ID: 948244098

View in Genome Browser
Species Human (GRCh38)
Location 2:236463790-236463812
Sequence GAACCAGATGTGGCTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948244089_948244098 29 Left 948244089 2:236463738-236463760 CCTTAGCAGCTTGAAACAACAAA 0: 1
1: 3
2: 16
3: 31
4: 284
Right 948244098 2:236463790-236463812 GAACCAGATGTGGCTCAGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948244098 Original CRISPR GAACCAGATGTGGCTCAGCT GGG Intronic
900310789 1:2032305-2032327 GAGCCGGATCTGGGTCAGCTGGG + Intergenic
900476657 1:2879335-2879357 GGACAAGATGTGGCTCAGCTGGG + Intergenic
900799883 1:4730712-4730734 GGCCCAGATGTGGCTCAACATGG - Intronic
901829088 1:11881250-11881272 GAGCCAGATGTTGCAGAGCTGGG + Intergenic
901925237 1:12561774-12561796 GAACCAGAGGTGGCTCAGACTGG - Intergenic
902145617 1:14396337-14396359 ACACCAGCTATGGCTCAGCTAGG + Intergenic
902213269 1:14918891-14918913 AATCCAGGTGTGGCTTAGCTGGG - Intronic
902687844 1:18090575-18090597 AATCCAGGTGTGGCTTAGCTGGG + Intergenic
903645909 1:24896443-24896465 GAACCAGGTGTCGCTGAGCTGGG - Intergenic
904206550 1:28859220-28859242 GATACAGATGTTGATCAGCTTGG - Exonic
904311996 1:29635031-29635053 GAGCCACATGTGGCTCACCGTGG + Intergenic
904956408 1:34287687-34287709 AATCCAGGTGTGGCTTAGCTGGG - Intergenic
912040742 1:105386758-105386780 GAAGTTGAAGTGGCTCAGCTTGG + Intergenic
912548032 1:110465398-110465420 GACCCATCTGGGGCTCAGCTGGG + Intergenic
912580879 1:110719858-110719880 AAAAGAGATGTGGCTCAGTTTGG + Intergenic
913130801 1:115837675-115837697 GCCCCAGAAGTGGCTCATCTCGG + Exonic
914457483 1:147849643-147849665 CATCCAGACATGGCTCAGCTGGG + Intergenic
915542169 1:156574380-156574402 GGACCAGATGAGCCTCATCTTGG + Intergenic
915661941 1:157411935-157411957 AATCCAGGTGTGGTTCAGCTGGG + Intergenic
915765310 1:158356110-158356132 GAAACAGCTGAGGCTCTGCTGGG + Intronic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
922880472 1:228976621-228976643 CAACCAGATGCTGCCCAGCTGGG - Intergenic
923820726 1:237437340-237437362 GACCCAGATGTGGCTGGGCGCGG - Intronic
924577393 1:245292757-245292779 CAACCAGATGTGTATCTGCTAGG + Intronic
1064832627 10:19488447-19488469 GAAACAGAAGTGTCTCACCTGGG + Intronic
1065143244 10:22740333-22740355 GAGCTAGCTGGGGCTCAGCTGGG + Intergenic
1067441422 10:46311043-46311065 GAACAAGTTGTGGCTCACCTGGG + Intronic
1067757870 10:49018817-49018839 GAATCAGAGGTGACTGAGCTTGG + Exonic
1069825263 10:71251015-71251037 GACTCAGATCTGGCTCAGTTGGG + Intronic
1071305242 10:84293788-84293810 GAACCAGCTGGGGCTCTGCAGGG - Intergenic
1075004589 10:118820760-118820782 GATTCAGATGTGGCTGGGCTAGG - Intergenic
1075399579 10:122151392-122151414 GAACCAAATGTGCCAAAGCTTGG + Intronic
1077607214 11:3620387-3620409 CAACCAGAAGCGGGTCAGCTGGG + Intergenic
