ID: 948230997

View in Genome Browser
Species Human (GRCh38)
Location 2:236349220-236349242
Sequence ATGGAGCTGAAGAGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 612}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948230983_948230997 20 Left 948230983 2:236349177-236349199 CCCCGATTTCCTTCCAACATGGC 0: 1
1: 0
2: 0
3: 9
4: 141
Right 948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 612
948230981_948230997 21 Left 948230981 2:236349176-236349198 CCCCCGATTTCCTTCCAACATGG 0: 1
1: 0
2: 0
3: 4
4: 116
Right 948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 612
948230985_948230997 18 Left 948230985 2:236349179-236349201 CCGATTTCCTTCCAACATGGCCT 0: 1
1: 0
2: 2
3: 19
4: 265
Right 948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 612
948230992_948230997 -2 Left 948230992 2:236349199-236349221 CCTGGGCACTGCTGCCAAGGGAT 0: 1
1: 0
2: 1
3: 21
4: 224
Right 948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 612
948230988_948230997 11 Left 948230988 2:236349186-236349208 CCTTCCAACATGGCCTGGGCACT 0: 1
1: 0
2: 1
3: 16
4: 173
Right 948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 612
948230984_948230997 19 Left 948230984 2:236349178-236349200 CCCGATTTCCTTCCAACATGGCC 0: 1
1: 0
2: 1
3: 24
4: 250
Right 948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 612
948230989_948230997 7 Left 948230989 2:236349190-236349212 CCAACATGGCCTGGGCACTGCTG 0: 1
1: 0
2: 3
3: 31
4: 281
Right 948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG 0: 1
1: 0
2: 3
3: 52
4: 612

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948230997 Original CRISPR ATGGAGCTGAAGAGTGAGGA GGG Intronic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901009568 1:6192152-6192174 GGGGAGCTGAAGTGGGAGGATGG - Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902075608 1:13782434-13782456 TTGGACCTGAAGGATGAGGAGGG - Exonic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902165080 1:14563652-14563674 ATGGAGCTGATGAGAGTTGAGGG - Intergenic
902298866 1:15487242-15487264 AGGGAGTTGAAGTGGGAGGAAGG - Intronic
902548577 1:17205891-17205913 ATGGTGATGAACAGTGATGATGG + Intronic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
902792253 1:18777534-18777556 ATGGATCTGAAGCGGGGGGAGGG - Intergenic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903762618 1:25709484-25709506 TTGGAGCTGGAGAGTTAGGGTGG - Intronic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905227808 1:36491305-36491327 ATGAGGCTGCAGGGTGAGGAAGG - Intergenic
905649349 1:39646215-39646237 ATGGAGCAGGAAAGTGATGATGG - Intergenic
905826707 1:41031182-41031204 AGGAAGCTGAGGTGTGAGGATGG + Intronic
905855616 1:41310094-41310116 ATGGAGCTGAAGGGTATGGGGGG + Intergenic
906355058 1:45098224-45098246 ATGGAGCTGTAGAGTCAGGCAGG + Intronic
907233606 1:53024368-53024390 ATGGAGATGAAAGGTGATGATGG + Intronic
907362706 1:53932667-53932689 TTGGAGCTGAGGCATGAGGATGG - Intronic
907466371 1:54640456-54640478 CTGGAGATAAAGAGTGAGGGAGG + Intergenic
907528241 1:55067064-55067086 ATGAAGCTTTACAGTGAGGACGG + Exonic
909252924 1:73381311-73381333 AGGGAGCAGGAGAGTGAGGTGGG - Intergenic
910855572 1:91691884-91691906 ATTAAGCTGATGACTGAGGAAGG + Intronic
911046165 1:93630527-93630549 ATGAGGCTGAAGTGGGAGGATGG + Intronic
911167473 1:94736899-94736921 ATGGTGCTCAACAGTGAAGAAGG - Intergenic
911346819 1:96706742-96706764 CTGGAGTGGAGGAGTGAGGAGGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
911745118 1:101433270-101433292 ATGGAGCTGTAGTGTGGGGCTGG + Intergenic
912090171 1:106062728-106062750 CTAGAGCTGAAGAGAAAGGAGGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912445625 1:109733923-109733945 ATGGACATGGAGAGTGAGTAGGG + Exonic
912653402 1:111462342-111462364 ATGGAGCTGGATAGTGGTGATGG + Exonic
912989228 1:114467417-114467439 CTGGAGCTGAAGGGTGTGGAGGG + Intronic
913556222 1:119969808-119969830 ATGAAGATGAAGAGTGTGGGGGG - Intronic
914346714 1:146806316-146806338 ATGGTGCTGCAGGGTCAGGAAGG - Intergenic
914430117 1:147613076-147613098 ATGGGGCTGAAGAATGGGGCTGG + Exonic
914992578 1:152511642-152511664 ATGGGGCTGAACACTGGGGAGGG - Exonic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916561662 1:165938996-165939018 ATGCACCTGAAGATGGAGGAAGG - Intergenic
916852642 1:168719234-168719256 ATGGAGCTGCAGGGAGAGAACGG - Intronic
917546469 1:175973991-175974013 ATTGAGCTGGAGAGGGAGGTGGG + Intronic
918148948 1:181781653-181781675 ATGAGACTGAAGAGTCAGGAAGG + Intronic
919102562 1:193112465-193112487 ATGGGGCTGAGGTGGGAGGATGG - Intergenic
920133753 1:203753260-203753282 ATGGAGGTGAGGAGGGTGGAGGG - Intergenic
920263173 1:204703462-204703484 ATGGGTCTGAAGAGTGTGCAGGG - Intergenic
921358199 1:214306216-214306238 ATGGGGCTGGAGGGTGGGGATGG - Intronic
922191583 1:223323505-223323527 ATAGAGCTGAAGATTGAGGGTGG + Intronic
922203251 1:223424779-223424801 ATGTAGCTCAAGAGAGAGGCTGG - Intergenic
922784450 1:228276149-228276171 AGGGAGCGGAAAAGAGAGGAGGG + Intronic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924062823 1:240193945-240193967 ATAACGCTGAAGACTGAGGATGG - Intronic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
924594083 1:245430149-245430171 TGGGGGCTGAAGAGGGAGGATGG + Intronic
1062985222 10:1762082-1762104 ATGGAGCTGAAAGTTGGGGAGGG - Intergenic
1063063470 10:2582913-2582935 GTGGAGGTGAGGAGTTAGGAGGG + Intergenic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1066047445 10:31605509-31605531 AAGGAGCTGAGGTGGGAGGAAGG - Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067222157 10:44352221-44352243 AGGGAGACAAAGAGTGAGGAGGG - Intergenic
