGTGCTGGAGTGATGG - Intronic
1071634239 10:87236359-87236381 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1071647689 10:87368576-87368598 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1071668441 10:87584126-87584148 TGCTGGGGGTGATGGGGGGAGGG - Intergenic
1072666093 10:97393632-97393654 GGCTTTTTGTGGAGGGGAGAAGG - Intronic
1072845418 10:98825184-98825206 ATGTGTGTGAGGTGGGGAGAGGG + Intronic
1072981359 10:100100506-100100528 AGCAGTGTGTGGTGGGGATGTGG - Intergenic
1073093820 10:100968178-100968200 GGATGTGTGTGGCGGGGAGAGGG - Intergenic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1074085997 10:110209395-110209417 TGTTGTGTTGGGTGGGGGGAAGG - Intronic
1074218803 10:111415400-111415422 TGCAGACTGTGGTGGGGAGGGGG + Intergenic
1074302229 10:112242887-112242909 TGCTGCCTGGGGTTGGGAGAGGG + Intergenic
1074776589 10:116771855-116771877 TGCTGGGGGCGGTGGGGAGGTGG + Intergenic
1075121466 10:119667770-119667792 TGCTGTGTGGAGTGTGCAGATGG + Intronic
1075307709 10:121382579-121382601 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
1075612667 10:123865993-123866015 GGCTGTGTGTGGTGTGGGGGTGG - Intronic
1075710226 10:124526835-124526857 TCCAGTGTGTGGTGGGGAGGTGG + Intronic
1076179717 10:128397710-128397732 TACTGTGTGTGCTGATGAGAAGG - Intergenic
1076916628 10:133425680-133425702 TCCTGTGTGTGATGGGGAAGGGG - Intergenic
1076936732 10:133570475-133570497 TCCTGTGTGTGATGGGGAAGGGG - Intergenic
1076997610 11:306374-306396 TTCTGTGTGTGGGGGAGACATGG + Intergenic
1077037683 11:503170-503192 GGGTGGGTGGGGTGGGGAGAGGG + Exonic
1077473579 11:2776180-2776202 GGCTGGGGGTGGTGAGGAGAAGG - Intronic
1077542515 11:3153985-3154007 TGCTGTGTGTGCGGGGCTGACGG - Intronic
1078023773 11:7674970-7674992 TGGTGTGTGTCTTGGGGAGAAGG - Intronic
1078088930 11:8251765-8251787 TGGTGTGTGTGGAGGGGTGGAGG + Intronic
1079021076 11:16909514-16909536 TGGAGAGTGTGGTGGGGAGCAGG - Intronic
1079128175 11:17733388-17733410 ATCTGTGTGTGGTGGGTAAAAGG - Intergenic
1079130032 11:17741875-17741897 TGCTGTTTGAGGTGGGGTGTCGG - Intronic
1079246161 11:18753731-18753753 TGCTATGTGTGGTGGGGGTAGGG + Intronic
1080605605 11:33862381-33862403 TGCTGGGAGTGGTGGGGTGGCGG - Intronic
1081388136 11:42497056-42497078 TGTTGTGGGTTGTGGGGAGTGGG + Intergenic
1081420987 11:42874373-42874395 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1081422157 11:42881843-42881865 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1081548217 11:44087662-44087684 CAGTGTATGTGGTGGGGAGAGGG + Intergenic
1081690546 11:45074951-45074973 GGCTGGGTGTGGGGAGGAGAAGG - Intergenic
1081869566 11:46377177-46377199 AGCAGGGTGAGGTGGGGAGAGGG - Exonic
1081890980 11:46542357-46542379 TGCTGTGTGGGGTGGGCTGGTGG + Exonic
1082148343 11:48699974-48699996 TGCGGTGGGGGGAGGGGAGAGGG - Intergenic
1082994808 11:59244764-59244786 TGCTCTGTCTGGTGGGGACAGGG - Intergenic
1083582268 11:63832592-63832614 AGCTGTGTGTGGGGTGGAGGTGG - Intergenic
1083661967 11:64255615-64255637 GGGTGTGTGGGGTGGGGACAGGG + Exonic
1083959562 11:66007108-66007130 GGCTGGGTGTGATGGGGGGATGG - Intergenic
1084316120 11:68346897-68346919 TGAGGTGTCTGGTGGGGTGATGG + Intronic
1084440852 11:69172247-69172269 GGCTGTGTGTGCTGTAGAGATGG - Intergenic
1084455427 11:69265429-69265451 AGCTGTGGGTGGTGGGGACCTGG + Intergenic
1085004063 11:73068322-73068344 TGCGGTGGGTGGTGGAGGGAGGG + Intronic
1085289469 11:75387433-75387455 TTCTCTGTCTGGTGTGGAGAAGG - Intergenic
1085520397 11:77135225-77135247 TGCCAAGGGTGGTGGGGAGAGGG - Intronic
1085898964 11:80674432-80674454 TACTGTGTGAGGTGGAGAGAGGG - Intergenic
1086043119 11:82501618-82501640 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1086098209 11:83071592-83071614 AGCTGTGAGCGGTGGGGAGGTGG - Intronic
1086253238 11:84842883-84842905 TGCTGTGTGTGTTGGGGTTTGGG - Intronic
1086347248 11:85909503-85909525 TGCTTTGGGTGGTGGAGAGGTGG + Intronic
1086737044 11:90319861-90319883 TGGTGTGTGTGTTGGGTAGGTGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087082253 11:94182838-94182860 TGCTCTGTGTTCTTGGGAGAGGG + Intergenic
1087688012 11:101287062-101287084 TGCTGTGTGTGAGGGGGTGGGGG - Intergenic
1087701511 11:101441152-101441174 TGCTGTCCCTGGTGGGGACACGG - Intergenic
1087844744 11:102960460-102960482 TGCTGTGCCTGGTGGAGAGAAGG + Intergenic
1087968940 11:104455011-104455033 TTATGTGTGTGGTGGGGTGAGGG + Intergenic
1088396398 11:109374639-109374661 TGTCGGGTGTGGTGGGGAGTTGG + Intergenic
1089125123 11:116171487-116171509 GCATGTGTGTGTTGGGGAGAGGG + Intergenic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089308002 11:117538776-117538798 GGGGGAGTGTGGTGGGGAGAAGG + Intronic
1089344179 11:117779605-117779627 TGCTGTGTGTGGTGGGAGGTTGG - Intronic
1089385950 11:118068201-118068223 GGCTGTGTGCGCTGGGGAAATGG - Intergenic
1089418484 11:118313681-118313703 TGGGGGGTGGGGTGGGGAGAGGG - Intronic
1089499408 11:118923696-118923718 TCCTGAGTGGGGTGGGGTGATGG - Intronic
1089698026 11:120227691-120227713 TCCCCTGTGTGGAGGGGAGAGGG + Intronic
1089744993 11:120610448-120610470 GGCTGTGTGTTGCTGGGAGAGGG + Intronic
1089781301 11:120874998-120875020 GGCTGTGTGTGGGCAGGAGAAGG + Intronic
1090133474 11:124170622-124170644 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1090524917 11:127522682-127522704 TGGTTTGTTTGCTGGGGAGATGG + Intergenic
1090940878 11:131387363-131387385 TTCAGTGTTTGGTGGGGCGATGG - Intronic
1091198128 11:133749122-133749144 CACTGTGTGCTGTGGGGAGAGGG + Intergenic
1091312317 11:134583407-134583429 GGCTTTGTGTGGGGGCGAGATGG + Intergenic
1092016191 12:5160986-5161008 GTATGTGTGTGGTGGGGAGTGGG - Intergenic
1092272763 12:7036830-7036852 TCGTGTGTGTCCTGGGGAGATGG + Intronic
1092324598 12:7516467-7516489 TGTTGTGGGTTGTGGGGAGTAGG + Intergenic
1092561566 12:9619604-9619626 TGCGGTGAGGTGTGGGGAGAGGG + Intergenic
1092570906 12:9720247-9720269 TACTGTGTGTGCTGGGGAGAAGG - Intronic
1092583747 12:9876071-9876093 TCCTGAGTCTGGTGGGGACAAGG - Intergenic
1092585422 12:9896266-9896288 TGAAGTGTTTGGTGGGGAGTGGG + Intergenic
1092793582 12:12089707-12089729 TGGTGTGTGTTGGGGGGACAGGG - Intronic
1093527003 12:20115130-20115152 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1093580946 12:20783680-20783702 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1093970300 12:25369837-25369859 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
1094393760 12:29982094-29982116 TGTTGTGTGGGGTGGGGGCAGGG - Intergenic
1094409927 12:30157320-30157342 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
1094666574 12:32526132-32526154 TCCTGAGTCTGGTGGGGACATGG + Intronic
1094718106 12:33033831-33033853 TCCTGAGTCTGGTGGGGACACGG - Intergenic
1094807289 12:34106293-34106315 AGCAGTGTGGGGTGGGGAGTGGG + Intergenic
1095123179 12:38442409-38442431 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1095207164 12:39451435-39451457 TGGTGTGTGTGTTGGGAAGTAGG - Intergenic
1095304226 12:40621072-40621094 TTCTGAGTCTGGTGGGGACATGG + Intergenic
1095749514 12:45695755-45695777 TGCTGAATGGGGTGGGGAGTGGG + Intergenic
1096025760 12:48359638-48359660 TGGTGTGGGGGGTGGTGAGAAGG + Intergenic
1096796844 12:54083028-54083050 TTGTGTGCGTGTTGGGGAGAGGG + Intergenic
1096813006 12:54183579-54183601 GGCTGGGTGTGCTGTGGAGAAGG - Intronic
1096934020 12:55249901-55249923 TGCTGTGAGGTGGGGGGAGAGGG - Intergenic
1097017832 12:56000045-56000067 TCCTGAGTCTGGTGGGGAGGTGG - Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097900699 12:64871057-64871079 TACTGTGTGTGCTGTGGAGAAGG + Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098075902 12:66730742-66730764 TGCCCAGTGTGCTGGGGAGAAGG + Intronic
1098205208 12:68101919-68101941 TTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1098289619 12:68945446-68945468 TGAGGTGTGAGCTGGGGAGATGG + Intronic
1098578847 12:72075152-72075174 TGCAGTGTGTGAAGGGGAAATGG + Intronic
1099559535 12:84155023-84155045 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1099729286 12:86477741-86477763 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
1099733507 12:86537216-86537238 TGTTGTGGGGTGTGGGGAGAGGG + Intronic
1100163669 12:91892278-91892300 AGCTCTGTGTGATAGGGAGAGGG + Intergenic
1100181136 12:92087813-92087835 TGCTTAGTGTGGGGAGGAGAAGG + Intronic
1100507825 12:95237372-95237394 TGCTGTTGTTTGTGGGGAGATGG + Intronic
1100591130 12:96030567-96030589 GGCTGTGTGGGGTTGGGAAATGG - Intronic
1101092827 12:101305077-101305099 TGCAGGGAGTTGTGGGGAGACGG - Intronic
1101093635 12:101313710-101313732 GGGTGTGTGTGGTGGGGAGTGGG + Intronic
1101253220 12:102955186-102955208 TGGTGTGTGTAGGGGGGAGGAGG + Intronic
1101987023 12:109455254-109455276 TCCTGTGAGTGCTGGGGAGGAGG + Intronic
1102539808 12:113610561-113610583 GGGTGTGTGGGGTGGAGAGAGGG - Intergenic
1102566026 12:113798071-113798093 TTGTGTGTGTGGTGGGGGCAGGG + Intergenic
1102810303 12:115818560-115818582 AGTTGTGTGTGGTGGTGAGGCGG + Intergenic
1102988092 12:117294764-117294786 TTATGTCTGTGGTGGGGACAAGG + Intronic
1103364428 12:120370909-120370931 TGATGGTTGGGGTGGGGAGAGGG - Intergenic
1103789069 12:123456503-123456525 TGCTGTGGGTGTTAGGAAGATGG - Intergenic
1104370166 12:128217321-128217343 GGCTGTATGTGAAGGGGAGAGGG - Intergenic
1104415962 12:128596763-128596785 TGCTGTGCGTGGTGACGGGAAGG - Intronic
1104462030 12:128963833-128963855 GGCTGTGGGTGGTGCGCAGATGG + Intronic
1104591142 12:130085510-130085532 TGCTGTCTGTGGTTGCCAGAGGG + Intergenic
1104599261 12:130141559-130141581 TTCTTTTTTTGGTGGGGAGAGGG - Intergenic
1104792286 12:131491235-131491257 TGCTGTGTGTCGGGAGGACAAGG - Intergenic
1104834336 12:131777960-131777982 TGCTGTGTTTGTTGGTGTGAGGG + Intronic
1104982963 12:132582285-132582307 AGGGGTGTGTGGTGGGGATACGG - Intronic
1105036977 12:132932198-132932220 TGCTGTGGAGGTTGGGGAGAGGG - Intronic
1105239296 13:18595979-18596001 TGCCCTCTCTGGTGGGGAGAAGG - Intergenic
1105554212 13:21430382-21430404 TACTGTTTGGGGTGGGGGGATGG + Intronic
1105726200 13:23164792-23164814 TGCTGTGAGTGGTAGGGAGCAGG - Intergenic
1105916475 13:24921824-24921846 AGGTGTGTTTGGTGGGGAGTTGG - Intronic
1106148289 13:27072208-27072230 TCTTGTGTGTTATGGGGAGAGGG + Intronic
1106295427 13:28409231-28409253 TTTTGAGTGTGGTGGGAAGAGGG - Intronic
1106421555 13:29589863-29589885 TGGTGTGACTGATGGGGAGAGGG - Intronic
1106450834 13:29880534-29880556 GGCAGTCAGTGGTGGGGAGAGGG + Intergenic
1106592441 13:31109488-31109510 TGCTGTGCATGGAAGGGAGAGGG - Intergenic
