ID: 948234363

View in Genome Browser
Species Human (GRCh38)
Location 2:236376843-236376865
Sequence AGGTTTTTAACCTACTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948234363_948234365 -5 Left 948234363 2:236376843-236376865 CCTTGCTAGTAGGTTAAAAACCT 0: 1
1: 0
2: 0
3: 6
4: 97
Right 948234365 2:236376861-236376883 AACCTGCTTCTATTACGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 62
948234363_948234364 -6 Left 948234363 2:236376843-236376865 CCTTGCTAGTAGGTTAAAAACCT 0: 1
1: 0
2: 0
3: 6
4: 97
Right 948234364 2:236376860-236376882 AAACCTGCTTCTATTACGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
948234363_948234366 -4 Left 948234363 2:236376843-236376865 CCTTGCTAGTAGGTTAAAAACCT 0: 1
1: 0
2: 0
3: 6
4: 97
Right 948234366 2:236376862-236376884 ACCTGCTTCTATTACGTTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948234363 Original CRISPR AGGTTTTTAACCTACTAGCA AGG (reversed) Intronic
903840706 1:26237255-26237277 AGGTTTTTAATATATTGGCAAGG + Intronic
909379706 1:74984563-74984585 AGGTTCTTAACCAAATAGGAAGG - Intergenic
911687033 1:100789476-100789498 AGGTTTTAAAACAAGTAGCAAGG - Intergenic
911818029 1:102379317-102379339 AGGTTTTTAGAGAACTAGCATGG - Intergenic
912574438 1:110652917-110652939 AGGATCCTAACCTACTAGCTTGG + Intergenic
914772127 1:150697077-150697099 AAGTTTTTCACCTACTAGGACGG - Intronic
915494714 1:156273644-156273666 ACATTTTGAACCTACCAGCAAGG - Intronic
916550273 1:165843448-165843470 AGGCTTTTAACTTACTAAAAAGG + Intronic
919033251 1:192272802-192272824 AGGTTTTAAATCTGCTGGCAGGG + Intergenic
922652747 1:227355315-227355337 AGGAGTTTCACATACTAGCAAGG - Intergenic
924115319 1:240739588-240739610 AGCTTTTTAACTTATTAGCTAGG + Intergenic
1066161804 10:32741170-32741192 ATGTTTTTAATCTACTACCTAGG - Intronic
1068102245 10:52569861-52569883 AGGTTCTTAACCTTGTGGCAGGG + Intergenic
1068255569 10:54505355-54505377 GGGTTTTTAACTTAGGAGCATGG - Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1071090939 10:81917536-81917558 AGGGTTTTTACCTACTCTCAAGG - Intronic
1078325397 11:10376474-10376496 AGGTTTATAACTCACTAGTATGG + Intronic
1084879668 11:72161733-72161755 CGGTTTTATACCTACTAGAATGG + Intergenic
1085184845 11:74566803-74566825 TGGTTTTTAATCAACTAGCTTGG + Intronic
1085184846 11:74566859-74566881 TGGTTTTTAATCAACTAGCTTGG - Intronic
1093904129 12:24669670-24669692 AGGTTTGTAGCCTAGGAGCAAGG + Intergenic
1094363612 12:29656853-29656875 AGTTTTTTTTCCTACCAGCAGGG + Intronic
1100549511 12:95634144-95634166 TCGTTTTTAACCTCCTAGCCAGG - Intergenic
1108383944 13:49880620-49880642 AGGTTCTTAGCTTCCTAGCAAGG - Intergenic
1111474960 13:88733275-88733297 TGCTTTTTAAATTACTAGCATGG - Intergenic
1112905434 13:104413744-104413766 AAGTTTTAAACCTACTTTCAGGG - Intergenic