1067717542 10:48701006-48701028 ATGGAGCTGGATAGTGCTGATGG - Intronic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1068236995 10:54250014-54250036 CTGGTGCTGAAGTGGGAGGATGG - Intronic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069775582 10:70925398-70925420 CTGGAGCTCAAGAGAGATGAGGG + Intergenic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070673699 10:78397322-78397344 GAGGAGCTGAAGAGTTAGGCAGG + Intergenic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071497555 10:86179296-86179318 AGGGAGGGGAAGAGGGAGGAGGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1072289639 10:93952293-93952315 AAGGACCTGGAGAGTGAGGAGGG + Intronic
1072312109 10:94166534-94166556 ATGGAGTTGAAGAGTTAGGCAGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072983475 10:100119074-100119096 TAAGAGCTGAAGAGTGAGTAGGG - Intergenic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1074717918 10:116236680-116236702 ATGGAGTTGAAGAAGGAGAATGG + Intronic
1074894338 10:117762008-117762030 GCGGGGGTGAAGAGTGAGGAGGG + Intergenic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1076217443 10:128707414-128707436 TTGGAGGTAAAGGGTGAGGATGG + Intergenic
1076493346 10:130879148-130879170 ATGGAGCAGAAGGGAGTGGAAGG + Intergenic
1076755309 10:132567623-132567645 ATGGAGCGGAAAAGGGAGGTGGG - Intronic
1076831842 10:132999338-132999360 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831855 10:132999382-132999404 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831881 10:132999470-132999492 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831907 10:132999558-132999580 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1077470287 11:2755138-2755160 ATGGCTCTGAAGATAGAGGAAGG - Intronic
1077782591 11:5347791-5347813 AGGGAGCAGAAGAGGGAGGGAGG + Intronic
1077846478 11:6030548-6030570 ATGGAACTGGAAAATGAGGAAGG - Intergenic
1077916554 11:6615397-6615419 ATGCAGGGTAAGAGTGAGGATGG - Intronic
1078133011 11:8628777-8628799 AAGGAGCTCATGAGAGAGGAGGG - Intronic
1078645289 11:13136418-13136440 ATGAAGCTGAAGACAGAGAAGGG - Intergenic
1078885546 11:15496405-15496427 GTGGTGCAGTAGAGTGAGGAAGG - Intergenic
1080814054 11:35736842-35736864 AAGGGAGTGAAGAGTGAGGAAGG - Intronic
1081607418 11:44536093-44536115 ATGATGCAGAAGAGGGAGGAGGG + Intergenic
1081751048 11:45511616-45511638 AGGGAGCAGATGAGAGAGGAGGG - Intergenic
1082113856 11:48306695-48306717 AGGCAGCTGAACCGTGAGGAGGG - Exonic
1082216934 11:49582768-49582790 ATGGTGCCTAAGAGAGAGGAAGG - Intergenic
1082265323 11:50111602-50111624 ATTCAGCTGGAAAGTGAGGAGGG + Intergenic
1083503658 11:63134880-63134902 ATGAAGCTGGAGAGGGAGGCAGG - Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1083691409 11:64411173-64411195 ATGGAGCTGAAACTTCAGGAAGG + Intergenic
1083692501 11:64418877-64418899 CTGGAGCTGAATGGTGGGGATGG + Intergenic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1084952646 11:72675129-72675151 TTGGAGCTGATGCGTGAGCATGG + Intergenic
1085029378 11:73260359-73260381 AGGGAGCTGGGGAGTCAGGAGGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085417793 11:76330772-76330794 CTGGACCTGAAGAATGAAGAGGG - Intergenic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085622555 11:78048413-78048435 AGGAAGCTGAAGTGGGAGGATGG + Intronic
1085916848 11:80900461-80900483 ATGGAGTTGCAGAGAGAGCAGGG + Intergenic
1086276882 11:85140707-85140729 ATGGAGGGGAAAAGTGGGGATGG - Intronic
1086353005 11:85962198-85962220 GTTGCGCTGAAGAGGGAGGAGGG - Intronic
1086515198 11:87603940-87603962 ATGGAGCCCAAGACAGAGGAGGG + Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086632617 11:89041398-89041420 ATGGTGCCTAAGAGAGAGGAAGG + Intronic
1087043061 11:93820401-93820423 ATGGAGTTGAGGACTGTGGATGG - Exonic
1089219889 11:116861843-116861865 CTGGAGCTGATGGGTAAGGAGGG + Exonic
1089402614 11:118173083-118173105 CTGGAGGTGAGGAGTGATGAGGG - Intronic
1089534832 11:119154567-119154589 AAGGAGCTGGTGAGTGGGGAAGG + Exonic
1089626937 11:119757110-119757132 ATGGAGCTGGAGAGTAATGATGG + Intergenic
1089956272 11:122574318-122574340 ATGGAGCTGAATGTTAAGGAAGG - Intergenic
1090387101 11:126363732-126363754 AAAGAGCTCAAGAGAGAGGAGGG - Intronic
1090447456 11:126776216-126776238 ATGGAGCCTAAGAGAGAGTAGGG - Intronic
1090567791 11:128014785-128014807 TTGGAGCTGAATATTTAGGACGG - Intergenic
1090613429 11:128492720-128492742 TTGGAGGTGTAGAGTGGGGATGG - Intronic
1091157371 11:133386074-133386096 AATGAGCTGAAGTGTGAGAATGG + Intronic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1092004895 12:5061014-5061036 ATGGAGGTGAGCAGAGAGGAGGG - Intergenic
1093822857 12:23643138-23643160 ATGGGGATGGAGAGTGAGGCAGG + Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1095967023 12:47875157-47875179 ATCTAGCTGAAGTGTGATGATGG - Intronic
1096007045 12:48182172-48182194 TTGGTGATGAAGAGTGAGGCTGG - Intergenic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1096239974 12:49954613-49954635 ATGGATCTGCAGTGGGAGGAGGG - Exonic
1096761001 12:53841949-53841971 ATGGGGAGCAAGAGTGAGGAGGG - Intergenic
1097203532 12:57300445-57300467 ATGGGGTTGAAGAGAGAAGAGGG - Intronic
1098150079 12:67537626-67537648 AAGGAGCTCAAGAGTGATGGGGG - Intergenic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1101072034 12:101086037-101086059 TTTGAGCTGAGAAGTGAGGAAGG + Intronic
1101323493 12:103694371-103694393 TTGGAGCTGAAGGGGGAGGAGGG - Intronic
1101376078 12:104172482-104172504 ATGGAGTGGAAGAGTAAGGAAGG + Intergenic
1101431163 12:104628618-104628640 ATGAGGCTGAAGAGGGAGGGAGG - Intronic