1106643344 13:31608729-31608751 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1107787541 13:43970730-43970752 AGCAGGGTGAGGTGGGGAGAGGG - Intergenic
1108016429 13:46081322-46081344 TGATAAGTTTGGTGGGGAGAGGG - Intronic
1108099094 13:46935955-46935977 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1108320979 13:49290258-49290280 TTATGTGTGTTGGGGGGAGATGG - Intronic
1108546857 13:51503550-51503572 CGCTGAGTATGGTGGGGAGGGGG - Intergenic
1108685377 13:52815158-52815180 TCCTGAGTGTGGTGGGGACTTGG - Intergenic
1110236094 13:73219633-73219655 TTGTGTGTGAGGTGGGGTGAGGG + Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1110874271 13:80490457-80490479 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111341414 13:86891133-86891155 TGGGGTCTGTGGTGGGGTGAGGG - Intergenic
1112135246 13:96570942-96570964 TTCTGTGTGTGGATGAGAGAAGG + Intronic
1112164081 13:96899086-96899108 TTCAGTGTGGGGTGGGGGGAGGG - Intergenic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1112842774 13:103600399-103600421 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1113244367 13:108377752-108377774 TGCTGTCTGGGGTTGGGGGATGG + Intergenic
1113410830 13:110087875-110087897 TACTGTTTGGGGTGGGGGGAGGG - Intergenic
1113442257 13:110338425-110338447 TGTTGTGTGTGGGGGGGGGTGGG + Intronic
1113443495 13:110347633-110347655 TGCAGTGTGTGGTGGGCCAAAGG - Intronic
1113464207 13:110502798-110502820 TGCTGAGGGTTGGGGGGAGAGGG + Intronic
1114064665 14:19051054-19051076 TGCCCTCTCTGGTGGGGAGAAGG - Intergenic
1114097596 14:19348948-19348970 TGCCCTCTCTGGTGGGGAGAAGG + Intergenic
1114203234 14:20542574-20542596 TGGTGTGTGGGGTGAGGAGGTGG + Intergenic
1114495503 14:23128807-23128829 GGATGTGTGTGGTGGGGACATGG + Intronic
1114835420 14:26197891-26197913 TGGTGTGTGTGGTGGGGGACTGG + Intergenic
1114891404 14:26928638-26928660 TGCTGTGTGTGGATGGGGGTGGG + Intergenic
1115334428 14:32230916-32230938 TTTTGTGTGTGTTGGGGATAGGG + Intergenic
1115497857 14:34024860-34024882 GGGTGTGTGTGTTGGGGAGGTGG - Intronic
1116431593 14:44852190-44852212 AGGTATGTGTGGTGGGGAAAGGG + Intergenic
1117265028 14:54077452-54077474 TGCTGGGTGTGGTGGAGGGGTGG + Intergenic
1117380644 14:55159500-55159522 GGATGTGTGTGGGGTGGAGATGG + Intronic
1117620070 14:57576672-57576694 TGCTGTGTGTGACAGGGGGAAGG + Intronic
1117823973 14:59681487-59681509 TGCAGTGTGTGGTTTGGGGATGG - Intronic
1118181041 14:63493494-63493516 GCGTGTGTGTGGTGGGGGGAGGG + Intronic
1118215281 14:63803164-63803186 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1118306790 14:64661757-64661779 CGCTGTGTGTGGAGGAGAAAGGG + Intergenic
1118311459 14:64696566-64696588 TGCTGAGTGGAGTGGGGAGTTGG - Intergenic
1118465466 14:66026581-66026603 TGTTGTGGGTTGTGGGGAGGGGG - Intergenic
1118601053 14:67471756-67471778 TGCAGGGTGTGGTGGGGTGCAGG - Exonic
1118718000 14:68573938-68573960 TGCTGTGTGTGTGGGGGTGTGGG + Intronic
1118760783 14:68879265-68879287 GGCTGCGTGTGCTGGGGGGAGGG - Intronic
1118764218 14:68899340-68899362 TGGTGTGTGTGGTGTGTAGGAGG - Intronic
1119486868 14:74994609-74994631 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1119870620 14:78013880-78013902 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1120240387 14:81943140-81943162 TTGTGTGTGTGGTGGGGGAAGGG + Intergenic
1120439018 14:84512808-84512830 TGCTGAGTCTGGTGGGGATGTGG - Intergenic
1120454978 14:84718977-84718999 GCCTATGTGTGGTGTGGAGAGGG - Intergenic
1120647050 14:87086736-87086758 TGGTGGTTGGGGTGGGGAGAAGG + Intergenic
1121492741 14:94371783-94371805 TGGTGGGAGTGGTCGGGAGAAGG + Intergenic
1121648306 14:95535841-95535863 GGCTGTCGATGGTGGGGAGAGGG + Intronic
1122347839 14:101071486-101071508 GGCTGTGTGGGGTGCGGAGGGGG - Intergenic
1122405506 14:101498455-101498477 TCCTGTGTGTGGGGTGGAGTGGG - Intergenic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122694525 14:103546294-103546316 TGCCCTGTGTGGTGTGGAGGCGG + Intergenic
1122793939 14:104196430-104196452 CGCTGTGGGGGCTGGGGAGAAGG + Intergenic
1122853646 14:104549438-104549460 TGCTGTGTGGGGTGGGGAGGTGG - Intronic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1122885433 14:104708417-104708439 TGCTCTGTCGGGTGGGGACACGG - Exonic
1123491948 15:20788107-20788129 TGCCTTCTCTGGTGGGGAGAAGG + Intergenic
1123548453 15:21357197-21357219 TGCCTTCTCTGGTGGGGAGAAGG + Intergenic
1123633736 15:22281194-22281216 TTTTGTGTGTGGGGGGGAGAGGG - Intergenic
1124069000 15:26373738-26373760 TTGTGTGTGTGGTGGGGTGGGGG + Intergenic
1124218003 15:27825480-27825502 GGCTGGGAGTGGCGGGGAGAGGG + Intronic
1124493576 15:30173306-30173328 TGGTGTGTGTGGTGTGTAGTAGG + Intergenic
1124749992 15:32365343-32365365 TGGTGTGTGTGGTGTGTAGTAGG - Intergenic
1125112305 15:36047413-36047435 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1125535079 15:40437867-40437889 GGTTGTGTGTGGTGGGGGAAGGG + Intergenic
1125756757 15:42070088-42070110 TGCAGTGCCTGGTGGGGAGAAGG + Exonic
1126045782 15:44638502-44638524 TGTTGTGTGTGTTGGGGGGGGGG - Intronic
1126105015 15:45141788-45141810 TTCTGTGTGTGAGGGAGAGATGG + Intronic
1126128174 15:45314558-45314580 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1126301906 15:47206805-47206827 GCCTGTGGATGGTGGGGAGAGGG - Intronic
1126745971 15:51826948-51826970 AGCTGGGTGTGGTGGGGTGGGGG + Intergenic
1126796901 15:52266890-52266912 TGCTGTGTGAAGTGGGCAGGTGG - Intronic
1126876181 15:53044580-53044602 TGCTGTGAGTGGTCTGGGGAGGG - Intergenic
1127092597 15:55481574-55481596 TGCTCTGTCTAGTGGAGAGAGGG - Intronic
1127282929 15:57507251-57507273 TGCAGTGTGTTGTGGTCAGAAGG + Intronic
1127377917 15:58402057-58402079 TTGTGTGTCTGGTGGGGTGAGGG + Intronic
1127609965 15:60627168-60627190 GGTTGTGGGTGGTGGGGGGAGGG + Intronic
1127748055 15:62001664-62001686 TGTTGTGGGTTGTGGGGAGGGGG - Intronic
1127765979 15:62186464-62186486 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1127898273 15:63321715-63321737 TCCTGTGTGTGTAGGGGCGAGGG + Exonic
1127987623 15:64086501-64086523 TGCTGTGGGTGTTGTGGAGGGGG - Intronic
1128160020 15:65417416-65417438 TGCTGTGTGTGGAGGGGTAGAGG - Intronic
1128932076 15:71714262-71714284 TGTTGTGTGTTGGGGGGGGAGGG + Intronic
1128935552 15:71743223-71743245 TGCTCTGTGTCTTGGGAAGATGG - Intronic
1129004151 15:72358193-72358215 TGATGTGTGGGGTTGGGAGTGGG - Intronic
1129354229 15:74978561-74978583 TGTTGTGGGTGCTGGGGATATGG + Intronic
1129948556 15:79563437-79563459 TTCTGTCTGTGGTAGGGACAGGG - Intergenic
1129997231 15:80016938-80016960 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1130563210 15:84974777-84974799 TGCTCGGTGTGTTGGGGAGTCGG + Intergenic
1130571724 15:85051968-85051990 TGCTGTGGGGTGTGGGGAGGGGG - Intronic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131253429 15:90845701-90845723 TGATGTGCCTGGTGGGGAGCGGG + Intergenic
1131274153 15:90966650-90966672 TGTCCTGTGTGGTGGGGACAAGG + Exonic
1131380320 15:91958270-91958292 TACTGTGTGTGTTGGGGTGGAGG + Intronic
1131773697 15:95770310-95770332 TGTTCTGTGTGGTGGGGAAATGG - Intergenic
1131778642 15:95829714-95829736 TGCTCTATCTGATGGGGAGAAGG - Intergenic
1131883476 15:96883828-96883850 TGTTGTGGGTCGGGGGGAGAGGG - Intergenic
1131992299 15:98104165-98104187 TCCTGAGTCTGGTGGGGAGTTGG - Intergenic
1132012830 15:98290997-98291019 TGTTGTGTGTGCTGTGGGGATGG + Intergenic
1132360072 15:101204898-101204920 TTGTGTGTGTGGCGGGGGGATGG - Intronic
1202956786 15_KI270727v1_random:84428-84450 TGCCTTCTCTGGTGGGGAGAAGG + Intergenic
1132577762 16:671817-671839 TGATGTGTGTGCCGGGGAGGGGG - Intronic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1132826815 16:1909310-1909332 TGATGTGGGTGGAGGGGAAAGGG - Intergenic
1132834454 16:1945804-1945826 TGCTGGGTGGGCTGGGGAGTGGG - Intronic
1133140043 16:3736948-3736970 AGCTGGGTGTGGTGGGGGCAAGG + Intronic
1133198126 16:4184842-4184864 CGCTGTGTGTGGCGGGGATAAGG - Intergenic
1133367446 16:5221910-5221932 TCCTGAGTGTGGTGGGGACTTGG - Intergenic
1133917029 16:10118347-10118369 TGCTGCGTGGGGTGGGGTGGGGG - Intronic
1134156141 16:11844777-11844799 TGCTGACTGCGGTGTGGAGATGG - Intronic
1134201958 16:12206688-12206710 TGCTCTGTGGGGTGAAGAGATGG - Intronic
1135750983 16:25058834-25058856 TCCTGAGTGTGGTGGGGACGTGG - Intergenic
1135869850 16:26139269-26139291 TGCTGCGTGTGGTTCAGAGATGG + Intergenic
1136393913 16:29982674-29982696 GGCTGTGGGTTGTGGGGGGAAGG + Intronic
1136497900 16:30655056-30655078 CACTGTGGGTGGTGGGGAAATGG + Exonic
1136870571 16:33803760-33803782 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1137063671 16:35814670-35814692 TGCTGGGTGGGGTCTGGAGAGGG - Intergenic
1137384385 16:48028151-48028173 TCCTGTGCGTGGTGGCCAGAGGG + Intergenic
1137525666 16:49234076-49234098 TGGGGTGTGGGGAGGGGAGAGGG + Intergenic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1138120716 16:54398971-54398993 AGCTCAGTGTGGTGGGGATAGGG + Intergenic
1138167839 16:54819445-54819467 AGGTGTGTGTAGTGGGTAGAGGG + Intergenic
1138182328 16:54949913-54949935 TGCTGAGAGTGGTGGTGAGTTGG - Intergenic
1138424281 16:56920276-56920298 TGATGTGGGAGATGGGGAGAAGG + Intergenic
1139125451 16:64072228-64072250 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1139264213 16:65623965-65623987 TGCAGAGTCTGGTGGGGAGAGGG - Intergenic
1139403889 16:66703182-66703204 TGCTGAGTGTTGTTGGGGGAAGG + Intergenic
1140002639 16:71040489-71040511 TTGTGTGTGTGGGGGGGAGGGGG - Intronic
1140289930 16:73644070-73644092 TGTTGTTTGTGGTGGGTGGATGG - Intergenic
1140803557 16:78511220-78511242 TGATGTGTGCGCTGGGGAGGGGG - Intronic
1141033736 16:80610986-80611008 TGGTGAGGATGGTGGGGAGAGGG - Intronic
1141157741 16:81609184-81609206 TGCTGGCTGTGGTGGGGAGGGGG - Intronic
1141183856 16:81773157-81773179 TGCTGGGTGTGGGGGGGCGTTGG + Intronic
1141479251 16:84295259-84295281 TGAGTTGTGTGGTGGGCAGATGG + Intronic
1141829442 16:86501571-86501593 TGCTGTGTGACATGGGGACATGG - Intergenic
1142278165 16:89133709-89133731 TTCTGACTCTGGTGGGGAGAAGG - Intronic
1142427539 16:90008692-90008714 AGGTGTGTGTGGTGGGCTGAGGG - Intronic
1203101601 16_KI270728v1_random:1312288-1312310 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1142518367 17:448020-448042 TTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1142732665 17:1871915-1871937 TGCTTTGTTTGGGAGGGAGAGGG + Intronic
1142866663 17:2795521-2795543 GGCTGTGTGGGGTGGGGGGGCGG - Intronic
1142875962 17:2852515-2852537 TGCTGGGTGGAGAGGGGAGAGGG - Intronic
1142943329 17:3402230-3402252 TGCTGGGTGAGTTGGGCAGAAGG - Intergenic
1143001539 17:3798137-3798159 TGCAGTGTGTGGGGGAGAGCTGG - Intronic
1143173989 17:4946116-4946138 GCCTGTGTGTGGTGGGGGGGCGG - Intronic