1117879858 14:60302713-60302735 TGGTTTTCAACCTGCCAGCAAGG + Intergenic
1118346042 14:64941706-64941728 ATGATTTTAACGTACAAGCAGGG - Intronic
1119995271 14:79246744-79246766 AAGTTTTTAACCTTGTTGCAGGG - Intronic
1128615205 15:69103507-69103529 AGATTCTTAACCTACTGGTATGG - Intergenic
1133643467 16:7740539-7740561 AGGTTTTTAAACTCATATCATGG - Intergenic
1135252235 16:20910498-20910520 AGGGTATTAACCTAATTGCAGGG + Intronic
1137548960 16:49423701-49423723 AGGTCTTTATCCTAAGAGCAAGG - Intergenic
1139216910 16:65134872-65134894 AGGTATTTCACCTAAGAGCATGG - Intergenic
1140883297 16:79218950-79218972 AGGTATTTACCCCACTAGCCAGG + Intergenic
1144114521 17:12074463-12074485 AGGATTTTACCTTACTAGTAAGG - Intronic
1147329882 17:39691831-39691853 AGATTTGTAATGTACTAGCATGG + Intronic
1154248440 18:12720985-12721007 AGGTTTTTACCATATTAGCCAGG - Intronic
1156484902 18:37458472-37458494 AGGTATTTCACCTCCTGGCATGG + Intronic
1159235274 18:65663537-65663559 AGATTTTTAACCAAGAAGCAGGG + Intergenic
930123683 2:47780394-47780416 AAATTTTTAAAATACTAGCAGGG + Intronic
933074643 2:77907625-77907647 AGGTTTTGATCTTACTACCATGG + Intergenic
933172751 2:79141650-79141672 AGATTTTTACCCTACTTGCAAGG + Intergenic
933223170 2:79714831-79714853 AGGATGTTAATCAACTAGCATGG + Intronic
940622189 2:156125922-156125944 AGGTTCTTATCCAAGTAGCAGGG - Intergenic
940995944 2:160149683-160149705 AGGTTTTTAGCTTCCTTGCAAGG - Intronic
941275958 2:163491034-163491056 AGGTTTTTGACCCAATACCAAGG + Intergenic
941336884 2:164256546-164256568 AGGTATTGAACGAACTAGCAAGG + Intergenic
941348042 2:164394404-164394426 AGGTTTTTACCATATTAGCCAGG + Intergenic
942589837 2:177530954-177530976 AGGTTTTTAACTTCCTGACAAGG - Intronic
946545480 2:220737387-220737409 AGATTTGAAACCTACTAGCTGGG - Intergenic
948234363 2:236376843-236376865 AGGTTTTTAACCTACTAGCAAGG - Intronic
1170240171 20:14156431-14156453 ATGTTATTAAGCTACTAGCCTGG - Intronic
1170618114 20:17970456-17970478 GTTTTTTTAACTTACTAGCAAGG + Intronic
1171221976 20:23406381-23406403 AGGTTTTTAGCCTATTCACAGGG - Intronic
1171997068 20:31739644-31739666 ATGTTTATAACCTGTTAGCATGG - Intronic
1172061794 20:32191399-32191421 AGGGTTTTAACCTACTGGGGTGG + Intergenic
1173618293 20:44417156-44417178 AGGATTTTAACCTTCTAGTTTGG + Intronic
1178505494 21:33159379-33159401 AAGTTTTTAAACTACTGGCTTGG + Intergenic
1179222460 21:39420877-39420899 AAGTTTTTAACATACTAACTTGG - Intronic
1179485783 21:41709899-41709921 ATGTTTTTAAACTATTAGCCGGG + Intergenic
1179534555 21:42043096-42043118 AGGTTTTTAAATTGATAGCAGGG + Intergenic
1182057880 22:27374271-27374293 AGGTTTTTAGCTTCCTTGCATGG - Intergenic
1182313381 22:29425464-29425486 AGGTTTTTAATTTCCTTGCAAGG - Intergenic
1184971566 22:48025790-48025812 AGGCTCTTTACCTACTACCAGGG + Intergenic