1101949330 12:109162433-109162455 CTGGAGCTGAGGGGTAAGGAGGG + Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102348973 12:112178499-112178521 ATGGAGCTGAGGACTGAGAAAGG + Intronic
1102490615 12:113287786-113287808 ATGGAGCTCACCAGTGAAGAAGG - Intronic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1102793908 12:115672248-115672270 ATGGAGCTTAAGAGCTGGGATGG + Intergenic
1103344139 12:120238102-120238124 ATGGAGCTGCAGAGTCACGCTGG + Intronic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106928923 13:34642322-34642344 TTGGAGCTGAGGATTGAGGTTGG + Intergenic
1107965861 13:45597694-45597716 ATGGAGCAGAAGAGGGAGCCTGG - Intronic
1108003363 13:45924500-45924522 GTGGAGGTAAAGAGTGAGGCTGG + Intergenic
1110355062 13:74558085-74558107 ATGGAGATCAAGGGTGAAGAGGG - Intergenic
1110563096 13:76930178-76930200 ATGCAGCTGGAGAGTAAGGGAGG - Intergenic
1110738421 13:78965683-78965705 ATAAAACTGAGGAGTGAGGAGGG - Intergenic
1111948274 13:94688248-94688270 AGAAACCTGAAGAGTGAGGAGGG + Intergenic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112533856 13:100230646-100230668 AGGGATCTGAAGAGTCAGGCTGG - Intronic
1112716378 13:102190901-102190923 GTGGAGCTGAGAAGAGAGGATGG - Intronic
1112772765 13:102809741-102809763 TTGGAGATGAATAGTGATGATGG - Intronic
1112844043 13:103616064-103616086 GTGGAGATCAAGAGTGATGAGGG + Intergenic
1114694087 14:24610467-24610489 ATGGTGCTTATGAATGAGGAGGG + Intergenic
1115107056 14:29774219-29774241 ATGCACTTGAAGAGGGAGGATGG + Intronic
1115273551 14:31581314-31581336 CTGGGGATGAATAGTGAGGATGG - Intronic
1115306959 14:31943622-31943644 GGGGAGCTGAGGAGTGAGGATGG + Intergenic
1116808391 14:49515770-49515792 ATGGAGTGGGAGAGAGAGGAGGG + Intergenic
1117392947 14:55279914-55279936 ATGGAGGTAAAGGGAGAGGATGG - Intronic
1117925449 14:60774384-60774406 ATGAAGCTGAAGAGTTAGGTAGG + Intronic
1119016338 14:71059832-71059854 ATAGTGCTGTAAAGTGAGGATGG - Intronic
1119205928 14:72793543-72793565 ATGGAGGTAGAGTGTGAGGATGG - Intronic
1119464147 14:74840916-74840938 ATGGACCTGAAAACTGAGAATGG - Intronic
1119489064 14:75014364-75014386 ATGAAGCTGGAGAATGGGGAGGG - Exonic
1119694888 14:76705339-76705361 ATGAAGCTGGAGGGTCAGGAAGG - Intergenic
1120716348 14:87845093-87845115 ATGGAACTTAAGACTGAGGCAGG - Intronic
1120737677 14:88072027-88072049 ATGGAGATTAAAAGTGATGAGGG + Intergenic
1121266049 14:92603344-92603366 AGGGGGCTGAAGGGTGGGGAGGG - Intronic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1121564130 14:94895977-94895999 ATGGAGTTGCAGAGAGAGGCAGG + Intergenic
1121576579 14:94993841-94993863 ATGGAAGTGAAGTGTGTGGATGG - Intergenic
1122775520 14:104115307-104115329 AGGGAACTGACGAGAGAGGACGG - Exonic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1123430589 15:20212297-20212319 TTGGAGCTGAGGTGGGAGGATGG - Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1124218909 15:27832464-27832486 ATGGCGCTGAAGATGGTGGAAGG - Intronic
1124395989 15:29302123-29302145 ATGAAGATGAAGAGTGAAAATGG - Intronic
1125377079 15:39041523-39041545 ATGGATCTAAAGAGAGAGGTTGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1127668699 15:61173894-61173916 ATGGATCTGAAAAGATAGGAAGG - Intronic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1128127715 15:65205225-65205247 GTGAGGCTGAAGAATGAGGAGGG - Intronic
1128361915 15:66968138-66968160 ATGGAGGTTTAGAGTGAGGATGG + Intergenic
1128691569 15:69728065-69728087 AGGAAGCTGAAGTGGGAGGATGG - Intergenic
1129687192 15:77693479-77693501 ATGAAGCTGCAGAGGGAGGCTGG + Intronic
1130347003 15:83056800-83056822 AGGGAGCTGAGGTGGGAGGATGG - Intronic
1130906598 15:88244959-88244981 CTGGGGCTGCAGAGTGGGGAAGG + Intronic
1131868820 15:96740514-96740536 ATGGAGTAGAAGGGTGTGGAAGG - Intergenic
1132091173 15:98949003-98949025 ATGGAGAGGATGAGTAAGGATGG - Intronic
1132249806 15:100326939-100326961 ATGGAGCTGATGAGTAAAGCAGG - Intronic
1133070900 16:3246300-3246322 ATGGAGCTGCAGACTGGGAAGGG - Intronic
1133602374 16:7351965-7351987 TTGGAGCTGAAAAGGAAGGAGGG + Intronic
1133671034 16:8020827-8020849 ATGTAACTGAAGGGTGAGGCAGG + Intergenic
1133765177 16:8832812-8832834 AAGACGCTGAAGAGGGAGGATGG - Intronic
1134090684 16:11390265-11390287 CTGGAGCTGGTGAGTGAGCAAGG - Exonic
1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG + Intronic
1134473064 16:14545081-14545103 AGGAAGCTGAAGTGGGAGGATGG + Intronic
1135937521 16:26793668-26793690 AAGGAGCAGAAGAGGGAGGGAGG - Intergenic
1136060404 16:27722517-27722539 AGGGAACTAAATAGTGAGGAAGG + Intronic
1136238977 16:28932687-28932709 ATGGAGCTGGAGAGAGGGGCTGG + Intronic
1136854048 16:33638920-33638942 TTGGAGCTGAGGTGGGAGGATGG + Intergenic
1139267606 16:65654923-65654945 AAGGACCAGAAGAGAGAGGAGGG + Intergenic
1139428592 16:66898918-66898940 ATGGGGTTGAAGAGTGGGCAGGG - Intergenic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1139532968 16:67552483-67552505 ATGGAACAGAAGCCTGAGGAGGG + Intergenic
1139650933 16:68361739-68361761 AGGGTCCTGGAGAGTGAGGAGGG - Exonic
1139749827 16:69102865-69102887 ATGTTGCTGCTGAGTGAGGACGG + Intergenic
1139831239 16:69800034-69800056 ATGTAGCTTAAGAGAGAGGTGGG + Intronic
1139987267 16:70908954-70908976 ATGGTGCTGCAGGGTCAGGAAGG + Intronic
1140332719 16:74073324-74073346 ATGGAGGGGAAGAGAGGGGAAGG - Intergenic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1141884575 16:86882782-86882804 AGGAAGCTGATGGGTGAGGAGGG - Intergenic
1142207513 16:88791180-88791202 ATGGAGGGGAAGAGAGGGGAGGG + Intergenic
1203115626 16_KI270728v1_random:1487359-1487381 TTGGAGCTGAGGTGAGAGGATGG + Intergenic
1142714781 17:1741535-1741557 GAGGAGCTGGACAGTGAGGATGG + Intergenic
1143197540 17:5087648-5087670 CTGGGCCTGAAGAGAGAGGAGGG + Intronic