1143256662 17:5562553-5562575 TTCTGTGTGTGTTGGGGACAGGG - Intronic
1143750652 17:9024462-9024484 GGCTGTTTGAGATGGGGAGATGG - Intronic
1144116014 17:12091363-12091385 TGCTGTGTTTTGTGACGAGATGG + Intronic
1144458684 17:15439932-15439954 GCCTGTTTGTGGTGGGGAGAGGG + Intronic
1144711401 17:17403916-17403938 TGCTGTGGGTGGTGGTGGGCAGG + Intergenic
1144840205 17:18181391-18181413 TGGTGTGTGTGAGGGGGAGGGGG + Intergenic
1145014424 17:19387278-19387300 GGTTGTCTGGGGTGGGGAGAGGG - Intergenic
1145395449 17:22490587-22490609 TGCTGTATGAGGAGGGGAGGAGG + Intergenic
1145854397 17:28139242-28139264 TGTTTTTTTTGGTGGGGAGATGG - Intronic
1145936100 17:28715747-28715769 GGGTGTGGGTGCTGGGGAGAAGG + Intronic
1146002772 17:29141106-29141128 TGGCGTCTGTGGAGGGGAGAGGG - Intronic
1146056760 17:29585220-29585242 TGGTGTTTGGAGTGGGGAGAGGG - Intronic
1146541655 17:33701224-33701246 TGTTGTGTGTGGTGGGCGGAGGG + Intronic
1146722974 17:35136343-35136365 TCCTGTGAGTGATTGGGAGAAGG - Exonic
1146745110 17:35321816-35321838 TGCTCTGTCTGGTGGGGAGAGGG - Intergenic
1146840216 17:36146968-36146990 TTCTGTGTGTGGTGTGGGGTAGG + Intergenic
1146936716 17:36816645-36816667 TGGTGTGAGTGGTGGCGAGTGGG - Intergenic
1147149906 17:38508718-38508740 GGCTGTGGGTGGAGGAGAGAGGG + Intronic
1147241148 17:39091300-39091322 GGGTGTGTGTTGCGGGGAGATGG - Intronic
1147326849 17:39673761-39673783 TGGCCTGTTTGGTGGGGAGAGGG - Intronic
1147335562 17:39725277-39725299 AACTGTGTGTTGTGGGGAGGTGG - Intronic
1147343156 17:39767430-39767452 AGTGGTGAGTGGTGGGGAGAGGG + Intronic
1147390318 17:40105251-40105273 TTCTCAGTGTGGTGGGGGGAGGG + Intergenic
1147428342 17:40356816-40356838 TGCTGTGTATTGGGGGGAGCTGG + Intronic
1147485540 17:40809180-40809202 TGCTGTTTCTGGTGGGGAGGGGG - Intergenic
1147938075 17:44024980-44025002 TGCAGTGTGGGGTGGGAGGAAGG - Intergenic
1148051776 17:44773126-44773148 TAATGTGTGTGGTGGGGTGGGGG - Intronic
1148110918 17:45144357-45144379 GCCTCTGTGTGGAGGGGAGAGGG + Intergenic
1148487647 17:48001304-48001326 TGCTGTGGGAGGTCAGGAGAGGG - Intergenic
1148815792 17:50327096-50327118 TGGTTTGTGTGTTAGGGAGATGG - Intergenic
1149427630 17:56570285-56570307 GGCTGTGAGAGGAGGGGAGATGG - Intergenic
1149560834 17:57606875-57606897 GGCTGTGTGAGGTGGGGTGATGG + Intronic
1149991297 17:61384963-61384985 TGCTCAGTGTGGTGGGAAGCAGG + Intronic
1150116965 17:62560973-62560995 TGTTGTGGGTTGTGGGGAGTGGG - Intronic
1150218679 17:63483968-63483990 TCCGGTGTGTGGTGGGAAGCCGG + Intergenic
1150417780 17:65001434-65001456 AGCTGTGGGTTGTAGGGAGATGG - Intergenic
1150620116 17:66801831-66801853 TGATGTGTGTGGTGGGGCAGAGG - Intronic
1151167883 17:72220220-72220242 TGGGGTGGGAGGTGGGGAGAGGG + Intergenic
1151388490 17:73770113-73770135 GCCTGCGTGTGCTGGGGAGAGGG - Intergenic
1151557610 17:74854549-74854571 TGATGTGGGTGATGGGGAGATGG - Intronic
1151564709 17:74891608-74891630 TGATGTGTGTGCTGGTGAGAGGG + Intronic
1152037107 17:77880320-77880342 TGTCCTGTGTGGTGGGGAAAGGG + Intergenic
1152382982 17:79951851-79951873 GGCAGGGGGTGGTGGGGAGAAGG - Intronic
1152466916 17:80471703-80471725 TGCTGGATGTGGTGGGGAAGGGG - Intronic
1153393056 18:4584949-4584971 TGCTCTGTGGGATGGGGCGAGGG + Intergenic
1153686630 18:7552649-7552671 TGATGTATGTGGAGGGGAAAAGG + Intergenic
1153933591 18:9900901-9900923 TGCTGGGTGTGGAGATGAGATGG + Intergenic
1154085855 18:11305117-11305139 TGCTGTCTGGGGTTGGGGGAGGG + Intergenic
1154106814 18:11530824-11530846 TGTGGAGTGTGGTGGGGAGGAGG + Intergenic
1154449497 18:14462658-14462680 TGCCCTCTCTGGTGGGGAGAAGG + Intergenic
1155090857 18:22509481-22509503 TGCTGGGGGTGGGGGGGAGGCGG - Intergenic
1155158997 18:23180829-23180851 TTATGTCTGTGGTGGGGGGATGG + Intronic
1155164215 18:23219570-23219592 TGCTGAGTGTGGCTGGGAAATGG - Intronic
1155169786 18:23258986-23259008 TGATTTGGGTGGTGGGGGGAGGG + Exonic
1155294945 18:24376479-24376501 TCCTGAGTCTGGTGGGGAGGTGG - Intronic
1155541921 18:26877850-26877872 TACTGTGTGTGGTGGTGAAGAGG + Intergenic
1155710393 18:28870111-28870133 TGTTGTGGGTTGGGGGGAGAGGG - Intergenic
1155793278 18:30000545-30000567 TGATGTTTGTGGTGGGGATTTGG - Intergenic
1156061056 18:33076682-33076704 TGGTGTGTGTGAGGGGGAGGAGG + Intronic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156114165 18:33767123-33767145 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1156253352 18:35373392-35373414 AGATGTGTGTGGTGAGCAGAGGG + Intronic
1156469655 18:37369235-37369257 TGCAGTGTATGGTGGGGGGGTGG + Intronic
1156519396 18:37709012-37709034 TGTTGTGTGGGGTGGTGAGGAGG + Intergenic
1156575940 18:38315126-38315148 TGCTGTGTGTGCTGGGGAAAGGG + Intergenic
1156886478 18:42141284-42141306 TGCTGTGCATGGAGTGGAGAGGG - Intergenic
1156965625 18:43087826-43087848 TGCTGTTTGTGCTGGTGAGTTGG - Intronic
1157090216 18:44627962-44627984 TGCTGTGTGGGTGGGCGAGAAGG - Intergenic
1157220289 18:45824688-45824710 GGCTGTGTGTGGTGAAGAGGAGG + Intergenic
1157531026 18:48420861-48420883 GGCTGTGTGTGGGTGGGAGAGGG - Intergenic
1157701029 18:49761690-49761712 TGGGGTGTGTGGGGGGGAGTGGG - Intergenic
1157879248 18:51304503-51304525 TGCTGACTGTGGTTGGGGGAGGG - Intergenic
1157966542 18:52215231-52215253 GTGTGTGTGTGGTGGAGAGAAGG - Intergenic
1157979713 18:52366803-52366825 TCCTGAGTCTGGTGGGGAGGTGG - Intronic
1158092490 18:53730468-53730490 TGGGGACTGTGGTGGGGAGAGGG - Intergenic
1158113324 18:53966064-53966086 TCCTGTGTGTGTTGAGTAGAAGG - Intergenic
1158349623 18:56551626-56551648 AGCTCTGTGTGGTGGTGAGATGG + Intergenic
1158573309 18:58614908-58614930 GGCTGTGTGTGTTGGGGGGGAGG - Intronic
1158999668 18:62961411-62961433 TTATTTGTGTGCTGGGGAGAGGG + Intronic
1159040492 18:63319745-63319767 CGCTGTGTGTGGTGCGGCGAGGG + Exonic
1159040497 18:63319757-63319779 TGCGGCGAGGGGTGGGGAGAAGG + Exonic
1159087811 18:63813897-63813919 TTCTGGGGGTAGTGGGGAGAAGG - Intergenic
1159477960 18:68948701-68948723 TGCTGGGAGTAGTGGGGAAATGG - Intronic
1159599965 18:70419546-70419568 TGTTGTGGGAGGTGGGGAGTGGG - Intergenic
1159656020 18:71031237-71031259 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1159670073 18:71212295-71212317 TCCTGAGTCTGGTGGGGAGTTGG - Intergenic
1159793087 18:72808458-72808480 GTGTGTGTGTGGTGAGGAGATGG + Intronic
1159871456 18:73763148-73763170 TGTGGTGGGTGGTGGGGGGATGG - Intergenic
1159877523 18:73828867-73828889 TGCAGGGGGCGGTGGGGAGAGGG - Intergenic
1159925989 18:74269493-74269515 TGCTGTGTGTGGGAGGGACCTGG - Intronic
1160217086 18:76941486-76941508 TGCAGTGGGTGGGAGGGAGAGGG - Intronic
1160269655 18:77372922-77372944 TGGGGTGTGAGGTGGGGAGCGGG - Intergenic
1160269672 18:77372972-77372994 TGGGGTGTGAGGTGGGGAGCGGG - Intergenic
1160269703 18:77373072-77373094 TGGGGTGTGAGGTGGGGAGCGGG - Intergenic
1160269735 18:77373172-77373194 TGAGGTGTGAGGTGGGGAGAGGG - Intergenic
1160269795 18:77373372-77373394 TGGGGTGTGAGGTGGGGAGAGGG - Intergenic
1160269855 18:77373572-77373594 TGCGGTGTGAGGTGGAGAGCGGG - Intergenic
1160506051 18:79427420-79427442 TGCGGTGGGTGGGGGGGAGCTGG + Intronic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160531180 18:79565651-79565673 TTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1161245384 19:3249047-3249069 TGGGCTGTGTGGTGGGGAGGGGG - Intronic
1161256279 19:3311598-3311620 TGGTGTGTGGGGAGGGGCGAGGG - Intergenic
1161403598 19:4080009-4080031 TGCCCTGTGTGGGGTGGAGAAGG - Intergenic
1161853301 19:6750119-6750141 TGCTGGGTGGGGTGGGGGGTCGG + Intronic
1161921425 19:7269061-7269083 TGGTGTGTGTGTTGGGGAGGCGG - Intronic
1161956246 19:7497068-7497090 TTCTGTGTGGGGTGTGTAGAAGG + Intronic
1162089346 19:8268815-8268837 GCCTTTGTGTGTTGGGGAGAGGG + Intronic
1162115492 19:8426826-8426848 TGCGGTGGGCAGTGGGGAGAGGG + Intronic
1162302134 19:9850070-9850092 TGGGGTGGGTGGCGGGGAGATGG + Intergenic
1162915120 19:13870516-13870538 TGCTATGTGTGGGGGGGTGGGGG + Intronic
1163204369 19:15791624-15791646 AGCTGTCTGTGGTGGGGGCAGGG - Intergenic
1163362675 19:16857651-16857673 TGATGTGGGTGGTGGGCACATGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1164290204 19:23861387-23861409 TCCTCTGTGTGGTGGGTAGTGGG - Intergenic
1164878482 19:31710897-31710919 TTATGTTGGTGGTGGGGAGAAGG + Intergenic
1165074300 19:33272417-33272439 GGCTGTGTGTGATGGGGAAGGGG + Intergenic
1165235342 19:34416323-34416345 AACTGGGTGTGGTGGGGAGGTGG + Intronic
1165299242 19:34957837-34957859 TGCAGTGTGTGGTGCTGACATGG + Exonic
1165415446 19:35690996-35691018 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1165873250 19:38988133-38988155 TGTTTTTTGTGGTGGGGACAGGG + Intergenic
1166154951 19:40903985-40904007 TGGTGTCTGTGGTGGGCATAGGG - Intergenic
1166612456 19:44211047-44211069 AGCTGGGCGTGGTGGGGAGGGGG + Intronic
1166855507 19:45781016-45781038 GGCTGTGGGAGGTTGGGAGAAGG + Intronic
1167506255 19:49872682-49872704 TGCTGGGAGTGGTGGGCACAAGG - Intronic
1167618496 19:50548872-50548894 GGCTGTGGGTGGGGGAGAGAAGG + Exonic
1167637067 19:50661484-50661506 AGCTGTGTGTGCTGGGGAGAGGG + Intronic
1167647750 19:50715016-50715038 TGCATGCTGTGGTGGGGAGAGGG + Intronic
1167723996 19:51198871-51198893 TGCTGTGGGCAGTGGGGAGAGGG + Intergenic
1168195510 19:54771099-54771121 TGGGGTGTGTGGTGGGGAAGTGG + Intronic
1168289004 19:55347895-55347917 AGCTGTCTGCGGTGGGGGGAAGG + Exonic
925085281 2:1102778-1102800 TGCTGTAGGTGGAGAGGAGAAGG + Intronic
925227678 2:2199827-2199849 TACTGTGTGTAGTGGGAAGCAGG - Intronic
925336631 2:3103196-3103218 TGGTGTGTGTGGTCTGGGGAGGG - Intergenic
925396244 2:3535630-3535652 TGAGGTGTGGGGTGGGGACAGGG + Intronic
925534202 2:4899428-4899450 TGCTGTATTTGGTTGGGAGTAGG - Intergenic
925551067 2:5074985-5075007 TGGTGTGTGGGGTGGGGAGCTGG - Intergenic
925650548 2:6085234-6085256 TGATGTGTGTGTTGGGGGAATGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925818357 2:7775380-7775402 TGCTGTGTGTGGCGGGGTGGGGG + Intergenic
925861781 2:8184548-8184570 TGTTGTGTGGTGTGGGGAGTTGG + Intergenic
925926978 2:8677874-8677896 GGCTGTGTGTTGTGGGGTGGGGG - Intergenic
925969847 2:9098657-9098679 TGCTGGGTGTGGGGAGGAGAGGG - Intergenic
926000660 2:9329564-9329586 TACTCTGTGTGTTGTGGAGAAGG + Intronic
926315876 2:11709168-11709190 TGCTCTGAGTAGGGGGGAGATGG - Intronic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
926945857 2:18186623-18186645 TTCTGTGTGTAGTGGTGAGGTGG - Intronic
926953580 2:18270832-18270854 TGCTGATTTTGGTGGGGGGAAGG - Intronic
927145847 2:20165826-20165848 TGGTGTGTGTGGTGTGGGTATGG - Intergenic
927876468 2:26658700-26658722 TGATGGGTGAGGTGGGGAGGGGG - Intergenic
