ID: 948246067

View in Genome Browser
Species Human (GRCh38)
Location 2:236487191-236487213
Sequence ACGGCACTTCATGGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948246067 Original CRISPR ACGGCACTTCATGGTTTTAA AGG Intronic
902081592 1:13824667-13824689 ACAGCACTTCATGCTTGTGAGGG - Exonic
903010099 1:20323682-20323704 ACACCACTTCATGTTTTTATGGG - Intronic
904596920 1:31652660-31652682 AGGCCCCTTCATGGTTTTCATGG + Exonic
912670730 1:111621184-111621206 ACGGCCCTTCATGCTTTTGAAGG - Intronic
918465909 1:184821342-184821364 AGCGCACTTCCTTGTTTTAAAGG + Intronic
1062780087 10:195621-195643 ACTGCACAGCATGTTTTTAAGGG + Intronic
1067655899 10:48190929-48190951 ATAGCACTTCATTGTTTAAAAGG - Intronic
1068979966 10:63051770-63051792 AAGGCATTTCATGGTTCTAGTGG + Intergenic
1071128676 10:82366534-82366556 ACGACTCTTCATGGGTTTAAAGG + Intronic
1072416523 10:95251193-95251215 TGGGCACTTCATGGTTCTGATGG - Intronic
1072799150 10:98380755-98380777 AGTGCACTTCAGGGTTTTACAGG + Intergenic
1075721810 10:124591873-124591895 GCAACACTTCCTGGTTTTAAGGG + Intronic
1083546849 11:63555225-63555247 AAGGCACTTCAGAGTTGTAAGGG + Intronic
1084755127 11:71233586-71233608 ACGGCACTGCAGGTTTTCAAAGG + Intronic
1085080155 11:73627313-73627335 ACGGAACTGAATGGTTTCAATGG - Intergenic
1093955019 12:25206958-25206980 AAATCACTTCATTGTTTTAAAGG - Intronic
1100051364 12:90452216-90452238 ATGGCACTTCATCTTTTAAAGGG + Intergenic
1108439068 13:50430551-50430573 AGAGAACTTCATGATTTTAAAGG - Intronic
1111390543 13:87588917-87588939 ACTAAACTTCATGGTTGTAATGG - Intergenic
1113328294 13:109304749-109304771 TCAGCACTTCAGGGTTGTAAAGG + Intergenic
1129495782 15:75978371-75978393 ACGGGACTTCATTTTTTTTATGG + Intronic
1131261636 15:90890861-90890883 ATGCCACTCCATGGTTGTAAGGG + Intronic
1147702097 17:42402734-42402756 ACTGCAGTTCATTGTTTTAAGGG - Exonic
1150138722 17:62711171-62711193 ACAGCACTGCAGGGTTTTCAGGG + Intronic
1155604958 18:27594451-27594473 CCGGGAGTTCATGGTTTTAATGG - Intergenic
1164814389 19:31183623-31183645 CCTGCATTTCATTGTTTTAAAGG + Intergenic
928651222 2:33405596-33405618 TAGGAACTTCTTGGTTTTAAAGG - Intergenic
934882802 2:97997951-97997973 TCAGCACTTCATGGTTGGAAAGG - Intergenic
936326376 2:111509041-111509063 ACGGCACGACATGGTTTAACTGG + Intergenic
936944405 2:117917526-117917548 TCCGAAGTTCATGGTTTTAATGG - Exonic
937153694 2:119703270-119703292 ATGGCACATCATGGTTTCCAGGG + Intergenic
938671674 2:133592455-133592477 CTAGCAATTCATGGTTTTAATGG - Intergenic
939325746 2:140685994-140686016 ACTGAACTTCATGGTGTGAAGGG + Intronic
948246067 2:236487191-236487213 ACGGCACTTCATGGTTTTAAAGG + Intronic
1176107631 20:63396888-63396910 ACTGAACTTCATGCTTTAAATGG - Intergenic
1179132505 21:38651143-38651165 GAGTCACTTCATGCTTTTAAAGG - Intronic
950122624 3:10491878-10491900 ACAGCACGTCATAGTTTTATTGG - Intronic
951681769 3:25302425-25302447 TCGGCACTTCATTTTTTTTATGG - Intronic
952559838 3:34578650-34578672 AAGGCACTACCTGGTTTTAGTGG - Intergenic
958656860 3:97013505-97013527 ATGGCAATTCATGGTTTTTCAGG - Intronic
961947436 3:130707174-130707196 AAAGCACATAATGGTTTTAAAGG - Intronic
963592237 3:147275856-147275878 ACGGCACTACATAGTGGTAAAGG + Intergenic
963965365 3:151362748-151362770 AAGACAATTCATGTTTTTAATGG + Intronic