1143457637 17:7078181-7078203 AGGGAGCTGTCTAGTGAGGAGGG + Intronic
1143591670 17:7888853-7888875 ATGGAGGTGAAGGGTGAGATCGG + Intronic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1144445730 17:15326356-15326378 ATGAAGCTGAGAAATGAGGAGGG + Intronic
1145279721 17:21458352-21458374 ATGGAACTGGAGAGCGAAGAAGG + Intergenic
1145305660 17:21673717-21673739 ACAGAGCTAAAGAGTGAGAAAGG + Intergenic
1145772279 17:27502100-27502122 ATGGCTCTGAAGAGTGAGCAAGG + Intronic
1146316495 17:31811423-31811445 ATGGAGATGAACAGTGGTGACGG + Intergenic
1146725554 17:35152876-35152898 TCGGAGCTGAGGAGAGAGGAGGG - Exonic
1146955233 17:36933397-36933419 CTGGAACCGAAGAGAGAGGAGGG + Intergenic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1147916205 17:43888422-43888444 ATGGAGCCCCAGAGTGAGGGAGG + Intronic
1148167524 17:45493639-45493661 GGGGAGCTGAAGACTGAGCAAGG + Intergenic
1148358692 17:46994414-46994436 TGGGAGTTGAAGAGTGGGGAGGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1150398705 17:64840052-64840074 GGGGAGCTGAAGACTGAGCAAGG + Intergenic
1150417264 17:64997565-64997587 TTCAAGATGAAGAGTGAGGAGGG - Intergenic
1150420383 17:65028765-65028787 GTGGAGCTGAAGAGTAAAGTAGG - Intronic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1150502676 17:65665996-65666018 ATGCAGATGAACAGTGAGGTAGG - Intronic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1152030545 17:77839612-77839634 ACTGAGCTGAGGAGAGAGGAGGG - Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152092082 17:78252625-78252647 GTGCAGCTGGAGGGTGAGGAAGG + Intergenic
1152728141 17:81957763-81957785 CTGGAGGTGAGGGGTGAGGACGG - Intronic
1153191797 18:2549024-2549046 AGGGATCTGAAGAGTGGTGAGGG - Intronic
1153525666 18:5992421-5992443 ATGAGGCTGGAGAGTGAGGTGGG + Intronic
1154489235 18:14906887-14906909 AGGAAGGTGAAGTGTGAGGAGGG + Intergenic
1155269745 18:24128514-24128536 ATGGAGCTGATGAGGAAGAAAGG - Intronic
1155394035 18:25367714-25367736 CTGGAACTGCAGAGTGAGAAGGG + Intergenic
1155871057 18:31028859-31028881 ATGAGGCTGAAGAGGGAGGTAGG - Intronic
1156195229 18:34767411-34767433 ATGGGGCTGAAGTTTGGGGAAGG + Intronic
1156333356 18:36147176-36147198 AGGAAGTTGAAGCGTGAGGATGG - Intronic
1156469442 18:37368276-37368298 ATGGGGCTGAAGAGGGAGATGGG - Intronic
1157231106 18:45916860-45916882 ATGGAGTTGGGGAGTGAGGAGGG - Intronic
1157971443 18:52274200-52274222 ATGGAGCTCCAGAGAGTGGAAGG - Intergenic
1158112532 18:53956738-53956760 ATGGAGATCAACAGTGAAGAAGG + Intergenic
1158379675 18:56915516-56915538 CTGGATCTGAATAGTGAAGAAGG - Intronic
1158426783 18:57347510-57347532 ATGGAGGTGGAAAGAGAGGACGG - Intergenic
1159960505 18:74551970-74551992 AGGGAGCTCAGGTGTGAGGAAGG - Intronic
1160072835 18:75643446-75643468 CTGGAGCTGAGGGGTGAGGGAGG - Intergenic
1160083730 18:75754465-75754487 CTGGAGCTGAGGGGTGAGGGAGG + Intergenic
1160186777 18:76682045-76682067 CTGGAGCTGGAGAGTGGTGATGG - Intergenic
1160438901 18:78873761-78873783 GTGGGGCTGAAGTGGGAGGATGG + Intergenic
1160705187 19:526252-526274 TTGGAGGTGAAGGGGGAGGAAGG - Intergenic
1161507390 19:4651133-4651155 ATGGAGCTGTGGGGTGAGGGTGG + Intronic
1161659156 19:5535426-5535448 AGGAAGCTGAAGAGTGAGCCTGG + Intergenic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162197182 19:8993997-8994019 ACGGAGCTGATGAGTGACGCCGG + Intergenic
1162305864 19:9873256-9873278 AGGGAGCTGAAATGAGAGGATGG - Intronic
1162472647 19:10881663-10881685 GTGGAGCTGCAGAGAGAGCAGGG + Intronic
1162639094 19:11993714-11993736 ATGGAGATCAAGAGTGAAGAGGG + Intergenic
1164023781 19:21331665-21331687 TTGGAGGTCAAGAGTGTGGACGG - Intergenic
1164081136 19:21862346-21862368 ATGGAGGTGAAGGATGTGGAAGG - Intergenic
1164439217 19:28259285-28259307 ATGCAGATGAACAGTGAGCACGG - Intergenic
1164470898 19:28531098-28531120 ATGAGGCTGAAGTGAGAGGATGG - Intergenic
1164756657 19:30694881-30694903 GTGGAGGGCAAGAGTGAGGAGGG + Intronic
1165877744 19:39021330-39021352 ATGGAGGTGGAGAGGGAGGCAGG - Intronic
1166079618 19:40435423-40435445 GGGGAGCAGAGGAGTGAGGAGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166233039 19:41436805-41436827 AGGGAGCAGAGGAGTGGGGATGG + Intronic
1166512304 19:43417173-43417195 ATGAAGCTGAAAAGACAGGAAGG - Intronic
1166626547 19:44362219-44362241 ATGGAGGAGAAGGGGGAGGAAGG + Intronic
1166656092 19:44613220-44613242 ATGGACCTGGGGAGTGAGAAGGG + Intergenic
1166784102 19:45357538-45357560 ATGCAGCTGGAGAGAGATGAGGG + Exonic
1166824714 19:45601647-45601669 ATAGAGATGAAGAGACAGGAAGG + Intronic
1167794273 19:51699112-51699134 AGGAAGCTGAAGTGGGAGGATGG - Intergenic
1167849549 19:52190962-52190984 AGGGAGCTGAGGGGCGAGGATGG - Intronic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926208230 2:10849132-10849154 CTGGGGCTGAAGAGTAAGGCAGG - Intronic
926309155 2:11662083-11662105 CTGGAGCTGCTGAGTGAGGAGGG - Exonic
926811012 2:16755427-16755449 ATGGAGCTGCAGAGAGAGGTGGG + Intergenic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
928383091 2:30838087-30838109 CTGGAGATGAACAGTGATGATGG + Intergenic
930919608 2:56736415-56736437 ATGAAGCTGGAGAGAGAGGATGG - Intergenic
932120022 2:69090220-69090242 ATAGAGCTGGAGAGATAGGACGG - Intronic
932460824 2:71880872-71880894 TGGGTGCTGAAGAGTGGGGATGG - Intergenic
932620045 2:73259821-73259843 ATGTGGCTGAAGGGGGAGGAAGG + Intronic
932659964 2:73643247-73643269 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
932666532 2:73702906-73702928 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
932768835 2:74489306-74489328 AAGAAGCTCAAGAGTTAGGAGGG + Intronic
932773174 2:74513097-74513119 ATGGAGCTGAACAGCGGGGTGGG + Intergenic
934773155 2:96920874-96920896 GAGGAGCTGAAGACTGGGGAGGG + Intronic