928019208 2:27688236-27688258 TGCTTTGTGGGGGAGGGAGAGGG - Intronic
928115347 2:28542153-28542175 TGAAGAGTGTGGTGGGGAGGAGG + Intronic
928115486 2:28542818-28542840 CACTGTTTGTGGTGTGGAGATGG - Intronic
928285163 2:29983993-29984015 TGGTGTGGGGGGTGGGGGGAGGG - Intergenic
928424327 2:31165679-31165701 TTGAGAGTGTGGTGGGGAGAGGG - Intergenic
928781740 2:34830991-34831013 TGCTGTTTGGGGTCGGGGGAGGG + Intergenic
928790640 2:34948555-34948577 TGCTGTGGGCTGCGGGGAGAGGG - Intergenic
929438832 2:41949568-41949590 TCCTGTGTGTGGAGTGGGGAGGG - Intronic
929475003 2:42237484-42237506 TTTTGTGTGTGGTGGAGATATGG + Intronic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929928567 2:46234681-46234703 TGCCCTGTGTGGTTGGGAAAAGG + Intergenic
929937343 2:46303189-46303211 TTATGTGTGTGTTGGGGAGGGGG - Intronic
930218924 2:48726022-48726044 TGCTGTCTGTGGTGGGGGAGAGG - Intronic
930357147 2:50335513-50335535 GGCAGGGGGTGGTGGGGAGAGGG - Intronic
930583919 2:53247568-53247590 TGCTGTGTGAGGTGGGGGGTTGG + Intergenic
932030768 2:68182077-68182099 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
932049000 2:68380581-68380603 GGGTGTGGGTGGTGGTGAGAGGG - Intronic
932231100 2:70085319-70085341 TGCAGTGTCTGGTGAGGATAGGG - Intergenic
932456506 2:71852859-71852881 GGGTGTGTGGGGTGGAGAGAAGG + Intergenic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932495571 2:72144312-72144334 GAGTGTGTTTGGTGGGGAGAGGG - Intronic
932538079 2:72620284-72620306 TGTTGTGGGTGGTGGGGGGCAGG + Intronic
932750723 2:74370039-74370061 TGCTCTGGGTGCTGAGGAGATGG - Exonic
932862716 2:75311382-75311404 TGTTGTGTGTGGTGGGGGGGTGG + Intergenic
933155506 2:78968885-78968907 TGCTGTGGATGGAGGGGTGAGGG - Intergenic
933536180 2:83577955-83577977 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
933775869 2:85770853-85770875 TTCTCAGTGTGTTGGGGAGAAGG - Intronic
934114037 2:88766490-88766512 GACAGTGTGGGGTGGGGAGATGG + Intergenic
934275305 2:91569057-91569079 TGCAGTGTGGGGTGGGTTGAGGG - Intergenic
934549839 2:95252231-95252253 TGCTGTGTGGTGGGGGGAGGGGG - Intronic
934601895 2:95664053-95664075 TGCTGTGTGTTGAGGGGGGTCGG - Intergenic
934635992 2:95991204-95991226 GGGGGTGTGGGGTGGGGAGATGG - Intronic
934714721 2:96536931-96536953 TGCGCTGTGTGGGGCGGAGAGGG + Intronic
934718668 2:96558052-96558074 TGCTGTGGGTGGTGGAGGGTGGG - Intergenic
934797656 2:97114230-97114252 GACGGTGTGGGGTGGGGAGATGG + Intronic
935350345 2:102147105-102147127 TGCTTTGTGTGTGGGGGTGAAGG + Intronic
935454366 2:103250059-103250081 GGCTGAGTGTGGTGGGGAATCGG + Intergenic
936057621 2:109272699-109272721 GGCTGTGTGTGGTCAGCAGAGGG + Intronic
936359448 2:111784297-111784319 AGCTGGGTGTGGTCGGGAGTTGG - Intronic
936611334 2:114004869-114004891 AGATGGGTGTGGTGGGGAGGTGG + Intergenic
936699405 2:114992587-114992609 AGCTGTGTGGGGAGTGGAGAGGG - Intronic
937048014 2:118862937-118862959 TCATGTGTGTGGAGGGGACATGG - Intergenic
937130193 2:119505315-119505337 TGTGTTGTGTGGTGGGGGGAGGG + Intronic
937765425 2:125655487-125655509 TGCAGTGAGTGGAGTGGAGATGG + Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938141869 2:128801033-128801055 TGTTGTGTGTGGTGGGGCTGGGG - Intergenic
938287384 2:130129115-130129137 TGCTGTGTTTGGTGGTGACGTGG - Intronic
938305375 2:130250690-130250712 TGTTTTATGTGCTGGGGAGAAGG - Intergenic
938428208 2:131209754-131209776 TGCTGTGTTTGGTGGTGACGTGG + Intronic
938448641 2:131396523-131396545 TGTTTTATGTGCTGGGGAGAAGG + Intergenic
938481944 2:131670086-131670108 TGCCCTCTCTGGTGGGGAGAAGG - Intergenic
938539605 2:132275370-132275392 TCATGTGTGTGGTGGAGAAAGGG + Intergenic
938653900 2:133411434-133411456 AGCTGTGTGGGATGAGGAGAAGG + Intronic
938673358 2:133605469-133605491 CGGGGTGTGTGGTGGGGGGAAGG + Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939521664 2:143239026-143239048 GGAGGTGGGTGGTGGGGAGAGGG + Intronic
939917864 2:148070092-148070114 GGCTGTTTGTGGTGGGGGAATGG - Intronic
940072846 2:149708858-149708880 TGCTTTGTGAGAAGGGGAGATGG - Intergenic
940320306 2:152369917-152369939 TGCTGTGTATTGTGGGGAATAGG + Intronic
940451334 2:153842011-153842033 TACAGTGGGTGGTGGGGAGCAGG + Intergenic
941309871 2:163914078-163914100 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
941377363 2:164748023-164748045 AGCTGTGTGTGGTGGGGAGCAGG + Intronic
941658685 2:168171857-168171879 TTTTGTGTGTGGGGGGGAGGGGG - Intronic
942299518 2:174548491-174548513 TCCTGAGTGTGGTGGGGACTTGG - Intergenic
942351621 2:175058527-175058549 AGCTGTGGGGTGTGGGGAGACGG - Intergenic
942864055 2:180650824-180650846 TTCCTTGGGTGGTGGGGAGAGGG + Intergenic
942984107 2:182119045-182119067 TGGGGTGGGTGGTGGGGGGAGGG - Intronic
943494660 2:188606294-188606316 TTCTGAGTCTGGTGGGGAGGTGG - Intergenic
943717724 2:191170658-191170680 TGCTGTGTATGGTGGAAAGTAGG + Intergenic
943864842 2:192916382-192916404 TGCTGTGGGTTGGGGGGAGGGGG + Intergenic
944729725 2:202503831-202503853 TCCTGAGTCTGGTGGGGACATGG + Intronic
945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG + Intergenic
945831677 2:214794999-214795021 TTGTGTGTGTGGTGGGGTGGGGG - Intronic
946411580 2:219517757-219517779 TGGGGTCTATGGTGGGGAGATGG + Intronic
947694859 2:232176958-232176980 TGGTGACTGTGGTGGGGAGGTGG - Intronic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948282932 2:236762326-236762348 TGCACTGTGGGGTGGGGAGCAGG + Intergenic
948347730 2:237313244-237313266 GGATGTGTCTGGTGAGGAGAGGG - Intergenic
948510897 2:238464547-238464569 TCCTGGGTGTGGCGGGGAGCGGG - Intergenic
948590447 2:239046455-239046477 TCCTGTTTGTGGTGAGGAGGGGG + Intergenic
948642604 2:239385177-239385199 TGCTGGGGATGCTGGGGAGAGGG - Intronic
948951260 2:241253352-241253374 TGTTGTGTGTGCTGGTGACAAGG - Intronic
949055819 2:241927861-241927883 TGCTGTGAGTGGGGTGGAGTGGG - Intergenic
949055871 2:241928068-241928090 TGCTGTGAGTGGGGTGGAGTGGG - Intergenic
949055936 2:241928306-241928328 TGCTGTGAGTGGGGTGGAGTGGG - Intergenic
949055969 2:241928424-241928446 TGCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056046 2:241928719-241928741 TGCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056214 2:241929334-241929356 TGCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056261 2:241929508-241929530 TGCTGTGAGTGGGGTGGAGTGGG - Intergenic
1169200633 20:3707509-3707531 TGGTTTGGGTGGTGGGGAGGGGG - Intergenic
1169267636 20:4176350-4176372 TCTTGTGTGTGCTGGGGAAAAGG - Intronic
1169321289 20:4635210-4635232 GGCTGTGTGGGGTTTGGAGAAGG - Intergenic
1169375602 20:5064429-5064451 AGCTGGGTGTGGTGGGGCGTGGG + Intergenic
1169517499 20:6333369-6333391 TGCTGTGGGGGGTGGGGGCACGG - Intergenic
1169530157 20:6476513-6476535 CTCTGTGTGTGGTGGGGGGATGG + Intergenic
1169838502 20:9907527-9907549 TGATGTCTGTGCTGGGCAGATGG - Intergenic
1170546515 20:17439441-17439463 GGCTGTGAGTGGTGAAGAGATGG - Intronic
1170635648 20:18101794-18101816 TCGTGTGTGTGTTTGGGAGATGG + Intergenic
1170881970 20:20304760-20304782 AGCTGTGGGTGGAGAGGAGAGGG + Intronic
1171066442 20:22020843-22020865 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1171221980 20:23406463-23406485 TTTTGTGTGTGTTGGGGAGGAGG - Intronic
1171377173 20:24701320-24701342 TGGTGTGTGGGTTGGGGACATGG - Intergenic
1171426028 20:25049275-25049297 CTCTGTGTGTGTTGGGGAGCTGG + Intronic
1171835536 20:30140980-30141002 TGTTGTGGGTTGTGGGGAGGGGG - Intergenic
1171868531 20:30508279-30508301 TCATGTGTGTGGTGGAGAAAGGG + Intergenic
1172061095 20:32188139-32188161 AGCTGTGGGTGCTGGGGAGGGGG - Intergenic
1172084191 20:32366568-32366590 TTCTGTGTCTGGTAGTGAGATGG + Intronic
1172215085 20:33230034-33230056 GTGTGTGTGTGGTGGGGTGAGGG - Intergenic
1172410470 20:34718150-34718172 TACTGTGGTTGGTGGGGAGAAGG + Intronic
1172637856 20:36422109-36422131 TGCTGCCTGGGGTGGGGTGAAGG - Intronic
1173186705 20:40845823-40845845 TGCTGTGGGTTGTTGGCAGAAGG + Intergenic
1173188609 20:40859774-40859796 TGCTGGTAGTGGTGGGGAGGGGG - Intergenic
1173204367 20:40981002-40981024 TCCTGTGGGGGATGGGGAGATGG + Intergenic
1173374693 20:42472880-42472902 TGCTGTGTGTGGTACCAAGAAGG - Intronic
1173455243 20:43196431-43196453 TGCTGTGTGTGGGGAGGGGTTGG - Intergenic
1174127241 20:48315607-48315629 TGGGGTGTGGGGTGGGGAGGTGG + Intergenic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1174198025 20:48786974-48786996 TGGAGTGTGTTGTGGGGAGGGGG - Intronic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1174560436 20:51427191-51427213 TGGTGGGTTTGGTGGTGAGATGG + Intronic
1174593701 20:51667055-51667077 AGCTGTGTGTTGTGGGGTTAGGG - Intronic
1175210159 20:57348858-57348880 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
1175526781 20:59639710-59639732 TGCTGAGGGAGGAGGGGAGAAGG + Intronic
1175595722 20:60231087-60231109 TGGTGTGTGTGGTTGGGGGGAGG - Intergenic
1175851520 20:62096686-62096708 TGGTGAGTGTGGTGGGGAGGGGG - Intergenic
1176210804 20:63920361-63920383 TGGTGGGTGTGGTGGGGGAAGGG + Intronic
1176256062 20:64153939-64153961 TGTTGTGTGTGGTGGATGGAAGG + Intronic
1176417186 21:6483439-6483461 TGATGTGGGTGGTGGGCAAATGG - Intergenic
1176417196 21:6483493-6483515 TGATGTGGGTGGTGGGCAAATGG - Intergenic
1177814042 21:25956715-25956737 TGGTGTGTGTGGTGGTGGGGCGG + Intronic
1178923316 21:36754504-36754526 AGCTGGGCGTGCTGGGGAGAGGG + Intronic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1179445430 21:41427021-41427043 TGCTGTGAGTGTTGGTGGGATGG - Intronic
1179692683 21:43091772-43091794 TGATGTGGGTGGTGGGCAAATGG - Intergenic
1179692693 21:43091826-43091848 TGATGTGGGTGGTGGGCAAATGG - Intergenic
1179798385 21:43798902-43798924 TGCTGGGGGCGGTGGGGAGGGGG - Intronic
1180135830 21:45861200-45861222 TGCTGTGTGCGGTGGGGAGAAGG - Intronic
1180140182 21:45888516-45888538 TGCTGTGTGCGGTGGCGTGTGGG - Intronic
1180483153 22:15773676-15773698 TGCCCTCTCTGGTGGGGAGAAGG - Intergenic
1180853593 22:19033417-19033439 TGCTGGGTGTGGGGGGGGGAAGG - Intergenic
1181181897 22:21074273-21074295 TGCCGTGTGCTGTGGGGAGCTGG - Intergenic
1181911150 22:26239294-26239316 TGAGGTGTGTGCTGGGGATAGGG - Intronic
1182165577 22:28169665-28169687 TGTTGTGGGTTGTGGGGAGCGGG + Intronic
1182666596 22:31964664-31964686 ATGTGTGTGTGGTGGGGTGAGGG + Intergenic
1182772546 22:32805622-32805644 TGCTGTGGGGGGTCGGGGGAGGG - Intronic
1182920265 22:34072806-34072828 TGCTGGATGTGGAGGAGAGATGG + Intergenic
1183110284 22:35643779-35643801 TGGTGTGTGTGTTGAGGGGATGG - Intergenic
1183189138 22:36310501-36310523 TGCAGTTTGTGTTGGGAAGAGGG - Intronic
1183311297 22:37111051-37111073 TGCTGTGTGCTGTGGGCATATGG + Intergenic