950105692 3:10386938-10386960 TGGTTTTTAAAATGCTAGCAGGG - Intronic
955838685 3:63087586-63087608 AGACTTTTAACTTAATAGCAGGG - Intergenic
956617946 3:71191977-71191999 TGGGTTTTTACCTACTAGCAAGG + Intronic
956629705 3:71304118-71304140 AGGTTTTTGCCCTACTAGAATGG - Intronic
956635550 3:71360792-71360814 ATGTTTTTAACCTACTCAGATGG + Intronic
961076597 3:123988435-123988457 AGATTTAAAACCTACAAGCAAGG + Intronic
963726672 3:148930352-148930374 ACCTTTCTAACCTCCTAGCAAGG - Intergenic
964305799 3:155338374-155338396 AGGTGTTTACCTTAGTAGCAGGG - Intergenic
967222124 3:187256269-187256291 ATTTTTTTAACCTACTACCAAGG - Intronic
970270109 4:14337389-14337411 TGGTTTTTCACCTACAAGGAAGG + Intergenic
975223616 4:71843359-71843381 AGATTTGTAACCAAGTAGCAGGG + Intergenic
979804888 4:124959211-124959233 AGGTTTTTAGTCTAGAAGCATGG - Intergenic
980064834 4:128175236-128175258 TGGTTTTTTTCCTAGTAGCAAGG + Intronic
981243371 4:142505742-142505764 AGGATTTAAACATAGTAGCATGG - Intronic
981341528 4:143627153-143627175 GAATTTATAACCTACTAGCAAGG + Intronic
982620989 4:157704853-157704875 ATGCTTTTAACCTGCTAGGAAGG - Intergenic
987514898 5:18892655-18892677 AGGTTTTTAATCCACTCACATGG + Intergenic
988255323 5:28811168-28811190 AGATTTTTAACTTACTACCCTGG - Intergenic
989597838 5:43173306-43173328 AGGTTTTTCACCTATTAGAGGGG - Exonic
994548515 5:101202823-101202845 TGGTTTTTAAACTACTAGTTTGG - Intergenic
997790089 5:136751216-136751238 ATGCTATTAACCCACTAGCAAGG + Intergenic
1000666511 5:164004447-164004469 TGGATTTGAACCTACAAGCAAGG - Intergenic
1004644873 6:17551137-17551159 ATGTTTTGAATCTACTAACAGGG + Intronic
1005251405 6:23950443-23950465 ATATTTTTAAACTACTGGCAAGG + Intergenic
1012492897 6:99802142-99802164 AGATTTTTGACCAACTATCAAGG + Intergenic
1014094994 6:117450004-117450026 AAGTTTTTCAGCTTCTAGCAAGG - Intronic
1014595982 6:123339194-123339216 AGGTTTTCACCATACTAGCCAGG + Intronic
1014779045 6:125542216-125542238 AGGACTTTAACATACAAGCAGGG + Intergenic
1016682552 6:146847477-146847499 AGCATTTTAACAGACTAGCAAGG + Intergenic
1024211547 7:47210136-47210158 CGGTTATTAACCAACTATCATGG + Intergenic
1033200948 7:139369604-139369626 AGGTTTTTCTTCTACTAACAAGG + Intronic
1035192262 7:157181385-157181407 AGTTCTTTAACATGCTAGCAAGG - Intronic
1038108068 8:24459614-24459636 AGGTTTTTAAAAAACTAGCCAGG - Intronic
1043974720 8:86571545-86571567 AGGGTTTTATCATATTAGCAAGG + Intronic
1045889213 8:107134693-107134715 AGGGTTTTACCCTGCTAGCCAGG + Intergenic
1050136842 9:2474384-2474406 AGGTTTTTAACCTAATCTCGCGG + Intergenic
1057714181 9:97476647-97476669 AGGTTCTTAACCTAGATGCAAGG + Intronic
1189795636 X:44643661-44643683 AAATTTTTGACCTTCTAGCAGGG - Intergenic
1197776681 X:130122644-130122666 AGGCTTTCAACCTAATACCAAGG - Intergenic