935574213 2:104692207-104692229 ATGGAGATGAATAGTGGTGATGG - Intergenic
935648118 2:105358535-105358557 ATGAAGCTGGGGAGTGGGGATGG + Intronic
935662485 2:105479142-105479164 ATGGAGTTTAAGACTTAGGAAGG + Intergenic
935807073 2:106759847-106759869 AGGGAGCTGAGGTGGGAGGATGG - Intergenic
936039750 2:109141236-109141258 ACAGAGGGGAAGAGTGAGGAAGG - Intronic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937495441 2:122414263-122414285 TTGTAGCTGAAGACTGAGGGAGG + Intergenic
938197364 2:129340385-129340407 ATGGAGCTGAAGTGTGAAGCTGG - Intergenic
939251303 2:139684607-139684629 ATAGAGCTGGAGCCTGAGGAGGG + Intergenic
939955529 2:148525105-148525127 AAGTAGCTGGAGAGTGAGGCAGG + Intergenic
940254539 2:151714830-151714852 ATGCATCTTGAGAGTGAGGAGGG + Intronic
940722954 2:157301610-157301632 ATGAAGGTGAAGAGGAAGGAAGG + Intronic
940847579 2:158658836-158658858 ATGGAGCTGATGAGTGTTAAGGG - Intronic
941865849 2:170333557-170333579 TTGGATCTGAAGAGAGAGCAGGG - Intronic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942943476 2:181647114-181647136 ATGAAGCTGAAGAGATGGGATGG + Intronic
943259451 2:185640248-185640270 AAGAAGCTGAAGTGGGAGGATGG + Intergenic
944459575 2:199932586-199932608 ATGCAGCGGAAGAGTCAGGCTGG - Exonic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
946036276 2:216744925-216744947 TGGGAGCTAGAGAGTGAGGAAGG + Intergenic
947024105 2:225717042-225717064 ATGAAGCTGAACAGTGATGGAGG + Intergenic
947030044 2:225782988-225783010 AGGAAGGTGAAGAGGGAGGAGGG - Intergenic
947513981 2:230785268-230785290 ATTGGGCTGAAGAGTGAGTGAGG + Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948552847 2:238786192-238786214 CTGGAGCTGAATAGTGGTGACGG - Intergenic
948862410 2:240759068-240759090 ACAGGGCAGAAGAGTGAGGAGGG + Intronic
949071177 2:242025201-242025223 GTGGAGCTGGAGACTGAGGGAGG + Intergenic
1169275908 20:4233699-4233721 AGGGGGCAGAAGAGTGATGATGG - Intronic
1169355488 20:4901537-4901559 AGGGTGCTGAAGACAGAGGAGGG + Intronic
1169867632 20:10218273-10218295 ATGGAGCTGGCGAGGGTGGACGG + Intergenic
1169872165 20:10259641-10259663 GGGGAGCTGAAGTGGGAGGATGG - Intronic
1170230156 20:14037665-14037687 ATGGAGCTAAGGATTGATGAAGG + Intronic
1170638490 20:18130325-18130347 ATGGAGATGAATAGTGATGCTGG + Intergenic
1170829679 20:19829442-19829464 AGAGAGCTCTAGAGTGAGGAGGG + Intergenic
1171406379 20:24914858-24914880 AGGGAGCTGAGGCCTGAGGATGG - Intergenic
1171406392 20:24914899-24914921 AGGGAGCTGAGGCCTGAGGACGG - Intergenic
1171986464 20:31664816-31664838 GTGGAGCAGAAGAGAGAGGGAGG + Exonic
1172214492 20:33225434-33225456 ATGGGCTTGAGGAGTGAGGAGGG - Intronic
1172356155 20:34281412-34281434 CTTGAGTTGAAGAATGAGGAAGG - Intronic
1172692933 20:36803085-36803107 ATGGAGCTGAAGACAGGGAAGGG - Exonic
1173531868 20:43775938-43775960 ATGTATGTGATGAGTGAGGAAGG - Intergenic
1173663286 20:44748854-44748876 ATGGGGGTGAGGAGTGGGGATGG - Intronic
1173845635 20:46186700-46186722 GATGAGCTGAAGGGTGAGGAGGG + Exonic
1174061240 20:47834413-47834435 ATGGAGCTGCAGACTCAGGGAGG - Intergenic
1174070268 20:47894764-47894786 GTGGAGCTGCAGACTGAGGCAGG + Intergenic
1174070536 20:47896286-47896308 ATGGAGCTGCAGACTCAGGGAGG + Intergenic
1174100577 20:48123536-48123558 ATGGAGCTGGAGACTCAGGGAGG - Intergenic
1174149387 20:48475476-48475498 ATGGAGCTGGAGACTCAGGAAGG - Intergenic
1174306677 20:49618375-49618397 AAGGAGGTCAAGGGTGAGGACGG - Intergenic
1175090049 20:56495225-56495247 ATTAAGCGGAAAAGTGAGGAAGG - Exonic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1176049015 20:63106846-63106868 AGCGAGCTGCAGTGTGAGGATGG + Intergenic
1176156573 20:63625159-63625181 AAGGAGCTGTGGAGAGAGGAGGG - Intronic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1179137541 21:38693413-38693435 ATGGAGATGAAGAGGATGGATGG - Intergenic
1179448436 21:41450369-41450391 AGGCAGCTGAAGTGTGAGTAAGG - Intronic
1179548081 21:42125517-42125539 GAGGGGCTGAAGGGTGAGGAAGG - Intronic
1179839246 21:44060052-44060074 AGGGAGATGAAGTGTGGGGACGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180130405 21:45823346-45823368 CTGGAGCTGCACAGTGTGGAAGG - Intronic
1180231749 21:46430550-46430572 CAGGAGCTGGAGAGTGAGCAGGG + Exonic
1180593163 22:16957557-16957579 ATGGAATGGAAGAGAGAGGAAGG + Intergenic
1181235252 22:21444647-21444669 ATGGAGGTGGAGGGTGATGAGGG - Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1183495351 22:38140164-38140186 AAGGAGCTGATGAAAGAGGAAGG + Exonic
1184379834 22:44138360-44138382 ATGGCCCTGAGCAGTGAGGAAGG + Intronic
1184558189 22:45244975-45244997 CTGGCACTGAAGAGGGAGGAAGG + Intergenic
1185139157 22:49090626-49090648 AAGGTGCTGCAGAGTGAGGCTGG + Intergenic
1185142133 22:49108434-49108456 CTGGATCTGGGGAGTGAGGATGG - Intergenic
949107211 3:214203-214225 ACGCAGCTGAAAAGTAAGGAAGG - Intronic
949405622 3:3711328-3711350 TTGGATGTGAGGAGTGAGGAAGG - Intronic
949892064 3:8740674-8740696 CTGGAGCTGAAAAGAGAGGCTGG + Intronic
950694857 3:14690960-14690982 ATGGAGGTGAGGGCTGAGGAAGG - Intronic
950842492 3:15980733-15980755 CTGGAGATGAATAGTGATGATGG + Intergenic
951623438 3:24632877-24632899 ATGAAGCTGAGGTGGGAGGATGG - Intergenic
952965419 3:38618110-38618132 ATCGACCTGAAGAGTGGGGAAGG - Intronic
953206277 3:40832784-40832806 ATGGAGCAGAGGAGAGAGAAGGG - Intergenic
953367096 3:42354216-42354238 ATGGAGCCAGAGAGTGGGGATGG - Intergenic
953490930 3:43349916-43349938 TCGGGGCTGAAGAGTGGGGAAGG - Exonic
953728956 3:45428606-45428628 CTGGAGATGAAGAGTGATAATGG - Intronic
954092922 3:48299931-48299953 GTGGATATGAAGAGTGAGGGAGG - Intronic