1183503018 22:38192529-38192551 TGCTGTGGGAGGGAGGGAGAGGG + Intronic
1183700525 22:39448512-39448534 TGCTGGGTGTGGAGGAGAGGAGG + Intergenic
1184150744 22:42636957-42636979 GGATGAGGGTGGTGGGGAGAGGG - Intronic
1184554284 22:45224908-45224930 TGAAGTGTTTGGTGGGGAGGGGG + Intronic
1184554979 22:45228212-45228234 TGCTGTGTGTGCTGGGGATCGGG - Intronic
1184968311 22:47997244-47997266 TCCTGGGTGTGGGGGGGAGGGGG - Intergenic
1185061504 22:48609464-48609486 TGTTGTCTGTGGTGTGGACAGGG + Intronic
949605581 3:5649640-5649662 TGCTGGGAGTTGAGGGGAGAGGG + Intergenic
949931582 3:9082821-9082843 GGCTGTGGGGGGTGAGGAGAAGG - Intronic
950152515 3:10698583-10698605 TGCTTTGGGTGGTGGGGATAGGG + Intronic
950256572 3:11511496-11511518 TCCTGAGTCTGGTGGGGACATGG - Intronic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950631189 3:14283323-14283345 TGCTGTTTCTGGTGGGCACAGGG - Intergenic
951188000 3:19736292-19736314 TGCTGAGGGTGGTGGGGACAAGG - Intergenic
951211935 3:19984598-19984620 TGTTGTTTGGGGTGGGGAGGGGG + Exonic
951340496 3:21480547-21480569 GGCTGTATGTGATGGGGACAGGG - Intronic
951483824 3:23190421-23190443 AGCTGTTTGTGATGGGGATAGGG - Intergenic
951548274 3:23851061-23851083 TTTTGTGTGTGGTGTGAAGAAGG + Intronic
951734868 3:25852170-25852192 TGCTGAGTCTGGTGGGGACTTGG + Intergenic
951799370 3:26577976-26577998 TTCTGCCTGGGGTGGGGAGAGGG - Intergenic
951893087 3:27584964-27584986 TGGTGTATATGGTGAGGAGAGGG + Intergenic
952885693 3:38009885-38009907 TGAGGTGTGTGGTGGGGATGGGG - Exonic
952912792 3:38204766-38204788 TGCTGCCTGGGGTGGGGGGAAGG + Intronic
952967865 3:38632225-38632247 CTCTGTGTGTGGTGGGGATGGGG + Intronic
953089917 3:39713776-39713798 TCCTGAGTCTGGTGGGGACATGG + Intergenic
953607024 3:44418935-44418957 TTGTGTGTGTGGTAGGGAAAGGG - Intergenic
953908838 3:46882055-46882077 GGATGTGAGTGCTGGGGAGACGG - Intronic
953927854 3:46991449-46991471 TGCTGAGTGTGGTGCGGGGCTGG + Exonic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954204835 3:49050880-49050902 GCCTGTGGGTGGTGGGGAGGAGG - Intronic
954436373 3:50498503-50498525 TGCTCTGTGTGGAGGGGTGGAGG - Intronic
954465555 3:50652454-50652476 TGCTGTGTGTGGGATGGAGTGGG + Intergenic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954804828 3:53211850-53211872 GCCTGTGTGGGGTGAGGAGAGGG + Intergenic
955035919 3:55267667-55267689 TGCAGTGTGTGATGAAGAGAGGG - Intergenic
955210373 3:56934926-56934948 TCCTGAGTCTGGTGGGGAGGTGG + Intronic
955266373 3:57449245-57449267 TTCTGAGTCTGGTGGGGACATGG - Intronic
955404894 3:58619861-58619883 ATGTGTGTGTGGTGGGGAGGTGG + Intronic
955449566 3:59051318-59051340 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
956038992 3:65126046-65126068 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
956126770 3:66018202-66018224 TCCTGTGTGTGTTGGGGTGAGGG - Intronic
956167720 3:66408952-66408974 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
956369200 3:68539710-68539732 GCATGTGTGTGGTGGGGGGAGGG + Intronic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956665010 3:71633650-71633672 TGATGTGTGTGGTGGAGTGGAGG + Intergenic
956749995 3:72337688-72337710 TGGTGTGTGTGTGGGGGGGAGGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957017975 3:75092122-75092144 TGGGGTGTGGGGTGGGGGGAGGG - Intergenic
957222447 3:77401682-77401704 TGGTGTGTGTGTTGTGGGGAGGG - Intronic
957371574 3:79300677-79300699 TCCTGAGTCTGGTGGGGAGGTGG + Intronic
957383711 3:79467969-79467991 GGCTGTTTGTGCTGGTGAGATGG - Intronic
957598388 3:82299624-82299646 TGTTGTGTGGTGGGGGGAGAGGG - Intergenic
959024837 3:101229317-101229339 TGGTGTGTGTGTGGGGGAGCAGG - Intronic
959474286 3:106790529-106790551 TGCAGTCTGGGGTTGGGAGAGGG - Intergenic
960013760 3:112862060-112862082 GTCTGTGTGTGGTGGGGGAATGG - Intergenic
960149711 3:114238189-114238211 TTCTGAGTCTGGTGGGGACATGG - Intergenic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
961219347 3:125187502-125187524 TGCTGTGGGAGGAGGGGAGGTGG - Intronic
961638870 3:128352338-128352360 TGCTGTGTGTACTGGGGGCAAGG - Intronic
961657059 3:128448794-128448816 GGCTATGTGTGGTAGAGAGAAGG - Intergenic
961869932 3:129979993-129980015 CCGTGTGTGTGTTGGGGAGAAGG - Intergenic
962155547 3:132945254-132945276 AGCTGTGTGTGTTGGGGGGGTGG + Intergenic
962752109 3:138441106-138441128 TGCTGGCTGTGGTAGGGAGTTGG + Intronic
963632022 3:147745339-147745361 TGCTGTGTGGTGTGTGGAGATGG + Intergenic
964280256 3:155056319-155056341 TGCGGTGTGGGGAGGGGGGAGGG - Intronic
964444090 3:156741038-156741060 TCCTGAGTCTGGTGGGGACATGG + Intergenic
964584465 3:158281444-158281466 TGCTGTGTGTGAGGGTGAGATGG + Intronic
965092007 3:164176822-164176844 TGTTTTATGTGGTGGGGAGGGGG - Intergenic
965245153 3:166258367-166258389 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
965516784 3:169630108-169630130 TGCTGTGTGTTGAGGAGAGAAGG - Intronic
965567968 3:170140952-170140974 GGGTGTGCCTGGTGGGGAGAAGG + Intronic
966096696 3:176213315-176213337 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
966351361 3:179035505-179035527 GAGTGTGTGTGGTGTGGAGAGGG - Intronic
966454025 3:180094428-180094450 TGCTGTCTGGGGTTGGAAGAGGG + Intergenic
966629524 3:182057069-182057091 GGGTGTGTGGGGTGGGGGGAAGG - Intergenic
967057909 3:185846159-185846181 AGCAGTGTGTGGTGGGGGGAGGG + Intergenic
967195914 3:187025547-187025569 TGGGGTGTGTAGTGGGGAGTGGG + Intronic
967250890 3:187536863-187536885 TGGTGCGGGTGGTGGGGGGATGG + Intergenic
967332620 3:188306669-188306691 TGCAGTGCGTGGTGGGGAATGGG + Intronic
967415273 3:189210121-189210143 GTCTGTGTGTGTTGGGGGGAGGG + Intronic
967718446 3:192789493-192789515 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
967841957 3:194012734-194012756 TGCTCTGTGTGGTGGTAAGCTGG - Intergenic
967998452 3:195184680-195184702 GGCTGTGTGTGGGGTGGGGAAGG - Intronic
968051886 3:195660159-195660181 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
968234780 3:197025061-197025083 GGGTGTGTGTGGTGGGGCCAGGG + Intronic
968422302 4:496144-496166 TTTTGTGTGTGGGGGGTAGACGG + Intronic
968447387 4:658550-658572 CTCTCTGTGTGGTGGGGACACGG + Intronic
968509244 4:988087-988109 TGCTGGCTGTGCTGGGGTGAGGG + Exonic
968826170 4:2899237-2899259 TGCTGTGTGTGTTTTGGAAAAGG + Exonic
968896908 4:3409656-3409678 TGCTGCCGGTGGAGGGGAGATGG - Intronic
969103022 4:4784304-4784326 GTGTGTGTGTGGTGGGGATAAGG - Intergenic
969616943 4:8258840-8258862 TGCTGTGGTGGGTGGGGAGGTGG - Intergenic
969671943 4:8594480-8594502 TGCTGTGTGACCTGGGCAGATGG + Intronic
969929135 4:10613244-10613266 TGCTGGGTGGGGTGGGCAGGTGG + Intronic
970032619 4:11693992-11694014 TTTTGAGTGTGGTGTGGAGAAGG + Intergenic
970345844 4:15151190-15151212 TGTTCTGTGAGGTTGGGAGAGGG + Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971169066 4:24214671-24214693 TGCTGTCTGTGGTGTGTCGAAGG + Intergenic
971337021 4:25732736-25732758 GTGTGTGTGTGGTGGGGAGTCGG + Intergenic
971630469 4:28986929-28986951 GGCTGTGTGTGTTGGGGGGCAGG - Intergenic
972020030 4:34300665-34300687 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
972440711 4:39088565-39088587 TGCTGGGGGTGGCAGGGAGATGG + Intronic
972583112 4:40412612-40412634 GGTTGGGTGTTGTGGGGAGAGGG + Intergenic
972627905 4:40819028-40819050 TGCTGTATGGGGTGGGGGGGCGG + Intronic
973037190 4:45420612-45420634 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973742602 4:53933032-53933054 TGCTGATGGTGATGGGGAGAGGG - Intronic
973844224 4:54894310-54894332 TGATGTGTGTTCTGTGGAGAAGG + Intergenic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
974051595 4:56946983-56947005 TTCTGTCTCTGGTGGGTAGATGG + Intergenic
974484697 4:62491796-62491818 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
974568412 4:63609918-63609940 TGTTGTGTGCGGTGGGGGGAGGG - Intergenic
974657908 4:64848886-64848908 GGTGGTGTGTGGTGGGGAGGCGG + Intergenic
974792679 4:66712317-66712339 TCCTGAGTCTGGTGGGGACATGG - Intergenic
974827847 4:67152341-67152363 TCCTGAGTGTGGTGGGGATGTGG + Intergenic
975108071 4:70591822-70591844 CTCTGTGTGTGCTGGGGGGAAGG + Intergenic
975155557 4:71068403-71068425 TGATCTGGGTGGTGGTGAGATGG - Intergenic
975218858 4:71790912-71790934 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
975651849 4:76601250-76601272 AACTGTGTGTGGTGTGGGGAGGG + Intronic
975672444 4:76795086-76795108 TTTTGTGTGTGGTGTGAAGAGGG - Intergenic
975752679 4:77539846-77539868 TGGTGTGTGTGGTGGGGGTAGGG + Intronic
976038577 4:80855552-80855574 TGTTGTGGGTTGGGGGGAGAGGG - Intronic
976400143 4:84597748-84597770 TTCTATCTGTGCTGGGGAGAAGG - Intronic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976833945 4:89348656-89348678 TGTTGTGGGTTGTGGGGAGGGGG - Intergenic
977470611 4:97437981-97438003 TTCTGAGTCTGGTGGGGACATGG - Intronic
977734675 4:100399342-100399364 TGGTGTGTGTGGTGGGGTGTGGG + Intronic
977859648 4:101941199-101941221 TTCTGTGTGTGGTGGGGCGGGGG + Intronic
977973507 4:103238219-103238241 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
978067683 4:104425629-104425651 TTGTGTGTGTGGTGGGGGGGAGG + Intergenic
978241797 4:106525243-106525265 TCCTGAGTCTGGTGGGGACATGG - Intergenic
979171620 4:117607687-117607709 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
979650504 4:123124483-123124505 TGTTGTGGGGTGTGGGGAGAGGG + Intronic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
979822636 4:125192363-125192385 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
980329182 4:131388703-131388725 AGATGTGTGTGGTGGGGTGAAGG - Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980686318 4:136234439-136234461 TGTGGTGTGGGGTGGGGAGAAGG + Intergenic
981003678 4:139853427-139853449 TGCTGAGTTTGGTTGGGGGAGGG + Intronic
981546870 4:145902765-145902787 TGCTGGGCGTGGTGGGAAGGCGG + Exonic
982122422 4:152156053-152156075 TGCTGTTTGCGGGAGGGAGAGGG - Intergenic
982614367 4:157622353-157622375 TGTTGTGGGCGGAGGGGAGAGGG - Intergenic
982705116 4:158700545-158700567 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
982724020 4:158886444-158886466 TGCTGTTAGTGGTCTGGAGAGGG + Intronic
982868713 4:160550007-160550029 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
982871284 4:160582015-160582037 TGCTGTGGGTTGGGGGGAGGGGG - Intergenic
983026184 4:162740002-162740024 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
983370540 4:166852142-166852164 TGTTGTGGGTTGTGGGGAGGGGG + Intronic
983406977 4:167343664-167343686 TGTTGTGGGTTGTGGGGAGTGGG - Intergenic
983494907 4:168431552-168431574 TGCGGTGGGGGGTGGGGGGAGGG + Intronic