1079606322 11:22372617-22372639 GAACAAGACGTGGATCAGATAGG + Intronic
1081862386 11:46340693-46340715 GAGACAGATGTGTCTGAGCTGGG - Intronic
1083489569 11:63005999-63006021 GAACCAGATGTGGAGCAAATGGG + Intronic
1083705705 11:64512916-64512938 GAAAGAGAGGTGGCTCAGGTGGG - Intergenic
1084408488 11:68992484-68992506 GAACCAGGCGTGGGTCAGCCAGG + Intergenic
1085117432 11:73942239-73942261 GAAACAGATATGGCTTATCTTGG - Intergenic
1085706683 11:78792621-78792643 GCACCAGGTGTGGCCCAGCATGG + Intronic
1085711982 11:78837495-78837517 GCACCACATCAGGCTCAGCTTGG + Intronic
1087134863 11:94706426-94706448 GAAGCAGAGTTGGCTCAGCCAGG + Intronic
1087968704 11:104452398-104452420 AAAACTGATGTGACTCAGCTGGG - Intergenic
1088533054 11:110831224-110831246 GAACAAGATCTGGCTTACCTTGG + Intergenic
1088701198 11:112413622-112413644 AATCCAGATGTGGCTTAGTTAGG - Intergenic
1089924851 11:122246738-122246760 GTACATGATGTGGCTCAGTTGGG - Intergenic
1090924181 11:131235285-131235307 GGACCAGATGAGGCACACCTGGG - Intergenic
1096874291 12:54615248-54615270 GAGCCAGACTTGGCTCAGCCTGG + Intergenic
1097078458 12:56412356-56412378 GAACCAGATGTGCAGCAGCAAGG + Intergenic
1098290719 12:68955054-68955076 GAGCCAGATGTGGAGCAGCAAGG - Intronic
1103173817 12:118844482-118844504 GAACCAGATGTGGAACTGCGAGG - Intergenic
1104570974 12:129925821-129925843 GACCAAGATGTGGAGCAGCTGGG + Intergenic
1104915286 12:132261252-132261274 GAACCACATGTGGTTCAGCGTGG + Intronic
1106185410 13:27405327-27405349 GAACCATAAGAGCCTCAGCTTGG - Intergenic
1111247282 13:85556029-85556051 AATCCAGCTGTGGCTAAGCTGGG - Intergenic
1112041976 13:95555827-95555849 CCACCAGATGTGGCTGACCTGGG - Intronic
1115923598 14:38406167-38406189 GAAACAGAAGTGGTTCAACTTGG + Intergenic
1117412973 14:55467686-55467708 GAGCCAGGTGTGGCGCAGCGAGG + Intergenic
1119098205 14:71854107-71854129 AAAGCAGATGTGTCTGAGCTGGG + Intergenic
1119980569 14:79076344-79076366 AATCCAGATGTGGCTTAGCTGGG + Intronic
1120311287 14:82831498-82831520 GAATCAAATGTGGCTTAGCTGGG + Intergenic
1120616624 14:86714149-86714171 GAAGAAGATGTGACACAGCTTGG + Intergenic
1120755724 14:88242330-88242352 GAACCATATGTGGCCCACCAGGG - Intronic
1121005648 14:90489158-90489180 GAACCAGGTGGGGCTCAGTGGGG + Intergenic
1122945751 14:105008122-105008144 GGCCCAGATGTGGCCCAGCAGGG + Intronic
1123141174 14:106080616-106080638 GAACCATGTGTTTCTCAGCTGGG - Intergenic
1124641619 15:31399681-31399703 GAGTCAGAGCTGGCTCAGCTTGG + Intronic
1124871200 15:33544760-33544782 GAACCAGATGTGACCCAGAAGGG + Intronic
1128531119 15:68448697-68448719 GAAGCAGCTGAGGCTCAGATAGG - Intergenic
1129597217 15:76974419-76974441 GGGCCATATGTAGCTCAGCTTGG + Intergenic
1129869490 15:78931581-78931603 GCCTCAGATGTGGCTCAGCCAGG - Intronic