954585158 3:51728267-51728289 AGGGAGCAGAAAAGAGAGGAGGG + Intergenic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
955162483 3:56478111-56478133 TTGGGGCTGAAGAGAGAAGAAGG + Intergenic
955231406 3:57102163-57102185 AGGGGGCTGAAGTGGGAGGATGG + Intronic
955479211 3:59372309-59372331 ATTGAGCTGAAGAGAGAAGAGGG - Intergenic
955517429 3:59741316-59741338 GTGGGGCTGAAGCGGGAGGATGG - Intergenic
955580253 3:60412133-60412155 AGGAAGCTGAAGCATGAGGATGG + Intronic
955581178 3:60424674-60424696 ATGTAGCTGAAGAGTCAGCAGGG + Intronic
956361431 3:68452103-68452125 ATGATGGTGAAGAGTAAGGAAGG + Intronic
957001803 3:74895209-74895231 ATGTGGCTGAGCAGTGAGGAGGG - Intergenic
958129190 3:89395820-89395842 ATGGAGCTGTAAAGAGAGGATGG - Exonic
958513869 3:95086881-95086903 ATGGAGGTGAAGTGGGAGGAAGG - Intergenic
958644712 3:96855082-96855104 CTGGCTCTGAAGAGAGAGGAAGG - Intronic
958915185 3:100041973-100041995 ATATAGCTGAAGAAAGAGGAAGG - Intronic
960446508 3:117756077-117756099 TTTGAGCTGAAGAGGAAGGATGG - Intergenic
961003843 3:123391480-123391502 CTGGGGCTGAAGACTGAGGGCGG + Intronic
961561332 3:127732478-127732500 AGGGGACTGAAGATTGAGGAGGG + Intronic
961589412 3:127964977-127964999 AGGGAGCTGAGGAGCCAGGAGGG + Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961955932 3:130804141-130804163 ATGGGGCTGAAGAGTTAAGATGG - Intergenic
962436144 3:135368571-135368593 AAGGACTTGAAGAGAGAGGAAGG + Intergenic
962464914 3:135649188-135649210 AGGAAGCTGCAGTGTGAGGAAGG + Intergenic
962518230 3:136173498-136173520 ATGGAGGTGAAGAGTCTGGGTGG - Intronic
962815696 3:138996143-138996165 ATAAAGCTGAAGAGGAAGGAGGG - Intergenic
962832746 3:139158678-139158700 ATGCAGCTGGAGGGTGAGGTTGG + Intronic
962886639 3:139633774-139633796 ATGAAGCTGCAGAGAGTGGAAGG + Intronic
963132930 3:141875640-141875662 ATGGAGCTGACGAGTACGGGAGG - Intergenic
964162470 3:153662109-153662131 ATGGAGCTACAGAGTGGGAATGG - Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965951098 3:174309077-174309099 ATAGAGCAGAAGTGTGAAGATGG + Intergenic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966713119 3:182989540-182989562 TGGGAGCTGAGGAGAGAGGAAGG + Intergenic
968049677 3:195645814-195645836 ATGCAGCTGAAGACTCAGGGAGG + Intergenic
968097621 3:195942774-195942796 ATGCAGCTGAAGACTCAGGGAGG - Intergenic
968304458 3:197640168-197640190 ATGCAGCTGAAGACTCAGGGAGG - Intergenic
968304565 3:197641110-197641132 ATGGAGCTGGAGACTCAGGCAGG - Intergenic
968761514 4:2444668-2444690 ATGGAGCTGTGGAGTCAGGTGGG - Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
968906063 4:3451293-3451315 ATTGAGCTGAAGTGTGAGCTGGG + Intergenic
968949976 4:3685465-3685487 AGGCAGCTGGAGAGTGAGGCTGG + Intergenic
969520244 4:7673997-7674019 ATGGCGCTGAGCAGGGAGGAAGG + Intronic
969659323 4:8517395-8517417 AGGGAGCAGAAGAGGGAGGGGGG + Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970249602 4:14100316-14100338 ATGGAGACAAAGAGTGAGCAAGG + Intergenic
970297908 4:14650963-14650985 AAGCAGCTGAAGAGTTTGGATGG + Intergenic
971213256 4:24640181-24640203 AGAGAGCTGAAGGGTGTGGAGGG - Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972629711 4:40832761-40832783 ATGGAGCTGCAGAGTGTTGAGGG - Intronic
972651273 4:41019945-41019967 AAGGAGTCGAAGAGAGAGGAGGG + Intronic
972698409 4:41470149-41470171 AAAAAGGTGAAGAGTGAGGATGG - Intronic
972753284 4:42014915-42014937 TGGGAGGTGGAGAGTGAGGATGG + Intronic
973598713 4:52519661-52519683 ATGGGACTGAAGTGGGAGGAAGG + Intergenic
974439590 4:61899088-61899110 ATGGAGCTGCAGAGGTAGAAAGG - Intronic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
975477925 4:74844316-74844338 GTGGGGGTGAAGGGTGAGGACGG - Intergenic
975698679 4:77040643-77040665 ATGGAGCTGAAAAGTAAAGATGG - Intergenic
978214059 4:106176303-106176325 ATGGGGATGAAGAGAGAGGTTGG - Intronic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
979040519 4:115786530-115786552 ATGGAGATGGATAGTGATGATGG - Intergenic
979814702 4:125086431-125086453 AAGGAGGTGGAGAGAGAGGAGGG - Intergenic
979814999 4:125089371-125089393 ATGTAGCTGAAGAGTAAAGCAGG + Intergenic
981276266 4:142901131-142901153 TTGAACCTGAAGAGTCAGGATGG - Intergenic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
981800441 4:148649021-148649043 AAGGAGCTGAAGGGGGAGGGAGG + Intergenic
982232458 4:153221930-153221952 AAGGAACGAAAGAGTGAGGAAGG + Intronic
982254751 4:153440936-153440958 AGGACGCTGAACAGTGAGGATGG - Intergenic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
984044084 4:174776005-174776027 AAGGAGGTGGAGAGTGAGAAGGG + Intronic
984045537 4:174792942-174792964 ACGGAGCTGAAGAGAGGGGGTGG + Intronic
984174810 4:176404051-176404073 ATGGGGCTGAAGAATGGGGCAGG + Intergenic
984460356 4:180028617-180028639 ATAGAGCTGAAAGGAGAGGATGG + Intergenic
984517903 4:180764266-180764288 ATGAAGTTGAAAAGAGAGGAAGG - Intergenic
984775754 4:183480466-183480488 GGGAAGCTGAAGAGGGAGGATGG + Intergenic
985506410 5:283911-283933 ATGCAGCTGAAGAGCCAGGGAGG + Intronic
986088934 5:4482593-4482615 ATGGAGGGGAACAGTCAGGAAGG + Intergenic
987373907 5:17217445-17217467 ATGGAGCTGGAGGGGGTGGAGGG + Intronic
988921662 5:35947901-35947923 AGGAAGCTGAAGCATGAGGATGG + Intergenic
989185526 5:38621635-38621657 ATGGAGCTGAGATATGAGGAAGG - Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
990252903 5:53935038-53935060 ATGGAACTGAAGAGTCAACAGGG + Intronic
990836439 5:60026835-60026857 ATGAAATTGAAGAGTGAGCACGG - Intronic
991013063 5:61903891-61903913 AGGAAGCTGAAGTGGGAGGATGG - Intergenic
991047828 5:62241262-62241284 TTGGAGCTGAGGTGGGAGGATGG - Intergenic
991258418 5:64640544-64640566 AGGAAGCTGAAGAGGGAGGATGG + Intergenic
992645382 5:78806927-78806949 AGGGAGCGGAAGAGTAAGCATGG - Intronic