983518214 4:168678963-168678985 TGATGTGTGTGGTGTGGGTACGG + Intronic
983625511 4:169798004-169798026 TGTTGTTGGTGGAGGGGAGAGGG + Intergenic
983782825 4:171693888-171693910 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
983827649 4:172284388-172284410 TGGTGTGTGTGGGGGGTGGATGG - Intronic
983923541 4:173371665-173371687 TGGTGTGTGTGTTGGGGTGGCGG - Intronic
983936102 4:173503542-173503564 TGGTGAGTGTTGAGGGGAGATGG + Intergenic
984199379 4:176698580-176698602 TACTGTGTGTGTGGGGGAGTTGG + Intronic
984639064 4:182143653-182143675 TGCTGCGGGTGGCGGGGAGGCGG - Intergenic
984770652 4:183433606-183433628 TCCTGAGTCTGGTGGGGACATGG + Intergenic
984879578 4:184398825-184398847 TGCTCCGTGGGGTGGTGAGATGG + Intronic
984929578 4:184834958-184834980 TGGTGTGTGTGTTGGGGTGGGGG - Intergenic
984945885 4:184968549-184968571 TGCTGTTTTTGGTGGGGAGACGG - Intergenic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985416330 4:189739234-189739256 TGCTGTGTGTGTCTGGGTGAGGG - Intergenic
985511291 5:315638-315660 TGCTGTGGGGGGTGGGGACTGGG + Intronic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
986728136 5:10614999-10615021 GGAGGAGTGTGGTGGGGAGAAGG + Intronic
987243895 5:16028968-16028990 TGCTCTGGGTGATTGGGAGAGGG - Intergenic
987355930 5:17062651-17062673 TCCTGAGTGTGGTGGGGACTTGG + Intergenic
987373472 5:17214147-17214169 TGATGTGGGAGGTGGGGAGAGGG + Intronic
987532692 5:19142669-19142691 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988132248 5:27120361-27120383 TCCTGAGTCTGGTGGGGACATGG + Intronic
988696132 5:33624281-33624303 TGCGGTGTGTGCCTGGGAGATGG - Exonic
988883366 5:35529579-35529601 GGCTATGTGGGGTAGGGAGAGGG - Intergenic
988922254 5:35954235-35954257 TGCTGGGTGTGGTGGCCAGGTGG - Exonic
989026187 5:37071149-37071171 TGCTGGGTTAAGTGGGGAGATGG + Intergenic
989690605 5:44138621-44138643 TGTTGTGTGTTGGGGGGAGGGGG + Intergenic
989690904 5:44142948-44142970 TGCTGTCTGGGGTTGGGGGAGGG + Intergenic
989956937 5:50369899-50369921 TCCTGAGTCTGGTGGGGACATGG + Intergenic
989958011 5:50377292-50377314 TCCTGAGTCTGGTGGGGACATGG + Intergenic
989965907 5:50465475-50465497 TCCTGAGTCTGGTGGGGACATGG + Intergenic
990490153 5:56295786-56295808 TCCTGAGTCTGGTGGGGACATGG + Intergenic
991168156 5:63587771-63587793 TGGGGTGTGGGGTGGGGGGAGGG + Intergenic
991498098 5:67247810-67247832 TGGTGTGTGTGGTGGGGGAGTGG + Intergenic
991567474 5:68020301-68020323 TCCTGAGTCTGGTGGGGACATGG - Intergenic
992272672 5:75081661-75081683 TGGGGTGGGTGGTGGGGAGGAGG + Intronic
992648052 5:78830620-78830642 TGCTGTGTGAAGTGGGGTGGAGG + Intronic
992947536 5:81824175-81824197 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
993052197 5:82938296-82938318 TGTTGTGGGTTGGGGGGAGAGGG + Intergenic
993320846 5:86466580-86466602 TCCTGAGTCTGGTGGGGACATGG - Intergenic
993328482 5:86569421-86569443 TCCTGAGTCTGGTGGGGACACGG - Intergenic
993340453 5:86719101-86719123 TGTTGTGGGTTGTGGGGAGCGGG - Intergenic
993400972 5:87450782-87450804 GGCTGAGTGTGGTGGGGAAGTGG - Intergenic
993544963 5:89200332-89200354 TGCTGCCTGTGGTTGGGAGGGGG + Intergenic
993913181 5:93709030-93709052 TTGTGTGTGTGGTGGGGTGGGGG - Intronic
994084002 5:95738948-95738970 TGCTGTGTGTGTGTGGGAGGAGG - Intronic
994106922 5:95959747-95959769 GACTTTGTGTGGTGGGGTGAGGG - Intronic
994149746 5:96433589-96433611 TCATGTGTGTGGCGGGGAGGGGG + Intronic
994507207 5:100657224-100657246 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
994520777 5:100831850-100831872 TGGTTTGTGTTATGGGGAGAGGG + Intronic
994538853 5:101068835-101068857 TTCTTTGTGGGGTGGGGGGAGGG - Intergenic
994701614 5:103141933-103141955 TCCTGAGTCTGGTGGGGAGGTGG - Intronic
994841482 5:104929463-104929485 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
994954966 5:106517081-106517103 TGCTGTTTATGGTGGAGTGAGGG - Intergenic
995019664 5:107352532-107352554 TGCTGCCTGCGGTTGGGAGAGGG + Intergenic
996107131 5:119517566-119517588 TCCTGAGTCTGGTGGGGACATGG + Intronic
996676927 5:126186885-126186907 TGCTGTGTGGTGTTGGGAGGTGG - Intergenic
997372469 5:133370700-133370722 TGCTGTGGGAAGTGGGGAGAAGG + Intronic
997600578 5:135135761-135135783 TGCTGTCAGTGGAGGGAAGATGG - Intronic
997890876 5:137675688-137675710 TGCTGTGTCTGGCGGGGAGTAGG - Intronic
998141770 5:139703901-139703923 TGCTGTGTGTAGATGGTAGATGG + Intergenic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998383471 5:141742332-141742354 GGCTGGGTGGGGTGGGGGGAAGG + Intergenic
998383718 5:141743878-141743900 TCATGTGTGTGGTGGAGAGAGGG + Intergenic
998618803 5:143771825-143771847 GGCTGAGTGAGCTGGGGAGAAGG - Intergenic
998659954 5:144225190-144225212 TGGGGTGTGTGGATGGGAGAAGG + Intronic
998684224 5:144505713-144505735 GCATGTGTGTGGTGGGGGGAAGG + Intergenic
998819682 5:146047443-146047465 AGATGGGTGGGGTGGGGAGAGGG + Intronic
998830430 5:146152230-146152252 AGGTGTGTGTGGTGGGGGAAGGG - Intronic
999122078 5:149217439-149217461 TGCTCTGAGATGTGGGGAGAAGG - Intronic
999295187 5:150455032-150455054 TGCTCTGTGGGGTGGGGTGAGGG + Intergenic
999589134 5:153124546-153124568 TGCGGGGAGAGGTGGGGAGAAGG + Intergenic
1000119912 5:158187573-158187595 TGTTGTGTGTGGGGGGAGGAGGG + Intergenic
1000204484 5:159045860-159045882 TCCTTTTTGTGGTGGGAAGATGG - Intronic
1000329099 5:160193795-160193817 TCCTGAGTCTGGTGGGGAGGTGG - Intronic
1000391758 5:160729784-160729806 TGTAGAGTGAGGTGGGGAGATGG + Intronic
1000779644 5:165464992-165465014 TGCTGTGGGAGATGGGGATAAGG - Intergenic
1001126430 5:169023757-169023779 GGCTGTGTGTGGGTGGGAGTGGG + Intronic
1001254372 5:170172151-170172173 GTCTGTCTGTGGTGGGGAGGGGG - Intergenic
1001268158 5:170290219-170290241 TGCTGTGGGTGTTGAGAAGAGGG + Intronic
1001313674 5:170628234-170628256 GGCTGTGTGTGCCTGGGAGAAGG - Intronic
1001566961 5:172706082-172706104 TGGTGGCTGTGGTGGGGAGAAGG + Intergenic
1001640574 5:173240942-173240964 TGCTATTTGGGGTGGGGGGAGGG + Intergenic
1001819414 5:174698401-174698423 TGCTGGGCTTGGTGAGGAGAAGG - Intergenic
1001841057 5:174877153-174877175 GGCTGTGTGACCTGGGGAGAAGG - Intergenic
1001951646 5:175820654-175820676 GGCTGTGTGTGGTAGGGGGCGGG - Intronic
1001956398 5:175850896-175850918 GGCTGTGTGTGGTGCAGAGTGGG + Intronic
1001970218 5:175949440-175949462 TGAGGTGGGTGGTGGGGGGAGGG - Intronic
1002051440 5:176573878-176573900 GGCTGTGTGGGGAGGGGAGGAGG + Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002094517 5:176823166-176823188 TGCTGCATGTGGGGGGGCGAGGG + Intronic
1002135865 5:177107206-177107228 TGCTGTGTGACGTGGGCAGCAGG - Intergenic
1002210435 5:177595717-177595739 TGCTGTTGGGGGTGGGGGGAGGG + Exonic
1002247220 5:177894324-177894346 TGAGGTGGGTGGTGGGGGGAGGG + Intergenic
1002624798 5:180518495-180518517 TTGTGTGTGTGGGGGGGAGGAGG + Intronic
1002686983 5:181020526-181020548 TGCTGTGTGGAGTTGGGGGAGGG - Intergenic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1003081994 6:3028139-3028161 TCCTGAGTGTGGTGGGGACGTGG + Intergenic
1003166813 6:3686680-3686702 TGAGGTGGGAGGTGGGGAGAGGG - Intergenic
1003213119 6:4085665-4085687 AGGTGTTTTTGGTGGGGAGAAGG - Intronic
1004178223 6:13359179-13359201 TCCTGTGCCTGGCGGGGAGAAGG + Exonic
1004329325 6:14707522-14707544 TGCTGTGTTAGGTGTGGAGGTGG - Intergenic
1004461541 6:15841508-15841530 TGTTGGGTGTGGCGGGGAGTTGG - Intergenic
1004646637 6:17568638-17568660 TTGTGTGTGTGGTGGGGTGGTGG + Intergenic
1005046996 6:21652290-21652312 TGATGTGTGGGGAGGGGAGATGG + Intergenic
1005054599 6:21717680-21717702 AGCTGGGTGTGGTGGGGGGGTGG + Intergenic
1005716535 6:28554486-28554508 TGCTGTGTGCGGTGGGGCTGTGG + Intergenic
1006101830 6:31690306-31690328 TGGGGTGTGTGGTGGGGGAATGG + Intronic
1006128040 6:31852477-31852499 TCCTGAGTGTGGTGGGGACTTGG + Intergenic
1006373631 6:33659831-33659853 GGCTCTGGGTGGTGGGGGGATGG - Intronic
1006546902 6:34787586-34787608 TACTCAGTGGGGTGGGGAGAGGG + Intergenic
1006676858 6:35770905-35770927 TGCTCTCTGTGGGGGGGAGCAGG - Intergenic
1006748809 6:36364130-36364152 TCCTGAGTCTGGTGGGGAGGTGG - Intronic
1006776647 6:36598014-36598036 TGCTGACTGTTGAGGGGAGAGGG + Intronic
1006795997 6:36732783-36732805 TGTTTTGTATGGTGGGGAAAGGG - Exonic
1006897938 6:37482646-37482668 GACAGTGTGTGGTGGGGGGATGG + Intronic
1007001713 6:38319743-38319765 TGCTGCCTGGGGTTGGGAGAAGG + Intronic
1007063870 6:38969699-38969721 AGGTGTGTGTGGGGGGGAGTGGG + Intronic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007160477 6:39787829-39787851 AGCTGTGTGTGTTGGGTGGAGGG + Intergenic
1007278515 6:40693088-40693110 GGCTGTGTGTGGGGGCGAGAGGG - Intergenic
1007355627 6:41313736-41313758 TTCTGTGTGTGGTAGGGAAGGGG + Intergenic
1007382416 6:41499416-41499438 TGCTGGGTGTGGTGAAGGGAAGG - Intergenic
1007399589 6:41596279-41596301 GGCTGTTTGAGGTCGGGAGAAGG - Intronic
1007475052 6:42114050-42114072 TGGTGTGTGTGGGAGGAAGACGG + Intronic
1007561046 6:42808670-42808692 GGGTGTGTGTGGGGGAGAGATGG + Intronic
1007618774 6:43198840-43198862 TGCTGTCTGTGCTGAGGTGAGGG + Exonic
1007636198 6:43301289-43301311 ATATGTGTGTGGTGGGGAGTGGG + Intronic
1007762208 6:44139689-44139711 TTCTCTGTGGGGTGGGAAGAGGG - Exonic
1008005505 6:46405665-46405687 TCCTGAGTCTGGTGGGGACATGG - Intronic
1008847322 6:55983566-55983588 TGCTATGTGAGTTGGGGAAAAGG + Intergenic
1008906658 6:56684989-56685011 TTCTGTGTGGGGTGGGGGGGTGG - Intronic
1008936421 6:56997414-56997436 GTGTGTATGTGGTGGGGAGATGG - Intronic
1009587735 6:65628003-65628025 TCCTGAGTCTGGTGGGGAGGTGG + Intronic
1009741401 6:67751436-67751458 TGTTGTGTATGGTGGGCAGAGGG + Intergenic
1010235553 6:73572430-73572452 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1010264072 6:73848146-73848168 TGTTGTGGGTTGGGGGGAGAGGG + Intergenic
1010311109 6:74386815-74386837 TGTTGTGGGTTGGGGGGAGAGGG + Intergenic
1010995033 6:82523364-82523386 TGACTTGTGTTGTGGGGAGAGGG + Intergenic
1011322887 6:86116379-86116401 TGCAGTCTGTGGTTGGGGGAGGG + Intergenic
1011620014 6:89234387-89234409 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1011726064 6:90211912-90211934 TGCTGGGCGTGGTGGTGGGAAGG - Intronic
1011726932 6:90219106-90219128 TGGTGTTGGAGGTGGGGAGAAGG - Intronic
1012113379 6:95262861-95262883 TGTTGTGTGAGGTGAGGACAAGG - Intergenic
1012232191 6:96772904-96772926 TGTTGTGTGGTGGGGGGAGAGGG + Intergenic
1012615704 6:101277275-101277297 TGCTGTGTCTGGCGGGGGTAAGG + Intergenic
1012644550 6:101662588-101662610 TGTGGTGTTTGGTGGAGAGATGG - Intronic
1012798682 6:103796638-103796660 TGTTGTGTGTAGCGGGGAGGAGG + Intergenic
1012881574 6:104797386-104797408 GGATGTGTGTGGTAGGAAGAAGG - Intronic