1131155558 15:90073165-90073187 GAAGCAGATGTGGCACTGGTAGG - Exonic
1132660187 16:1057789-1057811 GAACCAGGTGTGGTGGAGCTGGG + Intergenic
1134336283 16:13302581-13302603 GAAGCAGGAGTGGCACAGCTGGG - Intergenic
1134620779 16:15687553-15687575 GGACAAGATGTTGCTCAGGTAGG - Intronic
1136222169 16:28835766-28835788 GACCCAGAAGTGGGACAGCTGGG - Intronic
1138109897 16:54315462-54315484 GACTCGGATGTGGCACAGCTGGG - Intergenic
1138310616 16:56020463-56020485 GATCCAGAGGAGGCCCAGCTTGG + Intergenic
1139560319 16:67737685-67737707 AAACCAGCTGTGTGTCAGCTGGG - Intronic
1139932745 16:70542411-70542433 GAACCTGAAGTGGCTCAGAATGG + Intronic
1143995568 17:11003616-11003638 CACCCACATGTGGCTCAGCTTGG + Intergenic
1144387815 17:14766212-14766234 GAATAAGTTGTGGCTCAGGTAGG - Intergenic
1145942508 17:28749984-28750006 TAACCAGAGGGGGCACAGCTAGG - Exonic
1147326803 17:39673551-39673573 GAAGCGGATGAGGCTCAGGTAGG + Exonic
1148073404 17:44921642-44921664 GGACCAGATGTGGCCCTGGTGGG + Intergenic
1148252311 17:46094385-46094407 GAACCTGATGTGGCTGCGCGTGG - Intronic
1148434686 17:47674025-47674047 GAACCAAATCTGACTGAGCTAGG - Intronic
1148508057 17:48143951-48143973 GAAGCAGATGAGTCTCAGCAGGG + Intronic
1150505706 17:65696562-65696584 GAACCAGATGAACCTCCGCTGGG + Intronic
1150968016 17:69994064-69994086 GATCTAGGTGTGGCTTAGCTGGG + Intergenic
1151211741 17:72549530-72549552 GATCTAGATGTGGCTTAGTTGGG - Intergenic
1203169020 17_GL000205v2_random:130029-130051 GAAAAACGTGTGGCTCAGCTTGG + Intergenic
1203174587 17_GL000205v2_random:185073-185095 GAAAAAAGTGTGGCTCAGCTTGG - Intergenic
1154356399 18:13625610-13625632 GGACCAGAACTGGCTGAGCTGGG - Intronic
1155815191 18:30298532-30298554 GAACCAAATGTGTCTCTGCCAGG - Intergenic
1156519672 18:37711563-37711585 GAACTGGATGTGGATCAGATTGG - Intergenic
1157556090 18:48613734-48613756 GACACAGATGTGGCCAAGCTTGG + Intronic
1159057087 18:63476930-63476952 GAAGCAGCGGTGGCTCACCTGGG - Exonic
1159609276 18:70508473-70508495 GCACCAGTTGTGGCTCATCCAGG + Intergenic
1159775844 18:72602038-72602060 AGCCCAGATGTGGCTCAGCAGGG - Intronic
1161361442 19:3852250-3852272 TGGCCAGATGGGGCTCAGCTGGG + Intronic
1163385666 19:16998526-16998548 GGAGCAGATGTGTCTCAGGTGGG + Intronic
1163929006 19:20370742-20370764 GAACCAGAAGTGGGACAGCTTGG - Intergenic
1164563224 19:29308391-29308413 GAGCCAGAGATGGCCCAGCTGGG - Intergenic
1165759216 19:38310752-38310774 GCACCAGCTGTGCCTCTGCTTGG + Intronic
1167661596 19:50798863-50798885 GAACCAGCTCTGGCCCAGGTGGG + Exonic
926844243 2:17116755-17116777 GGACGAGAAGTGGCTCAGATGGG - Intergenic
927881867 2:26694602-26694624 GACCCAGAGGTGCCCCAGCTGGG - Intronic
932092263 2:68816787-68816809 GACCCAGATCTGGCTCGGCTGGG + Intronic
932705763 2:74023623-74023645 CAACCAGATGTGGCCAAGCTAGG - Intronic
