ID: 948247609

View in Genome Browser
Species Human (GRCh38)
Location 2:236499548-236499570
Sequence TGTAGTCCCAGCTACCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641875
Summary {0: 833, 1: 44541, 2: 164491, 3: 223530, 4: 208480}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948247609_948247618 28 Left 948247609 2:236499548-236499570 CCTCCTGGGTAGCTGGGACTACA 0: 833
1: 44541
2: 164491
3: 223530
4: 208480
Right 948247618 2:236499599-236499621 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
948247609_948247617 27 Left 948247609 2:236499548-236499570 CCTCCTGGGTAGCTGGGACTACA 0: 833
1: 44541
2: 164491
3: 223530
4: 208480
Right 948247617 2:236499598-236499620 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
948247609_948247619 29 Left 948247609 2:236499548-236499570 CCTCCTGGGTAGCTGGGACTACA 0: 833
1: 44541
2: 164491
3: 223530
4: 208480
Right 948247619 2:236499600-236499622 TGTATTTTTAGTAGAGATGGGGG 0: 1745
1: 3705
2: 3974
3: 3918
4: 4634
948247609_948247616 26 Left 948247609 2:236499548-236499570 CCTCCTGGGTAGCTGGGACTACA 0: 833
1: 44541
2: 164491
3: 223530
4: 208480
Right 948247616 2:236499597-236499619 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
948247609_948247612 -2 Left 948247609 2:236499548-236499570 CCTCCTGGGTAGCTGGGACTACA 0: 833
1: 44541
2: 164491
3: 223530
4: 208480
Right 948247612 2:236499569-236499591 CAGGCGTGTGCCACCACCTCAGG 0: 1
1: 192
2: 4252
3: 38293
4: 136686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948247609 Original CRISPR TGTAGTCCCAGCTACCCAGG AGG (reversed) Intronic