1013015193 6:106154684-106154706 TGCTGTGCATGGAGGGGAAAGGG + Intergenic
1013044298 6:106469082-106469104 AGGGGTGAGTGGTGGGGAGAGGG - Intergenic
1013080316 6:106806218-106806240 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1013783539 6:113754638-113754660 GGGTGTGTGGGTTGGGGAGAGGG + Intergenic
1013886133 6:114970533-114970555 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1014584608 6:123182737-123182759 GGCTGAGCTTGGTGGGGAGAGGG + Intergenic
1014637807 6:123870271-123870293 TGGTGTGTGTTGGGGGGAGTTGG + Intronic
1015011611 6:128356151-128356173 TGATGTTTGATGTGGGGAGAGGG - Intronic
1015083924 6:129264376-129264398 TGGTGTGTGTGGGGGGGTGGGGG + Intronic
1015180089 6:130352058-130352080 TGTTGTGTGTTGGGGGGAGGGGG + Intronic
1016510988 6:144842810-144842832 TGCTTTGGGGGGTGGGGAGGTGG - Intronic
1017523141 6:155219728-155219750 TGCTGGGTGTGGCAGGAAGACGG + Intronic
1018064147 6:160114415-160114437 TCCTGAGTCTGGTGGGGAAATGG - Intergenic
1018073505 6:160188489-160188511 TGTTGTGGGTTGGGGGGAGAGGG - Intronic
1018225729 6:161626869-161626891 TGCTCTGGGTGGTGGGGGGAGGG - Intronic
1018379526 6:163245673-163245695 CAGAGTGTGTGGTGGGGAGAGGG - Intronic
1018615572 6:165683493-165683515 TGCTGTGGGTGTGGGAGAGATGG + Intronic
1018719771 6:166563576-166563598 TACCCTGTGTGGAGGGGAGAGGG - Intronic
1018945207 6:168343145-168343167 TGCTGTGAGTGGCTGTGAGAAGG + Intergenic
1019194729 6:170274509-170274531 AGGTGTGTGGGGTGGGGAGCAGG + Intergenic
1019202647 6:170330959-170330981 TGCTTTCAGTGGTGGGGAGAAGG - Intronic
1019265672 7:116286-116308 TCCTGAGTGTGGAGGGGAGATGG - Intergenic
1019444034 7:1061650-1061672 TTCTGTGTGTGATGAGGTGAAGG - Intronic
1019527785 7:1488510-1488532 GCCTGTGTGTTGTGGGGAGTGGG - Intronic
1019537445 7:1536732-1536754 TTCTGTGCATGGTGGGGAGAGGG + Intronic
1019809951 7:3158031-3158053 TGGGGTCTGTGCTGGGGAGATGG - Intronic
1019944175 7:4313835-4313857 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1020726327 7:11820028-11820050 TGGTGTGTGGGGTGGGGGCAGGG - Intronic
1020817383 7:12922353-12922375 ACCTCTGTGTGGTGAGGAGAAGG + Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021085618 7:16419094-16419116 TTCTCTGGGTAGTGGGGAGAGGG - Intronic
1021264389 7:18501696-18501718 TGCTGTGTTTGGTGAAGAGGAGG + Intronic
1021406880 7:20280427-20280449 TTGTGTGTGTGTTGGGGAGGTGG + Intergenic
1021567465 7:22029101-22029123 TGCTGAGTCTGGTGGGGACTTGG + Intergenic
1021971697 7:25971263-25971285 GGCTGTATGTGGTGGGGAGGAGG - Intergenic
1022033381 7:26512652-26512674 TGTTGTGTGTGGTGGGGAGCAGG + Intergenic
1022256385 7:28662628-28662650 GGCTGTGTGTTGGGGGGAGCTGG - Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022470717 7:30680522-30680544 AGCTGTGTGGGGTGGGGCAATGG - Intronic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1023196366 7:37643983-37644005 GGCTGGTGGTGGTGGGGAGAGGG - Intergenic
1023535780 7:41207734-41207756 GGGTGTGGGGGGTGGGGAGATGG + Intergenic
1023839832 7:44090471-44090493 TGGCGGGGGTGGTGGGGAGAGGG + Intergenic
1024303524 7:47906443-47906465 TGCTGTGTATGGTGTGTATATGG - Intronic
1024591167 7:50885916-50885938 TGATGTGTGTGGTGAGGTGGGGG + Intergenic
1024635003 7:51280042-51280064 TGCTCTATGTGGAGGAGAGAGGG - Intronic
1024693735 7:51833615-51833637 TGTTGTGGGTTGGGGGGAGAGGG - Intergenic
1024825342 7:53385059-53385081 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1024971765 7:55078165-55078187 TGGCGTGTGGGGAGGGGAGAAGG + Intronic
1026582858 7:71632574-71632596 GTCTGTGTGTGTTGGGGACAAGG + Intronic
1026615942 7:71904537-71904559 TGGGGTGGGTAGTGGGGAGAAGG + Intronic
1026842721 7:73679502-73679524 TGCTCAGTGGGGTGGGGAGGGGG - Intergenic
1027140150 7:75650975-75650997 TTTTTTGTGTGGTGGGGAGAGGG - Intronic
1027293602 7:76743135-76743157 TTCTGTGTGTGTTGGAGGGAGGG + Intergenic
1027561124 7:79731866-79731888 TGCTACCTGTGGTTGGGAGAAGG - Intergenic
1027579625 7:79977505-79977527 GGCTGAGTCTGGTGGGGAGGTGG - Intergenic
1027699808 7:81455987-81456009 TGGTGTGTGTGTGGGGGAGGGGG + Intergenic
1028362286 7:89983771-89983793 TGTTGTGTGGTGGGGGGAGAGGG - Intergenic
1028542092 7:91953809-91953831 TTTTGTGTGTGGTGGGGGGCGGG - Intronic
1028736111 7:94214150-94214172 TGCTGTGTCTTGTGGTGAAAGGG - Intergenic
1028845161 7:95472069-95472091 GGGTGTGTGTGGTGGTGGGAGGG + Intergenic
1029529214 7:101114368-101114390 GGTTTTGTGAGGTGGGGAGAAGG + Intergenic
1029567711 7:101349987-101350009 TACTGTGTGTGGGGCTGAGATGG - Intergenic
1029797468 7:102910395-102910417 TTCTTTGTGTGTTGGGGGGAGGG + Intronic
1029974011 7:104815722-104815744 TACTGTGTGGGGTGGGGTGGTGG - Intronic
1030084976 7:105808135-105808157 CCCTGTGTGTCCTGGGGAGAAGG - Intronic
1030178902 7:106684529-106684551 TGTTGTGGGTTGTGGGGAGGGGG - Intergenic
1030612902 7:111708053-111708075 TCGTGTGTGTGGTAGGGGGAAGG - Intergenic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1031526911 7:122833507-122833529 AGCTGGGTGTGGTGGGAGGACGG - Intronic
1031610766 7:123824555-123824577 TGGTGAGAGTTGTGGGGAGAAGG - Intergenic
1031794729 7:126157333-126157355 TGGGGTGGGTGGTGGGGAGGGGG - Intergenic
1032086711 7:128887606-128887628 GGCTGTGTGTGGGGGGGTGTAGG - Intronic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032392084 7:131561787-131561809 TGGTGTGTGTGGTGTGTTGAGGG + Intergenic
1032487288 7:132297322-132297344 GGCTGTGTGTTGTGGGGTGGAGG + Intronic
1032545326 7:132737262-132737284 AGGGGTGTGTGGTGGGGGGAGGG - Intergenic
1032944805 7:136837043-136837065 TGGGGACTGTGGTGGGGAGAGGG + Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033606826 7:142933693-142933715 TGCAGTGTGTGGTTGTGAGGTGG + Exonic
1033918467 7:146357913-146357935 TCCTGTGTGTGGCGGGGGGCGGG - Intronic
1033947622 7:146741116-146741138 TGCTGCCTGGGGTTGGGAGAGGG + Intronic
1034091133 7:148364270-148364292 TCCTGAGTCTGGTGGGGACATGG + Intronic
1034273209 7:149813137-149813159 TGCTGAGGGAGGTGGGGAGAGGG + Intergenic
1034536700 7:151729821-151729843 TTCAGTGGGTGATGGGGAGAGGG - Intronic
1034725336 7:153330598-153330620 TTGTGTGTGTGTTGGGGAGCTGG + Intergenic
1035122475 7:156579748-156579770 GTCTGTGAGTGGTGGGGGGAGGG + Intergenic
1035716149 8:1756557-1756579 TGCTGTATGTTTGGGGGAGAGGG + Intronic
1035737350 8:1898344-1898366 TGTTCAGTGTGGTGGGGAGGAGG + Intronic
1036615367 8:10383390-10383412 TTCTGTGTGTGAAGGAGAGACGG + Intronic
1037372438 8:18194282-18194304 TGATGTGTCTGTAGGGGAGAGGG + Intronic
1037425523 8:18750942-18750964 TCCTGAGTCTGGTGGGGAGGTGG - Intronic
1037765355 8:21769173-21769195 TGCTCTGTGTGTTCCGGAGACGG - Intronic
1037805578 8:22056491-22056513 TGCTGTGGGCGGTGGGTCGAGGG - Intronic
1037892290 8:22629713-22629735 TGCTGGGTGGGGTGGGAAGGGGG + Intronic
1037914485 8:22764641-22764663 TGGAGTGTGTGGTGGGGATTTGG + Intronic
1037919290 8:22792828-22792850 TGCGGTGGGTGGTAGGGAGCAGG + Intronic
1038041503 8:23727587-23727609 GACTGGTTGTGGTGGGGAGAAGG - Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1038433956 8:27521668-27521690 TTTTGTGTGTGATGGGGACAGGG + Intronic
1038579857 8:28738618-28738640 TGCTCTGTGTGGTGGGCAGTGGG - Intronic
1038813842 8:30880780-30880802 AGCTGTGTGTTTTGGGGAGGGGG + Intronic
1039088821 8:33806409-33806431 GGCAGTGTGTGCTGGGGAGATGG + Intergenic
1039423579 8:37466227-37466249 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
1039637391 8:39180589-39180611 TCCTGAGTCTGGTGGGGAGGTGG + Intronic
1039884852 8:41649041-41649063 TGGTGTGTGGGATGTGGAGAGGG + Intronic
1040432149 8:47353528-47353550 GGTTTAGTGTGGTGGGGAGAGGG + Intronic
1040474385 8:47763871-47763893 TGGTGTGTGTGGTTGTGTGATGG + Intergenic
1040688826 8:49910296-49910318 TGGTGTGTGTGGTGGGGACGGGG - Intronic
1040778470 8:51076247-51076269 TGGGGACTGTGGTGGGGAGAGGG + Intergenic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1041046504 8:53892036-53892058 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
1041256959 8:55987266-55987288 AGCTGAGTGTGGTGGCGAGTAGG + Intronic
1041303552 8:56437676-56437698 GGGTGTGTGTGGTGGGGTGGGGG + Intronic
1041375698 8:57207870-57207892 TGATGTGTCTGGTGGGGTGTGGG + Intergenic
1041376461 8:57212249-57212271 TGATGTGTCTGGTGGGGTGTGGG + Intergenic
1041532588 8:58887423-58887445 TGCTGTTTTTATTGGGGAGAGGG + Intronic
1041581630 8:59466165-59466187 TGCGGTGGGGGGAGGGGAGAGGG + Intergenic
1041637155 8:60156783-60156805 TGATGGGGGTGGTGGGGGGAGGG - Intergenic
1042422299 8:68605952-68605974 TGGTGTGTGTGGGGGGCAGGAGG + Intronic
1042444341 8:68866710-68866732 TGGTGTGTGTGTTGGGGTGAGGG + Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043097741 8:75996987-75997009 TTCTGTGTGGGGTGGGGACTTGG + Intergenic
1043261783 8:78209504-78209526 CACTGGGTGTGGTAGGGAGAGGG + Intergenic
1043550711 8:81369393-81369415 AACTGTGTGTGGTATGGAGAGGG - Intergenic
1043701206 8:83290812-83290834 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1044429721 8:92095091-92095113 TGTTGTGTGGGGTGAGGAGGAGG - Intronic
1044526827 8:93261701-93261723 TTTTGTGTGTGGGGGGGGGAGGG + Intergenic
1044794268 8:95880443-95880465 AGGTGGGTGTGGTGGGGATAAGG + Intergenic
1044880584 8:96718985-96719007 TTCTGAGTCTGGTGGGGACATGG - Intronic
1045108340 8:98915775-98915797 TGATGTGTGTGGAGGGGCGGAGG - Intronic
1045739143 8:105334150-105334172 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1047749304 8:127867717-127867739 TGGCGGGTGGGGTGGGGAGAAGG + Intergenic
1047882586 8:129212692-129212714 GGATGTGTGTGTTGGGAAGAGGG + Intergenic
1048238051 8:132711829-132711851 GGGTGTGTGTGTTGGGGGGAGGG + Intronic
1048266893 8:132995284-132995306 TGCTGTATGTGGTGGGTAGTAGG - Intronic
1048292949 8:133194334-133194356 TGGTGTGTGTGGGGGGGTGGTGG + Intronic
1048292992 8:133194546-133194568 TGGTGTGTGTGGGGGGGTGGTGG + Intronic
1048443672 8:134477991-134478013 TGCTGGGTGGGGTGGGGGTAGGG - Exonic
1048524183 8:135186416-135186438 TGCTGTATGTGGTTGTGGGAGGG - Intergenic
1048786030 8:138051339-138051361 TTGTGTGTGTGGCGGGGAGTTGG + Intergenic
1048787308 8:138063771-138063793 GGCTGTGTCTGGCGGGGAGTAGG + Intergenic
1049011088 8:139887936-139887958 TGCTGCGTGTGGAGGGGCTACGG - Intronic
1049021621 8:139961193-139961215 TGCTCTGTGTAGTGGGCAGACGG - Intronic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049217800 8:141415742-141415764 TGTGGGGTGGGGTGGGGAGAGGG + Intronic
1049217811 8:141415765-141415787 TGTGGGGTGGGGTGGGGAGAGGG + Intronic
1049319680 8:141989446-141989468 AGCTGTCTGTGCTGGGAAGAGGG + Intergenic
1049586047 8:143432814-143432836 TCCTGTGGGTGGTGGCGGGATGG - Intergenic