994283384 5:97933838-97933860 ATGTTGCTTAAAAGTGAGGATGG - Intergenic
994891944 5:105647520-105647542 ATGGAACTGAGGAGTGAGCTGGG + Intergenic
995337987 5:111024551-111024573 ATGGGGCAGAAGAGAAAGGAAGG - Intergenic
995897349 5:117030251-117030273 ATGTGGCTGGAGTGTGAGGAGGG + Intergenic
995919027 5:117288381-117288403 ATGAAGCTGAAAAGTCATGAAGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996571900 5:124940646-124940668 AGGGAGCTGGAGAGTGTTGATGG + Intergenic
997033818 5:130162755-130162777 TTGGAGCAGAACTGTGAGGAAGG + Intronic
997457372 5:134027268-134027290 ATGGGGCGGGAGAGGGAGGAGGG - Intergenic
997612745 5:135226593-135226615 ATGCACCTGAAGAGAGGGGAAGG - Intronic
997646996 5:135488383-135488405 ATGGGGGTGAGGTGTGAGGAAGG + Intergenic
997817433 5:137032843-137032865 ATGGACTTGAAGGCTGAGGATGG + Intronic
997822874 5:137081892-137081914 ATGGAGCTGAGGTGTGAAAATGG + Intronic
998354795 5:141526021-141526043 ATGCAGGTGAGGAGTGAAGACGG - Exonic
998822616 5:146070304-146070326 ATGGGGCTGGAGATGGAGGAGGG + Intronic
999213010 5:149906584-149906606 ATGAGGCTCAAGAGGGAGGAAGG - Intronic
999279437 5:150355413-150355435 GTGGAGTTGAAGAGAGTGGAAGG - Intergenic
999647357 5:153731379-153731401 TTGGAGCTGAATTGTGAAGAAGG - Intronic
999968545 5:156835622-156835644 ATGGAGTTGAAGAGGGAGAATGG - Intergenic
999974210 5:156894759-156894781 AAGGAGCTGAAGTGTTGGGAGGG - Intergenic
1000190274 5:158903699-158903721 ATTGAGTTGAAGAGTCAAGAAGG + Intronic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1000918135 5:167106747-167106769 ATAGAGGTGAAGAGGGTGGAGGG + Intergenic
1001465020 5:171956582-171956604 ATGGAGCTGGGGAGCCAGGAAGG - Intronic
1001570158 5:172725558-172725580 ATGGAGCTGGACAGAGGGGATGG + Intergenic
1002211637 5:177602827-177602849 AAGGAACAGATGAGTGAGGAAGG + Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003513904 6:6802999-6803021 CGGGATCTGAAGGGTGAGGAAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003560500 6:7176020-7176042 CTGGAGCTGAGGTGGGAGGATGG - Intronic
1003667531 6:8125658-8125680 AAGGGGGTGAAGTGTGAGGATGG - Intergenic
1005149407 6:22731678-22731700 ATGGTTCTGAAGAATGATGAAGG + Intergenic
1005280691 6:24270644-24270666 AGGGAGTTGAAGAGGGAGAAAGG + Intronic
1006021850 6:31121990-31122012 AGGGAGCTGTGGAGAGAGGAAGG + Intronic
1006101019 6:31686497-31686519 ATCTTGGTGAAGAGTGAGGAAGG - Intergenic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1006800263 6:36755266-36755288 ATGGGCCTCTAGAGTGAGGAAGG + Intronic
1007023333 6:38544618-38544640 ATGCGGTTGAAGAGTGATGAGGG + Intronic
1007245917 6:40462499-40462521 AGGGAGCGAAAGAGTGAGGTAGG - Intronic
1007634808 6:43292961-43292983 GTGGAAGAGAAGAGTGAGGAGGG + Intergenic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1008584324 6:52935169-52935191 ATGGAGCTACAGGGTTAGGAGGG + Intergenic
1009004412 6:57765185-57765207 AAGAAGATGAAGAGTGATGATGG + Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009549166 6:65064897-65064919 AAGGAGCTGAATAGTCAGGATGG + Intronic
1009737756 6:67700271-67700293 ATGTAGCTGACTAGTGAAGAAGG - Intergenic
1010153332 6:72762298-72762320 AGGGAGGTGAAAAGGGAGGAGGG + Intronic
1010577835 6:77554651-77554673 ATGGATCTAAAGAGTAAGAATGG - Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1012075906 6:94685607-94685629 ATGGAACAGAAAACTGAGGAAGG - Intergenic
1012476987 6:99624518-99624540 ATGGAGATGAACACAGAGGAAGG + Intergenic
1012570750 6:100724773-100724795 AGGGTGATGAAGAGTGAGAAAGG + Intronic
1013049091 6:106514215-106514237 AGGGAGCAGAAGTGTGAGAAGGG - Intronic
1013115734 6:107102492-107102514 ATGCAGCTGAGGTGGGAGGAAGG + Intronic
1013147275 6:107406350-107406372 AGTGAGCTGTAGAGTAAGGAAGG - Intronic
1013394638 6:109722929-109722951 TGGGAGCTGGAGAGAGAGGAAGG + Intronic
1013464529 6:110406186-110406208 TTGGAGCTCAAGAGAGAGAATGG - Intronic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014706902 6:124758808-124758830 ATGTAGCTGGAGAGAGAGGTTGG - Intronic
1014926462 6:127276818-127276840 AAGGAACTGAAAATTGAGGATGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015715188 6:136185123-136185145 CTGGAGTTGAAGAGTTAGGGTGG + Intronic
1016126569 6:140411284-140411306 ATGTGGCTGAAGAGTGAAGGAGG + Intergenic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1016991635 6:149933764-149933786 ATGGAGAGGAAGAGTGGGAAGGG + Intergenic
1017009836 6:150055783-150055805 GTGGAGCTGAAGACTCAGGGAGG - Intergenic
1017360606 6:153564782-153564804 CTGGCACTGAAGACTGAGGAAGG + Intergenic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1019138813 6:169930006-169930028 GTGGAGGTCAACAGTGAGGATGG + Intergenic
1020678845 7:11211877-11211899 ATGGAACTGAGAAGTGTGGAAGG - Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021788768 7:24178888-24178910 AGGGAGCTGAGGAGTAAAGAGGG - Intergenic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1021973290 7:25985535-25985557 ATAAAGGTGAAGAGTGAGGCTGG - Intergenic
1022150008 7:27592885-27592907 ATGAGGCTGAAGAGAGAGGTTGG - Intronic
1022440698 7:30430612-30430634 CTGTAGCTGAACAGTGGGGAGGG - Intronic
1022471784 7:30686059-30686081 ATGAAGCAGGAGGGTGAGGATGG - Intronic
1023331284 7:39119628-39119650 GGGGAACTAAAGAGTGAGGAAGG + Intronic
1025233635 7:57219245-57219267 ATGGAGCTGGAGACCCAGGAAGG - Intergenic
1025629538 7:63257292-63257314 ATGGAGTAGAAGAGTAAGGTTGG + Intergenic
1025652731 7:63486746-63486768 ATGGAGTAGAAGAGTAAGGTTGG - Intergenic
1025969746 7:66311241-66311263 AGGGAGCTGAGGTGGGAGGATGG - Intronic
1026222778 7:68415115-68415137 GTGGGGCTTAAGAGAGAGGAGGG - Intergenic
1027761462 7:82284625-82284647 GAGGAGCTGAAGAGCAAGGAAGG + Intronic