933968597 2:87451562-87451584 CAACCATATGTGGCAAAGCTAGG - Intergenic
935176042 2:100649427-100649449 GAACCACAAGTGGCCCAACTGGG - Intergenic
936325197 2:111498943-111498965 CAACCATATGTGGCAAAGCTAGG + Intergenic
937105929 2:119312598-119312620 GAACCAGATGTTTTTTAGCTTGG - Intronic
937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG + Intronic
937750547 2:125472007-125472029 GAAGCAGACTTGGCTCAGCCTGG + Intergenic
937849746 2:126621617-126621639 AAGCCAGACGTGGCTCAGGTGGG - Intergenic
939883588 2:147657247-147657269 GAGCCAGATGTGGCTGCTCTTGG - Intergenic
942075487 2:172353381-172353403 GAACAAGATGTGTCTAATCTTGG - Intergenic
943724898 2:191243627-191243649 GGGCCTGATTTGGCTCAGCTAGG + Intergenic
946103774 2:217351678-217351700 CAAGCAGGTGTGGTTCAGCTGGG + Intronic
946668273 2:222074224-222074246 GAACTGGATGTGGCCCTGCTTGG - Intergenic
947795940 2:232894064-232894086 AAGCCACATGGGGCTCAGCTGGG - Intronic
948244098 2:236463790-236463812 GAACCAGATGTGGCTCAGCTGGG + Intronic
948528104 2:238585958-238585980 CAACTACATGTGGCTCAGCTGGG - Intergenic
948800138 2:240429760-240429782 TGACCCGATGTGGCTGAGCTTGG + Intergenic
948961740 2:241344273-241344295 GCACCAGGGGTGGCTCAGCCTGG - Intronic
1168832873 20:856575-856597 GAACCTGATGTGCGTTAGCTGGG - Intronic
1169706845 20:8515799-8515821 TATCTAGATTTGGCTCAGCTGGG + Intronic
1171309679 20:24136120-24136142 GAAAGAGATGTGGCTGAGCATGG - Intergenic
1172709422 20:36909376-36909398 GAACCAGCTGTGGCTGGGCGCGG + Intronic
1172812466 20:37658635-37658657 TAACCAGATCTGGCCTAGCTGGG + Intergenic
1174262947 20:49310561-49310583 GATCCAGGTGTGGCTTAGTTAGG + Intergenic
1176130980 20:63496755-63496777 GACCCAGATGGGACCCAGCTGGG + Intronic
1176332911 21:5565695-5565717 GAAAAAAGTGTGGCTCAGCTTGG - Intergenic
1176394846 21:6255257-6255279 GAAAAAAGTGTGGCTCAGCTTGG + Intergenic
1176402736 21:6329123-6329145 GAAAAACGTGTGGCTCAGCTTGG - Intergenic
1176434421 21:6659981-6660003 GAAAAACGTGTGGCTCAGCTTGG + Intergenic
1176442311 21:6733848-6733870 GAAAAAAGTGTGGCTCAGCTTGG - Intergenic
1176458683 21:6987051-6987073 GAAAAACGTGTGGCTCAGCTTGG + Intergenic
1176466573 21:7060917-7060939 GAAAAAAGTGTGGCTCAGCTTGG - Intronic
1176490134 21:7442695-7442717 GAAAAAAGTGTGGCTCAGCTTGG - Intergenic
1178783727 21:35632846-35632868 GAGCCACCTGTGGCTCAACTTGG + Intronic
1181343105 22:22198600-22198622 GAGCAGGATGTGCCTCAGCTGGG - Intergenic
1181427293 22:22851936-22851958 GAGACAGATGTGACACAGCTAGG - Intronic
1183924814 22:41198025-41198047 GAAACAGAAGTGGCTCATATGGG + Intergenic
1184192939 22:42907133-42907155 GAGCCTGGGGTGGCTCAGCTTGG + Intronic
949337277 3:2989248-2989270 GAAGAAGATGAGGCTCAGGTTGG + Intronic
950095905 3:10330296-10330318 GCACCAGATGTGGCAGAGCCAGG - Intronic