1049790532 8:144470314-144470336 TGCAGTGTGGGGTGGGGCTAAGG - Intronic
1049859692 8:144890098-144890120 TGATGTCTGTGATGGGGAGTGGG + Intronic
1050063216 9:1731960-1731982 TGGTGTGTGTTGTGGAGAGGGGG - Intergenic
1050063218 9:1731962-1731984 TGTGGTGTGTGTTGTGGAGAGGG - Intergenic
1050145150 9:2559776-2559798 TTCTGTTTGTGGGGAGGAGAGGG + Intergenic
1050615655 9:7399162-7399184 TTCTGTAGGTGGTGGGGGGAGGG + Intergenic
1050817112 9:9828496-9828518 TGTTGTGAGGTGTGGGGAGAGGG + Intronic
1051690748 9:19709750-19709772 TGGTGTGGGGGGTGGGGGGAGGG + Intronic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1052075534 9:24135528-24135550 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
1052979637 9:34438407-34438429 TCCTGAGTCTGGTGGGGAGGTGG + Intronic
1053027194 9:34740135-34740157 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1053056640 9:34996885-34996907 GTGTGTGTGTGCTGGGGAGATGG + Intronic
1053547827 9:39042256-39042278 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1053754850 9:41295601-41295623 TGCTGTGTGGTGGGGGGAGGGGG - Intergenic
1053786417 9:41655656-41655678 TTGCGTGTGTGTTGGGGAGAGGG + Intergenic
1053811951 9:41862297-41862319 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1054239532 9:62597448-62597470 GGCTGGGGGCGGTGGGGAGAGGG + Intergenic
1054260374 9:62859898-62859920 TGCTGTGTGGTGGGGGGAGGGGG - Intergenic
1054450104 9:65398842-65398864 TTGCGTGTGTGTTGGGGAGAGGG + Intergenic
1054618644 9:67325142-67325164 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
1054722541 9:68617485-68617507 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1055270848 9:74556740-74556762 TGCTTTGTGTGCTGGGGAGCAGG + Intronic
1055913550 9:81377273-81377295 GTCTGTGTGTGGTGTGGGGAAGG - Intergenic
1055967585 9:81880658-81880680 GGGTGTGAGTGTTGGGGAGAGGG + Intergenic
1056080873 9:83093198-83093220 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1056787527 9:89603851-89603873 GGGTGTGTGTGTTGGGGGGAGGG + Intergenic
1057353134 9:94316801-94316823 TGCTGTGTTCTGTGGGCAGATGG + Intergenic
1057654613 9:96940790-96940812 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1057800600 9:98189029-98189051 GGCAGGGTGTGGTGGGGACAAGG - Intronic
1058235610 9:102486882-102486904 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1058237627 9:102512009-102512031 TGCAGAGTGTGGAGGAGAGAGGG - Intergenic
1058249139 9:102669345-102669367 TGCTGCCTGGGGTTGGGAGAGGG + Intergenic
1058637642 9:107051781-107051803 AGGTATGTGTGTTGGGGAGAGGG + Intergenic
1058898946 9:109424720-109424742 TGCTCTGTGTGGTGTAGATAGGG - Intronic
1059003604 9:110377133-110377155 TGCTCTGTTTGGTGTGGACAAGG + Intronic
1059369304 9:113812831-113812853 TTGTGTGTGTGGTGAGGGGAGGG - Intergenic
1059427108 9:114228096-114228118 GTCTGTGTGTGGTGGGGGCAGGG - Intronic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1059560384 9:115328915-115328937 TGCTGTATGGGGTGAGGAGAGGG + Intronic
1059635155 9:116163164-116163186 GGCAGTGGGTGTTGGGGAGAAGG + Intronic
1059654499 9:116345358-116345380 AGGGGTGTGTGTTGGGGAGAAGG + Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060297773 9:122354955-122354977 TGCTGCTGGGGGTGGGGAGAGGG + Intergenic
1060812408 9:126617224-126617246 TGCAGGGCGTGGTGGGGAGGGGG - Intronic
1061028181 9:128063958-128063980 GGCTGTATGGGGTGGGGAGGAGG + Intronic
1061223266 9:129264811-129264833 TGGTGGGGGTGGTGGGGAGTTGG + Intergenic
1061483914 9:130910583-130910605 TCCTGAGTCTGGTGGGGAGGTGG + Intronic
1061565611 9:131437675-131437697 TTCAGTGTTAGGTGGGGAGAGGG - Intronic
1061754720 9:132804487-132804509 TGCAGTGAGGGGTGAGGAGAAGG + Intronic
1062225176 9:135446406-135446428 GGCTGTCTGGGGTGGGGGGAGGG + Intergenic
1062461313 9:136663658-136663680 TGCTGGGTGCGGTGGGCAAATGG + Intronic
1062521608 9:136960180-136960202 TGTAGTGTGTGGTGGGGAGGTGG + Intergenic
1062635556 9:137488756-137488778 TGCTGTGGGTGGTGGACAGTTGG - Intronic
1062638108 9:137502084-137502106 TTCTGTAGGTGGTGTGGAGAAGG - Intronic
1185587633 X:1252318-1252340 TCCTGTGTGGGGTGGTGGGAAGG - Intergenic
1185709724 X:2293809-2293831 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1185860004 X:3569060-3569082 TGATGTGTGTGGTGGGGGAGTGG - Intergenic
1186152511 X:6690407-6690429 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1186323168 X:8452390-8452412 TCCTGAGTCTGGTGGGGAGGTGG - Intergenic
1186457291 X:9719864-9719886 TGCTGTGTGAGATAGGGAGCTGG + Intergenic
1186502190 X:10060412-10060434 TTGTGTGTGTGTTGGGGAGGGGG + Intronic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1186976743 X:14915794-14915816 TGTTGGGTGTGGTGGGGGTAAGG + Intronic
1187114580 X:16336210-16336232 TTTTATGTGTGGTGGGGAGTGGG + Intergenic
1187244366 X:17540576-17540598 TGATTTGGGTGGTGGAGAGAGGG + Intronic
1187940504 X:24376178-24376200 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
1188189610 X:27157464-27157486 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1189078275 X:37941245-37941267 AGCTGGATGTGGTGGGGAGCGGG - Intronic
1189605114 X:42669107-42669129 TGCTGTTTGGTGTGGGAAGACGG - Intergenic
1189700694 X:43714774-43714796 GTGTGTGTGTGGTGGGGAAATGG + Intronic
1189754794 X:44260107-44260129 AGTTGTCTGTGGTGGGGAGCGGG + Intronic
1190172380 X:48121858-48121880 AGGTGTGTGTGGTGGAGGGAGGG + Intergenic
1190180131 X:48184921-48184943 AGGTGTGTGTGGTGGAGGGAGGG - Intergenic
1190193143 X:48294140-48294162 AGGTGTGTGTGGTGGAGGGAGGG - Intergenic
1190197142 X:48329293-48329315 AGGTGTGTGTGGTGGAGGGAGGG + Intergenic
1190199116 X:48345120-48345142 AGGTGTGTGTGGTGGAGGGAAGG - Intergenic
1190204840 X:48394538-48394560 AGGTGTGTGTGGTGGAGGGAGGG + Intergenic
1190205696 X:48400865-48400887 AGGTGTGTGTGGTGGAGGGAGGG - Intergenic
1190323723 X:49193682-49193704 GGCTGTGGGTGTTGGGGGGAGGG + Intronic
1190454641 X:50615774-50615796 GTTTGTGTGTGGTGGGGGGAGGG + Intronic
1190663881 X:52679671-52679693 AGGTGTGTGTGGTGGAGGGAGGG + Intronic
1190665877 X:52695588-52695610 AGGTGTGTGTGGTGGAGGGAGGG - Intronic
1190673541 X:52762822-52762844 AGGTGTGTGTGGTGGAGGGAGGG + Intronic
1190675541 X:52778751-52778773 AGGTGTGTGTGGTGGAGGGAGGG - Intronic
1190790726 X:53697370-53697392 TTCTGTGACTGGTGGGGTGAGGG + Intergenic
1190968377 X:55323875-55323897 TGCTGCCTGTGGTTGGGGGAGGG + Intergenic
1190988704 X:55523253-55523275 TGCTGGGTGATGTGAGGAGATGG + Intergenic
1191270232 X:58456091-58456113 TGCGGTGGGGGGTGGGGGGAGGG - Intergenic
1191890435 X:65934419-65934441 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1191948637 X:66563946-66563968 TGCTGTGGGGTGTGGGGAGGGGG - Intergenic
1192258161 X:69483463-69483485 TGGGGTGGGGGGTGGGGAGAGGG + Intergenic
1192553720 X:72073435-72073457 ATCTGTATGTGGTGGGGAGGGGG + Intergenic
1192674194 X:73177354-73177376 TGCGGTGGGGGGAGGGGAGAGGG + Intergenic
1192685413 X:73299776-73299798 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1193040125 X:76996558-76996580 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1193259902 X:79392925-79392947 TGCTGTGGGGTGGGGGGAGAGGG + Intergenic
1193264441 X:79452304-79452326 TGCTGTCTGAGGTTGGGGGAGGG - Intergenic
1193912094 X:87317917-87317939 TGCTACCTGTGGTGGGAAGAAGG + Intergenic
1194684271 X:96893303-96893325 TTCTTTGTGTGGAGTGGAGAGGG + Intronic
1194892604 X:99398595-99398617 TGCTGTCTGGGGTTGGGGGAGGG + Intergenic
1195085398 X:101408477-101408499 TGCTGCGCCTGGTGGGGAAATGG + Intronic
1195264209 X:103164289-103164311 TGGTGTGTGTGGAGGGGAATGGG + Intergenic
1195453815 X:105045278-105045300 TGGTGTATGTGCTGGGTAGAAGG + Intronic
1195964213 X:110415566-110415588 TTCTGGGTGCTGTGGGGAGATGG + Intronic
1195986720 X:110638325-110638347 TGTTGTGGGGTGTGGGGAGAGGG + Intergenic
1195986882 X:110640154-110640176 TGTTGTGGGGTGTGGGGAGAGGG - Intergenic
1196109989 X:111936490-111936512 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
1196609410 X:117694839-117694861 TGGTGTGTGTGTGGGGGGGAGGG - Intergenic
1196645244 X:118111078-118111100 TGCTGTGGGTGGTGGAGATTAGG - Intronic
1196741595 X:119029976-119029998 TCCTGAGTCTGGTGGGGATATGG + Intergenic
1196845138 X:119891051-119891073 TCCTGTGTCTGGTGGGGAGGTGG + Intergenic
1196853226 X:119958710-119958732 AGCTGGGTGTGGTGGGGGGGGGG + Intergenic
1197000203 X:121431428-121431450 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1197192515 X:123663766-123663788 TGTTGTGGGGTGTGGGGAGAGGG - Intronic
1197564435 X:128064397-128064419 TGTTAGGTGTGGTGGGGAGAGGG + Intergenic
1197656927 X:129126825-129126847 TGTTGTGTGTGGGGAGGAGTAGG - Intergenic
1197715719 X:129704792-129704814 TGCTGCTTGTGGTGGAGAAAAGG - Intergenic
1197738581 X:129871786-129871808 TGCTGTTGGTGCTGGGCAGAGGG - Intergenic
1197756856 X:130001708-130001730 TGGTGAGAGTGGTGGGGAAATGG + Intronic
1197846510 X:130810081-130810103 TGCTGCATGGGGTTGGGAGAGGG - Intronic
1197895943 X:131315471-131315493 TGGAGTGACTGGTGGGGAGAGGG + Intronic
1198021891 X:132666936-132666958 TGGTGTGTGTGGTGGTGAGGAGG - Intronic
1198569498 X:137939974-137939996 TGTTTTCTGTGGTGGGGGGAGGG - Intergenic
1198677593 X:139147320-139147342 AGATGTGTGTGGTGGGGAGATGG - Intronic
1199175623 X:144784079-144784101 TCCTGAGTCTGGTGGGGAGGTGG + Intergenic
1199411765 X:147532253-147532275 TGCTCTGTGTGGTGGTGGGTGGG - Intergenic
1199601943 X:149546300-149546322 TGCTGTGAGTGGTGGGGCTGGGG - Intronic
1199610430 X:149607756-149607778 TGGGGTCTGAGGTGGGGAGATGG + Intronic
1199648443 X:149933184-149933206 TGCTGTGAGTGGTGGGGCTGGGG + Intronic
1199730090 X:150623256-150623278 TGCTGGGAGAGCTGGGGAGATGG + Intronic
1199949660 X:152698292-152698314 TGGTGTGTGGGGTGGGGGGGCGG - Intergenic
1199960014 X:152770169-152770191 TGGTGTGTGGGGTGGGGGGGCGG + Intergenic
1200208108 X:154332519-154332541 TGCTGGGGGTGCTGGGGAGTAGG - Intergenic
1200405078 Y:2801909-2801931 TGGGGTCTGTGGTGGGGAGAGGG - Intergenic
1200778270 Y:7190159-7190181 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
1200824212 Y:7622116-7622138 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1201308080 Y:12568300-12568322 TGGGGTGTGTGGTGGGGTGGAGG - Intergenic
1201627598 Y:16031898-16031920 TGTTGTGGGTTGTGGGGAGCGGG + Intergenic
1202109919 Y:21407662-21407684 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1202235842 Y:22708971-22708993 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1202307321 Y:23487197-23487219 TCCTGAGTCTGGTGGGGACATGG - Intergenic
1202563484 Y:26183389-26183411 TCCTGAGTCTGGTGGGGACATGG + Intergenic
1202584757 Y:26410239-26410261 GACGGTGTGGGGTGGGGAGATGG + Intergenic