964745135 3:160005210-160005232 ATGCCACTTCCTGGTTTTAGGGG + Intergenic
964890105 3:161524556-161524578 ACGGCACTTCATCCTGTTACGGG + Intergenic
971130727 4:23806917-23806939 ACTGCATTTAATGCTTTTAATGG + Intronic
974862472 4:67539485-67539507 AAGGCACTTCATTGTTATACGGG - Intronic
975362962 4:73493234-73493256 ATGCCACTGAATGGTTTTAATGG + Intronic
980040067 4:127928900-127928922 ATGGCATTTCATGGTTTCAATGG - Intronic
984194541 4:176642706-176642728 ACGCCACCTCATGGTGTCAATGG + Intergenic
985581792 5:701039-701061 ACTGCACTGCATGGGATTAATGG + Intergenic
985596409 5:792357-792379 ACTGCACTGCATGGGATTAATGG + Intergenic
986562949 5:9081793-9081815 ACTGAACTTCAGAGTTTTAATGG - Intronic
989804781 5:45589688-45589710 ATGGCAATACATGTTTTTAATGG + Intronic
990121650 5:52461795-52461817 AGGGGACTGCATGGTTTTTAAGG + Intergenic
991402492 5:66267754-66267776 ATGGTAATTCATGGCTTTAAAGG - Intergenic
995701614 5:114941691-114941713 ACAGGATTTCATGTTTTTAATGG - Intergenic
999537487 5:152533224-152533246 ACGCCACTTGATGGTTAGAAAGG + Intergenic
1000364123 5:160475249-160475271 AAGTCACCTCATGGTTATAAGGG + Intergenic
1007000040 6:38302437-38302459 ACAGCATTTCATTCTTTTAATGG + Intronic
1011885973 6:92096240-92096262 ACGAGACTTTATGGTTTTATAGG + Intergenic
1014825568 6:126045789-126045811 AGGGCACATCATGGTTGTTAAGG + Intergenic
1015049985 6:128829040-128829062 ACGGCTCTTCATGGCTTTTGAGG - Intergenic
1016274603 6:142334388-142334410 AATTCACTTCATGGTTTTAGGGG - Intronic
1021934430 7:25615802-25615824 GGGGCACTTCAGGTTTTTAAGGG - Intergenic
1023117827 7:36879693-36879715 ACGGCAATCCATAGATTTAAAGG + Intronic
1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG + Intergenic
1025659872 7:63551240-63551262 CCGGCCCTAAATGGTTTTAAGGG - Intergenic
1027820756 7:83041178-83041200 AAGTCATTTCATGTTTTTAAAGG - Intronic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030116178 7:106064004-106064026 AGGGCACTTTATGGTTTACAGGG - Intergenic
1040276277 8:46015721-46015743 ACGGCACTTCAGGCTTGAAAGGG - Intergenic
1042262956 8:66878844-66878866 AAGGCACTTCGTGCTTTTCAAGG + Exonic
1042411467 8:68471173-68471195 GCTTCACTTAATGGTTTTAAGGG + Intronic
1045961674 8:107976046-107976068 AAGGCACTTCATGGGTTAACAGG - Intronic
1049431207 8:142566040-142566062 ACGGAAGTTTTTGGTTTTAATGG - Intergenic
1053559730 9:39178279-39178301 ACGTCTCTTATTGGTTTTAAAGG + Exonic
1054137385 9:61440664-61440686 ACGTCTCTTATTGGTTTTAAAGG - Intergenic
1054898752 9:70344350-70344372 ACGACACATCATGTTTTTCACGG - Intronic
1055360972 9:75489786-75489808 ATGAGACTTGATGGTTTTAAAGG + Intergenic
1056745133 9:89295080-89295102 AAAGCACTTCATGGATTTCATGG + Intergenic
1057946731 9:99336971-99336993 ATAGCACTTCAAGGTTTGAATGG - Intergenic
1058382473 9:104392565-104392587 ACTGAACTTGATTGTTTTAAAGG + Intergenic
1059541180 9:115132111-115132133 ACAGCTCTGCATGATTTTAAGGG - Intergenic
1187209659 X:17216935-17216957 ACCTCAGTTCATGGTCTTAAAGG + Intergenic
1194429412 X:93782537-93782559 AAGTCACTGCATGATTTTAAAGG + Intergenic
1197500344 X:127233302-127233324 ACGTGACTTCATGCTTTTTATGG - Intergenic
1200923269 Y:8631842-8631864 ACAGGAATTCATGGTTTTAAAGG - Intergenic
1201334829 Y:12869505-12869527 AGGGAAATTCATGGTTTGAAGGG + Intergenic