950133007 3:10560480-10560502 GAGAAAGATGGGGCTCAGCTGGG - Intronic
950931110 3:16789698-16789720 GCCCCAGCTGTGGCTCAGATGGG - Intergenic
952585422 3:34886820-34886842 GCTCCAGATGTGACTCAGGTGGG + Intergenic
952942858 3:38456501-38456523 GAAACAGCTGTGTCTTAGCTGGG + Intronic
953915481 3:46917533-46917555 GAATCAGGAGTGGCTTAGCTGGG - Intergenic
954106733 3:48413640-48413662 CAGCCAGATGTGGCTGGGCTGGG - Intronic
954635358 3:52068198-52068220 GAAGCCGCTGTGGCTCAGCATGG + Intergenic
957084327 3:75666009-75666031 GGATCAGATGAGGCTAAGCTGGG + Exonic
961288034 3:125822322-125822344 AAACCAGGCGTGACTCAGCTGGG + Intergenic
962877918 3:139550106-139550128 TAACCAAATGTGGCTCAGCATGG + Intergenic
963921174 3:150907441-150907463 GAACCACATCTGGTTCACCTTGG - Exonic
965103797 3:164335080-164335102 GAACCAGTAGTGGGGCAGCTCGG + Intergenic
967098790 3:186198877-186198899 TAACCTGATGTGGCTCAGAAAGG + Intronic
967905258 3:194494218-194494240 GATCCAGATGTGGCTGAGGAAGG - Exonic
968844630 4:3033614-3033636 GAAACAGATCTGGCCCAGGTTGG + Intronic
969207806 4:5660884-5660906 GAAGCAGCTGAGGCTCAGCTAGG - Intronic
970191089 4:13519722-13519744 AAACCAGAGGGAGCTCAGCTGGG - Intergenic
979407556 4:120331808-120331830 GACCCAGGTGTGGCTTAGCCAGG - Intergenic
984947812 4:184983506-184983528 GAAAGAGATGTGGCTGTGCTGGG - Intergenic
985822082 5:2167204-2167226 GAACCAGCTGGGGCTCTCCTTGG - Intergenic
987663919 5:20911110-20911132 GAACCAGAAGTGTCTCAGTAGGG + Intergenic
988758770 5:34291081-34291103 GAACCAGAAGTGTCTCAGTAGGG - Intergenic
989312842 5:40040776-40040798 AGACAAGCTGTGGCTCAGCTAGG + Intergenic
990005575 5:50940266-50940288 GCACCAGTTGTGGCTAAGGTAGG - Intergenic
993646846 5:90473705-90473727 GAAACAGAAGTGGCTCTGCGAGG + Intronic
994729075 5:103470724-103470746 GAAGCAGATGTGGCTGGGCACGG - Intergenic
997622243 5:135306526-135306548 GAAGCTGATGTGGCTCAGACAGG + Intronic
997972565 5:138415738-138415760 GATCCAAATTTGGCTCAGCACGG - Intronic
998617006 5:143751838-143751860 TAACCAGAGGGGGCACAGCTAGG + Intergenic
1002520836 5:179792649-179792671 AAACCAGATATGCCCCAGCTGGG - Intronic
1002783247 6:382836-382858 GACCCAGCTCTGGCTCAGGTGGG - Intergenic
1002931328 6:1637114-1637136 GAGCCAGATGGAGCCCAGCTGGG - Intronic
1003349296 6:5301005-5301027 TAACCAGATGTGGCTGGGCATGG - Intronic
1003557804 6:7156515-7156537 AACCCAGATGTGGCTCAGTGCGG - Intronic
1004079564 6:12378324-12378346 GAACCTGATGGGGCAGAGCTAGG + Intergenic
1006193149 6:32221648-32221670 CAACCAGTTGTGGCACAGCATGG - Intronic
1006338323 6:33432264-33432286 CTACCAGATGTGGCTCAGTTGGG + Intronic
1007960876 6:45957874-45957896 GAACCAGGTGGGGCTCAGTTGGG + Intronic
1008793100 6:55263719-55263741 GAAACAGATGTGGTACATCTTGG - Exonic
1010201535 6:73286589-73286611 GAACCAGATGGGGCAGAGCATGG + Intronic
1011356906 6:86480527-86480549 GAACAAGAAGTGGGGCAGCTCGG - Intergenic
1019421281 7:952455-952477 GTACCTGCTGTGGCCCAGCTGGG - Intronic
1019709312 7:2511116-2511138 GACCCAGCTGGGGCTCAGCAGGG - Intergenic
1022724828 7:32971689-32971711 GAAACAGTTGTTGCCCAGCTTGG - Intronic
1024548097 7:50539037-50539059 GAAGCAGAGGTGGCTCAGCTGGG + Intronic
1025048774 7:55716138-55716160 GAAACAGTTGTTGCCCAGCTTGG + Intergenic
1030251177 7:107446822-107446844 AATCCAGAAGTGGCTTAGCTGGG - Intronic
1030533255 7:110736082-110736104 GCACCAGCTGTGGCTCAAGTAGG + Intronic
1030859588 7:114608216-114608238 GAACCTGGTGTGGATCATCTAGG + Intronic
1035615305 8:995670-995692 GAAACAGAAGTGACTCAGCATGG + Intergenic
1036251277 8:7164909-7164931 AATCCAGGTGTGACTCAGCTGGG - Intergenic
1036366210 8:8122551-8122573 AATCCAGGTGTGACTCAGCTGGG + Intergenic
1037160398 8:15764010-15764032 TAACCAGATGAGGCTTAGGTTGG - Intronic
1037527385 8:19740179-19740201 GGACCAGATGTGGCCCAGGTGGG - Intronic
1038691495 8:29767814-29767836 GATCTAGGTGTGGCTCAGCGGGG - Intergenic
1039609379 8:38907008-38907030 CAACCAGAAATGGCTCAACTGGG - Intronic
1047494940 8:125402714-125402736 GACCCTGCTGTGGGTCAGCTTGG + Intergenic
1047994049 8:130316561-130316583 GGAAAAGAAGTGGCTCAGCTGGG + Intronic
1049175293 8:141189009-141189031 GAACCAGGTGTGGGTTGGCTCGG + Exonic
1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG + Intronic
1053308601 9:37001348-37001370 GCAGCAGATGTGCCTAAGCTGGG - Intronic
1056795733 9:89657562-89657584 AAACCTGATCTCGCTCAGCTTGG - Intergenic
1059776398 9:117479636-117479658 AAACCACAAGTGGCTCAGATTGG - Intergenic
1061424365 9:130489881-130489903 AAACCAGAAGTGGCCTAGCTGGG + Intronic
1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG + Intronic
1062001044 9:134215814-134215836 AACCCAGATGTCCCTCAGCTGGG + Intergenic
1062580314 9:137226527-137226549 AATCCAGACCTGGCTCAGCTAGG - Intergenic
1203429175 Un_GL000195v1:74588-74610 GAAAAAAGTGTGGCTCAGCTTGG + Intergenic
1203437114 Un_GL000195v1:148664-148686 GAAAAACGTGTGGCTCAGCTTGG - Intergenic
1186904686 X:14098662-14098684 AATCCAGTTGTGGCTTAGCTGGG + Intergenic
1189179965 X:38994490-38994512 GATTCAGAAGTGGCTCAGTTGGG + Intergenic
1190313800 X:49136589-49136611 AAAGCAGATTTGGCTCAGCGTGG + Intergenic
1190492443 X:50995662-50995684 GAACAAGGTGTGAATCAGCTTGG + Intergenic
1195332800 X:103819242-103819264 TAACTAGATGTGGCACAGCTTGG + Intergenic
1195770883 X:108349907-108349929 GAAAAACATGTGGCTCACCTAGG - Intronic
1195872652 X:109501974-109501996 ACCCCAGATGTGGCTCAGGTGGG - Intergenic
1196713011 X:118782890-118782912 GAACAAGTTGAGGCTCAGCACGG - Intronic
1197563341 X:128051126-128051148 CAAGCAGATGTGGGTCACCTCGG - Exonic
1197723307 X:129759442-129759464 GAATAGGATGAGGCTCAGCTTGG - Intronic