1028634312 7:92970403-92970425 AAGGTGATGAAGAGTCAGGAGGG + Intergenic
1028714951 7:93955138-93955160 TTGGATGTGAAGAGTAAGGAAGG - Intergenic
1028723165 7:94057457-94057479 ATGGTGCTGAAGAGAGAGAATGG + Intergenic
1029082233 7:97983816-97983838 AGGAAGCTGAAGTGGGAGGATGG + Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031854732 7:126908120-126908142 CTGGAGCTAAAGAGAGAGAAGGG + Intronic
1032382336 7:131498062-131498084 GTGAAGCTGTAGAGTAAGGATGG - Intergenic
1032520008 7:132536666-132536688 AAGGAGCTGCAGAGAGAGGCTGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1033052657 7:138020590-138020612 ATGGAGCTGAAGTTGGAGGATGG - Intronic
1034455028 7:151165382-151165404 GATGAGCTGAAGAGAGAGGATGG - Intronic
1035087759 7:156275828-156275850 ACAGACCTGAAGAATGAGGAGGG - Intergenic
1035214931 7:157358461-157358483 ATGGGTCTGGAGAGGGAGGAAGG - Intronic
1035277222 7:157754800-157754822 CTGGAGCTGCAGAGAAAGGAAGG + Intronic
1035744210 8:1950119-1950141 ATGCAGCTGCACAGTGAGGTTGG - Intronic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1037837964 8:22225378-22225400 AGGAAGCTGAGGAGGGAGGATGG + Intronic
1038075722 8:24071392-24071414 ATGGACCTTAACAGTGATGATGG + Intergenic
1038401469 8:27287722-27287744 GTGGAGCTGGAGTGTGAGGAGGG - Exonic
1039362165 8:36888455-36888477 ATGGGGCTGAAGGGAGATGAAGG - Intronic
1042929900 8:74002862-74002884 ATGGAGCTGAAGGCTGGGCACGG - Intronic
1043059523 8:75482358-75482380 ATGGAGCAGAAGGGAGGGGAGGG - Intronic
1044428572 8:92082698-92082720 ATGGTACTGAACAGTGAGGTAGG - Intronic
1045092500 8:98760785-98760807 AGGGAGCTGTAAAGTGAAGATGG - Intronic
1045917181 8:107486071-107486093 ATGGAGCTTTAGAGTGTGGATGG + Intronic
1046527903 8:115404861-115404883 TTGGAGCTGAAGAGGGAGTTGGG - Intergenic
1047971194 8:130086096-130086118 ATGAAGCTGAAGTGTGGAGAAGG - Intronic
1048165633 8:132059178-132059200 ATGGAGGAAAAGAGTGAGGGAGG - Intronic
1048243056 8:132763502-132763524 ATGGAGGTGATGCGTGTGGATGG + Intergenic
1048262850 8:132960387-132960409 AAGGAACTGAAGACTGAGCAGGG + Intronic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048488272 8:134868445-134868467 ATGGAGCTAAAGAATGAGTGTGG + Intergenic
1048741256 8:137563414-137563436 ATGGAGCTGAAAAGCAAGGCTGG - Intergenic
1049276397 8:141722183-141722205 ATGGTGCTGAAGTGTGTGGCCGG + Intergenic
1049958778 9:718415-718437 GGGAAGCTGAAGAGGGAGGATGG - Intronic
1050195108 9:3074704-3074726 ATGCAGCTGAGGAGTAATGAGGG - Intergenic
1050312435 9:4367206-4367228 ATGAAGCTGGAGAGTGGGCAGGG - Intergenic
1050436431 9:5615334-5615356 CTGGGGCTGAAGAGTAAGGGCGG - Intergenic
1051106583 9:13587667-13587689 ATGGAGCAGAAGGGGGTGGATGG - Intergenic
1051406462 9:16742983-16743005 ATGGACCTCATGAGTGAGAAAGG + Intronic
1051496864 9:17733031-17733053 CTTGTGCTGAAGAGTGGGGAAGG - Intronic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052594524 9:30540620-30540642 ATGGAGCTGAAAACTAAGGCTGG + Intergenic
1053153563 9:35757554-35757576 AGGGACCTGAGGAGGGAGGAGGG + Exonic
1055518138 9:77053765-77053787 ATGGAGATGGAGAGGGAGTAGGG - Intergenic
1055577257 9:77672281-77672303 ATGGAGCCGAATACTGAGAATGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1058668922 9:107344262-107344284 CTGGGACTGAGGAGTGAGGAAGG + Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059252836 9:112902636-112902658 ATGAGGCTGAAGAGTTAGGGAGG - Intergenic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1059999210 9:119943267-119943289 CTGCAGCTGAAAGGTGAGGATGG + Intergenic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061208068 9:129175784-129175806 ATCGAGCTGAAGACACAGGACGG + Exonic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061366337 9:130173879-130173901 ATGGAGCTGAAGCGTGGGCTTGG - Intronic
1185696848 X:2201371-2201393 TTGGAACTCAAGAGTGATGATGG - Intergenic
1186224160 X:7379326-7379348 ATTGAGGTGGAGAGTGGGGAGGG + Intergenic
1186435026 X:9535348-9535370 ATGGAGGTGAAGAGTGTGTGTGG + Intronic
1186446812 X:9636941-9636963 ATAGAGCTGAAGAGTTACAAAGG - Intronic
1186698622 X:12065526-12065548 ATGGAAGTGGAGAGGGAGGAAGG - Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1186977142 X:14919655-14919677 ACTGAGCTGAAGAGGGAAGAGGG - Exonic
1187521917 X:20021501-20021523 TGGGAGGTGAGGAGTGAGGAAGG - Intronic
1189175616 X:38954389-38954411 ATGGAACGGTAGAGAGAGGAGGG - Intergenic
1190300590 X:49054774-49054796 ATGGAGGTCAAGAGGCAGGATGG - Intronic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192182391 X:68924353-68924375 GTGGAGCTGGAGAGAGAAGAGGG - Intergenic
1192318785 X:70072215-70072237 AAGAAGCTGAAGAGGGAGGCAGG + Intergenic
1192333631 X:70199928-70199950 ATGGAGCTGAGTAGGGAGCAAGG - Intronic
1195888127 X:109662780-109662802 GGAGAGGTGAAGAGTGAGGAAGG + Intronic
1195952316 X:110287948-110287970 AAGCTCCTGAAGAGTGAGGATGG - Intronic
1196302914 X:114066946-114066968 CTGGCGTTGAAGAGGGAGGAAGG + Intergenic
1196338045 X:114562174-114562196 ATGGAGATGAATATTGGGGATGG + Intergenic
1197705044 X:129628882-129628904 AGGAGGATGAAGAGTGAGGAGGG + Intergenic
1197871468 X:131066336-131066358 ATGGAGGTGAAGAATCAGGGTGG - Intronic
1198738738 X:139817469-139817491 ATGGGGCTGGAGAGGGAGGCAGG + Intronic
1198741552 X:139848426-139848448 ATGGAGCTGAAAAATGAGAGAGG - Intronic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199684597 X:150255017-150255039 CTCCAGCTGAAGAATGAGGATGG + Intergenic
1199839840 X:151633609-151633631 ATGTAGCTGAAGATGGAGTATGG - Intronic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1201116570 Y:10839722-10839744 ATGGAGTTGAAGGGAGTGGAGGG - Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic