ID: 948242129

View in Genome Browser
Species Human (GRCh38)
Location 2:236446687-236446709
Sequence TTAGGGCTGCCACACGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948242122_948242129 -1 Left 948242122 2:236446665-236446687 CCTGGAAAACCCTCTTCTGTGCT 0: 1
1: 0
2: 1
3: 17
4: 235
Right 948242129 2:236446687-236446709 TTAGGGCTGCCACACGGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
948242117_948242129 21 Left 948242117 2:236446643-236446665 CCTGGGACCCACAGGCCGAATGC 0: 1
1: 0
2: 4
3: 8
4: 149
Right 948242129 2:236446687-236446709 TTAGGGCTGCCACACGGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
948242121_948242129 6 Left 948242121 2:236446658-236446680 CCGAATGCCTGGAAAACCCTCTT 0: 1
1: 0
2: 2
3: 19
4: 274
Right 948242129 2:236446687-236446709 TTAGGGCTGCCACACGGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
948242120_948242129 13 Left 948242120 2:236446651-236446673 CCACAGGCCGAATGCCTGGAAAA 0: 1
1: 0
2: 1
3: 9
4: 110
Right 948242129 2:236446687-236446709 TTAGGGCTGCCACACGGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
948242115_948242129 29 Left 948242115 2:236446635-236446657 CCGTGGTGCCTGGGACCCACAGG 0: 1
1: 0
2: 3
3: 41
4: 339
Right 948242129 2:236446687-236446709 TTAGGGCTGCCACACGGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
948242125_948242129 -10 Left 948242125 2:236446674-236446696 CCCTCTTCTGTGCTTAGGGCTGC 0: 1
1: 0
2: 2
3: 15
4: 206
Right 948242129 2:236446687-236446709 TTAGGGCTGCCACACGGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
948242119_948242129 14 Left 948242119 2:236446650-236446672 CCCACAGGCCGAATGCCTGGAAA 0: 1
1: 0
2: 1
3: 15
4: 97
Right 948242129 2:236446687-236446709 TTAGGGCTGCCACACGGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948242129 Original CRISPR TTAGGGCTGCCACACGGTGT GGG Intronic